Search Results

Search found 9338 results on 374 pages for 'fedora 15'.

Page 323/374 | < Previous Page | 319 320 321 322 323 324 325 326 327 328 329 330  | Next Page >

• phpmyadmin “Forbidden: You don't have permission to access /phpmyadmin on this server.”

  - by Caterpillar

  I need to modify the file /etc/httpd/conf.d/phpMyAdmin.conf in order to allow remote users (not only localhost) to login # phpMyAdmin - Web based MySQL browser written in php # # Allows only localhost by default # # But allowing phpMyAdmin to anyone other than localhost should be considered # dangerous unless properly secured by SSL Alias /phpMyAdmin /usr/share/phpMyAdmin Alias /phpmyadmin /usr/share/phpMyAdmin <Directory "/usr/share/phpMyAdmin/"> Options Indexes FollowSymLinks MultiViews AllowOverride all Order Allow,Deny Allow from all </Directory> <Directory /usr/share/phpMyAdmin/setup/> <IfModule mod_authz_core.c> # Apache 2.4 <RequireAny> Require ip 127.0.0.1 Require ip ::1 </RequireAny> </IfModule> <IfModule !mod_authz_core.c> # Apache 2.2 Order Deny,Allow Allow from All Allow from 127.0.0.1 Allow from ::1 </IfModule> </Directory> # These directories do not require access over HTTP - taken from the original # phpMyAdmin upstream tarball # <Directory /usr/share/phpMyAdmin/libraries/> Order Deny,Allow Deny from All Allow from None </Directory> <Directory /usr/share/phpMyAdmin/setup/lib/> Order Deny,Allow Deny from All Allow from None </Directory> <Directory /usr/share/phpMyAdmin/setup/frames/> Order Deny,Allow Deny from All Allow from None </Directory> # This configuration prevents mod_security at phpMyAdmin directories from # filtering SQL etc. This may break your mod_security implementation. # #<IfModule mod_security.c> # <Directory /usr/share/phpMyAdmin/> # SecRuleInheritance Off # </Directory> #</IfModule> When I get into phpmyadmin webpage, I am not prompted for user and password, before getting the error message: Forbidden: You don't have permission to access /phpmyadmin on this server. My system is Fedora 20

  Read the article

• segmented reduction with scattered segments

  - by Christian Rau

  I got to solve a pretty standard problem on the GPU, but I'm quite new to practical GPGPU, so I'm looking for ideas to approach this problem. I have many points in 3-space which are assigned to a very small number of groups (each point belongs to one group), specifically 15 in this case (doesn't ever change). Now I want to compute the mean and covariance matrix of all the groups. So on the CPU it's roughly the same as: for each point p { mean[p.group] += p.pos; covariance[p.group] += p.pos * p.pos; ++count[p.group]; } for each group g { mean[g] /= count[g]; covariance[g] = covariance[g]/count[g] - mean[g]*mean[g]; } Since the number of groups is extremely small, the last step can be done on the CPU (I need those values on the CPU, anyway). The first step is actually just a segmented reduction, but with the segments scattered around. So the first idea I came up with, was to first sort the points by their groups. I thought about a simple bucket sort using atomic_inc to compute bucket sizes and per-point relocation indices (got a better idea for sorting?, atomics may not be the best idea). After that they're sorted by groups and I could possibly come up with an adaption of the segmented scan algorithms presented here. But in this special case, I got a very large amount of data per point (9-10 floats, maybe even doubles if the need arises), so the standard algorithms using a shared memory element per thread and a thread per point might make problems regarding per-multiprocessor resources as shared memory or registers (Ok, much more on compute capability 1.x than 2.x, but still). Due to the very small and constant number of groups I thought there might be better approaches. Maybe there are already existing ideas suited for these specific properties of such a standard problem. Or maybe my general approach isn't that bad and you got ideas for improving the individual steps, like a good sorting algorithm suited for a very small number of keys or some segmented reduction algorithm minimizing shared memory/register usage. I'm looking for general approaches and don't want to use external libraries. FWIW I'm using OpenCL, but it shouldn't really matter as the general concepts of GPU computing don't really differ over the major frameworks.

  Read the article

• Making a Login Work After Cache, Cookies, etc. Have Been Cleared

  - by John

  Hello, I am using the code below for a user login. The first I try to login after cache / cookies, etc. have been cleared, the browser refreshes and the user name is not logged in. After that, logging in works fine. Any idea how I can make it work the first time? Thanks in advance, John index.php: <?php if($_SERVER['REQUEST_METHOD'] == "POST"){header('Location: http://www...com/.../index.php?username='.$username.'&password='.$password.'');} require_once "header.php"; include "login.php"; require_once "footer.php"; ?> login.php: <?php if (!isLoggedIn()) { if (isset($_POST['cmdlogin'])) { if (checkLogin($_POST['username'], $_POST['password'])) { show_userbox(); } else { echo "Incorrect Login information !"; show_loginform(); } } else { show_loginform(); } } else { show_userbox(); } ?> show_loginform function: function show_loginform($disabled = false) { echo '<form name="login-form" id="login-form" method="post" action="./index.php?'.$_SERVER['QUERY_STRING'].'"> <div class="usernameformtext"><label title="Username">Username: </label></div> <div class="usernameformfield"><input tabindex="1" accesskey="u" name="username" type="text" maxlength="30" id="username" /></div> <div class="passwordformtext"><label title="Password">Password: </label></div> <div class="passwordformfield"><input tabindex="2" accesskey="p" name="password" type="password" maxlength="15" id="password" /></div> <div class="registertext"><a href="http://www...com/.../register.php" title="Register">Register</a></div> <div class="lostpasswordtext"><a href="http://www...com/.../lostpassword.php" title="Lost Password">Lost password?</a></div> <p class="loginbutton"><input tabindex="3" accesskey="l" type="submit" name="cmdlogin" value="Login" '; if ($disabled == true) { echo 'disabled="disabled"'; } echo ' /></p></form>'; }

  Read the article

• Programmatically Setting ControlTemplate Item

  - by Robert

  I'm having trouble figuring out how to programmatically setting the "Stroke" of my arrow. I'm using these buttons in a menu bar and I want the one currently selected to have it's arrow change to green and all the others gray. <Style x:Key="FooterGrayButtonStyle" TargetType="{x:Type Button}"> <Setter Property="HorizontalContentAlignment" Value="Center"/> <Setter Property="VerticalContentAlignment" Value="Center"/> <Setter Property="MinHeight" Value="35" /> <Setter Property="FontSize" Value="16"/> <Setter Property="Margin" Value="0,5,10,5" /> <Setter Property="Foreground" Value="White" /> <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="{x:Type Button}"> <Grid> <Border x:Name="Bd" Background="#FF535A65" BorderBrush="Black" BorderThickness="1" CornerRadius="10"> <Path x:Name="arrow" Stretch="Fill" Stroke="#FFB1BB1C" StrokeThickness="5" HorizontalAlignment="Right" Margin="5" StrokeEndLineCap="Round" StrokeStartLineCap="Round" StrokeLineJoin="Miter" Width="13" Height="23" Data="M0,0 L1,1 0,2" /> </Border> <ContentPresenter HorizontalAlignment="Left" Margin="15,-2,30,0" VerticalAlignment="{TemplateBinding VerticalContentAlignment}" SnapsToDevicePixels="{TemplateBinding SnapsToDevicePixels}" RecognizesAccessKey="True"/> </Grid> <ControlTemplate.Triggers> <Trigger Property="IsPressed" Value="True"> <Setter TargetName="Bd" Property="Background" Value="#FFB1BB1C" /> <Setter Property="Stroke" TargetName="arrow" Value="White"/> </Trigger> <Trigger Property="IsEnabled" Value="False"> <Setter Property="Stroke" TargetName="arrow" Value="#FFB7B7B7"/> <Setter Property="Foreground" Value="#FFB7B7B7"/> </Trigger> </ControlTemplate.Triggers> </ControlTemplate> </Setter.Value> </Setter> </Style>

  Read the article

• Make UEFI, GPT, Bootloader, SSD, USB, Linux and Windows work together

  - by user129552

  I like to use the latest hardware and the latest software; thus I have a Laptop (Lenovo X220) with UEFI instead of BIOS an SSD instead of an HDD GPT partitioning scheme instead of MBR USB to boot from instead of optical disks. I need to use both Windows and Linux. I tried to make them work alongside, but I didn't succeed. Most Linux distribution isos don't even really work on UEFI systems booted from USB. (Not even the self-claimed cutting-edge Fedora. I also tried Linux Mint Debian Edition and Sabayon Linux (according to this guide) which did not work. Only Ubuntu worked for me. I first installed Windows 8 which created sda1: Recovery, sda2: EFI system, sda3: msftres, sda4: NTFS Windows. Windows worked without a problem. I then created sda5: linux-swap and installed Ubuntu into sda6: btrfs. After rebooting, I was not presented GRUB2 as expected, but instead my system just booted into Ubuntu. I could no longer access Windows. After fixing dpkg in btrfs Ubuntu, I followed the Ubuntu documentation on UEFI booting. The result left me with a broken GRUB2, but interestingly, when I wanted to select the device to boot from, I was not only presented the internal SSD, an attached USB device, or LAN, but also Grub2 (broken), Ubuntu and Windows. The result is not very satisfying to me. What would I have to do to fix everything? Or differently asked, what operating system should I install at what point given my possibilities and requirements, so that I have a working bootloader in my UEFI GPT system which presents me a working Linux and Windows.

  Read the article

• Gamepad Control for Processing + Android to Control Arduino Robot

  - by Iker

  I would like to create a Multitouch Gamepad control for Processing and use it to control a remote Arduino Robot. I would like to make the GUI on Processing and compile it for Android. Here is the GUI Gamepad for Processing I have created so far: float easing = 0.09; // start position int posX = 50; int posY = 200; // target position int targetX = 50; int targetY = 200; boolean dragging = false; void setup() { size(500,250); smooth(); } void draw() { background(255); if (!dragging) { // calculate the difference in position, apply easing and add to vx/vy float vx = (targetX - (posX)) * easing; float vy = (targetY - (posY)) * easing; // Add the velocity to the current position: make it move! posX += vx; posY += vy; } if(mousePressed) { dragging = true; posX = mouseX; posY = mouseY; } else { dragging = false; } DrawGamepad(); DrawButtons(); } void DrawGamepad() { //fill(0,155,155); //rect(0, 150, 100, 100, 15); ellipseMode(RADIUS); // Set ellipseMode to RADIUS fill(0,155,155); // Set fill to blue ellipse(50, 200, 50, 50); // Draw white ellipse using RADIUS mode ellipseMode(CENTER); // Set ellipseMode to CENTER fill(255); // Set fill to white// ellipse(posX, posY, 35, 35); // Draw gray ellipse using CENTER mode } void DrawButtons() { fill(0,155,155); // Set fill to blue ellipse(425, 225, 35, 35); ellipse(475, 225, 35, 35); fill(255,0,0); // Set fill to blue ellipse(425, 175, 35, 35); ellipse(475, 175, 35, 35); } I have realized that probably that code will not support Multitouch events on Android so I came up with another code found on this link Can Processing handle multi-touch? So the aim of this project is to create de multitouch gamepad to use to control my Arduino Robot. The gamepad should detect which key was pressed as well as the direction of the Joystick. Any help appreciated.

  Read the article

• A NSMutableArray is destroying my life!

  - by camilo

  EDITED to show the relevant part of the code Hi. There's a strange problem with an NSMutableArray which I'm just not understanding... Explaining: I have a NSMutableArray, defined as a property (nonatomic, retain), synthesized, and initialized with 29 elements. realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; After the initialization, I can insert elements as I wish and everything seems to be working fine. While I'm running the application, however, if I insert a new element in the array, I can print the array in the function where I inserted the element, and everything seems ok. However, when I select a row in the table, and I need to read that array, my application crashes. In fact, it cannot even print the array anymore. Is there any "magical and logical trick" everybody should know when using a NSMutableArray that a beginner like myself can be missing? Thanks a lot. I declare my array as realSectionNames = [[NSMutableArray alloc] initWithCapacity:29]; I insert objects in my array with [realSectionNames addObject:[category categoryFirstLetter]]; although I know i can also insert it with [realSectionNames insertObject:[category categoryFirstLetter] atIndex:i]; where the "i" is the first non-occupied position. After the insertion, I reload the data of my tableView. Printing the array before or after reloading the data shows it has the desired information. After that, selecting a row at the table makes the application crash. This realSectionNames is used in several UITableViewDelegate functions, but for the case it doesn't matter. What truly matters is that printing the array in the beginning of the didSelectRowAtIndexPath function crashes everything (and of course, doesn't print anything). I'm pretty sure it's in that line, for printing anything he line before works (example): NSLog(@"Anything"); NSLog(@"%@", realSectionNames); gives the output: 2010-03-24 15:16:04.146 myApplicationExperience[3527:207] Anything [Session started at 2010-03-24 15:16:04 +0000.] GNU gdb 6.3.50-20050815 (Apple version gdb-967) (Tue Jul 14 02:11:58 UTC 2009) Copyright 2004 Free Software Foundation, Inc. GDB is free software, covered by the GNU General Public License, and you are welcome to change it and/or distribute copies of it under certain conditions. Type "show copying" to see the conditions. There is absolutely no warranty for GDB. Type "show warranty" for details. This GDB was configured as "i386-apple-darwin".sharedlibrary apply-load-rules all Attaching to process 3527. Still not understanding what kind of stupidity I've done this time... maybe it's not too late to follow the career of brain surgeon?

  Read the article

• Apache: How to enable Directory Index browsing at the Doc Root level?

  - by Brian Lacy

  I have several web development projects running on Fedora 13. I generally setup Apache to serve my larger projects as Virtual Hosts, but I've got several small projects cycling through that I don't really care to setup a VirtualHost for each one. Instead I'd like them all under a subdirectory of the main VirtualHost entry. I just want Apache to serve me the directory index when I browse to the host name. For example, the hostname projects.mydomain.com refers to /var/www/projects, and that directory contains only subdirectories (no index file). Unfortunately when I browse to the host directly I get: Forbidden You don't have permission to access / on this server. Additionally, a 404 Not Found error was encountered while trying to use an ErrorDocument to handle the request. But my virtual host entry in my apache config looks like this: <VirtualHost *> ServerName projects.mydomain.com DocumentRoot /var/www/projects <Directory "/var/www/projects"> Options +FollowSymlinks +Indexes AllowOverride all </Directory> </VirtualHost> What am I missing here?

  Read the article

• How to fix the position of the button in applet

  - by user1609804

  I'm trying to make an applet that has a buttons in the right, where each button is corresponding to a certain pokemon. I already did it, but the buttons isn't fixed.they keep following the mouse. please help. This is my code: import javax.swing.*; import java.awt.image.BufferedImage; import java.io.*; import javax.imageio.ImageIO; import java.applet.*; import java.awt.event.*; import java.awt.*; public class choosePokemon extends Applet implements ActionListener { private int countPokemon; private int[] storePokemon; private int x,y; //this will be the x and y coordinate of the button BufferedImage Picture; public int getCountPokemon(){ //for other class that needs how many pokemon return countPokemon; } public int[] getStoredPokemon(){ //for other class that needs the pokemon return storePokemon; } public void init(){ x=0;y=0; try{ Picture = ImageIO.read(new File("pokeball.png")); } catch( IOException ex ){ } } public void paint( Graphics g ){ pokemon display = new pokemon(); // to access the pokemon attributes in class pokemon ButtonGroup group = new ButtonGroup(); //create a button group for( int a=0;a<16;a++ ){ // for loop in displaying the buttons of every pokemon(one pokemon, one button) display.choose( a ); //calls the method choose in which accepts an integer from 0-15 and saves the attributes of the pokemon corresponding to the integer JButton pokemonButton = new JButton( display.getName() ); // creates the button pokemonButton.setActionCommand( display.getName() ); // isasave sa actioncommand yung name ng kung ano mang pokemon pokemonButton.addActionListener(this); //isasama yung bagong gawang button sa listener para malaman kung na-click yung button pokemonButton.setBounds( x,y,50,23 ); group.add( pokemonButton ); //eto naman yung mag-aadd sa bagong gawang button sa isang group na puro buttons(button ng mga pokemon) y+=23; if( a==7 ){ x+=50; y=0; } add( pokemonButton ); //will add the button to the applet } g.drawImage( Picture, 120, 20, null ); } public void actionPerformed(ActionEvent e) { try{ //displays the picture of the selected pokemon Picture = ImageIO.read(new File( "pokemon/" + e.getActionCommand() + ".png" )); } catch( IOException ex ){ } } public boolean chosen( int PChoice ){ //this will check if the chosen pokemon is already the player's pokemon boolean flag = false; for( int x=0; x<countPokemon && !flag ;x++ ){ if( storePokemon[x]==PChoice ){ flag = true; } } return flag; }

  Read the article

• How do I stop linux from trying to mount android phone as usb storage?

  - by user1160711

  When I plug in my Motorola Triumph to my fedora 17 linux box USB port, I get an endless series of errors on the linux box as it desperately attempts to mount the phone as a USB drive. Stuff like this: Jun 23 10:26:00 zooty kernel: [528926.714884] end_request: critical target error, dev sdg, sector 4 Jun 23 10:26:00 zooty kernel: [528926.715865] sd 16:0:0:1: [sdg] Result: hostbyte=DID_OK driverbyte=DRIVER_SENSE Jun 23 10:26:00 zooty kernel: [528926.715869] sd 16:0:0:1: [sdg] Sense Key : Illegal Request [current] Jun 23 10:26:00 zooty kernel: [528926.715872] sd 16:0:0:1: [sdg] Add. Sense: Invalid field in cdb Jun 23 10:26:00 zooty kernel: [528926.715876] sd 16:0:0:1: [sdg] CDB: Read(10): 28 20 00 00 00 00 00 00 04 00 If I go ahead and tell the phone to allow linux to mount the USB storage, the messages stop, and I get a mounted drive, but if all I want to do is use the debug bridge, my log on linux will continue to fill with this junk. Is there some udev magic I can do to make the system ignore this particular device as far as usb storage goes? I just noticed that if I tell the phone to enable USB storage, let linux recognize the new disk, then tell the phone to disable USB storage again, I get one additional log message about capacity changing to zero, but the endless spew of messages stops, so I guess one work around is to enable and disable USB right away.

  Read the article

• Finding the most frequent subtrees in a collection of (parse) trees

  - by peter.murray.rust

  I have a collection of trees whose nodes are labelled (but not uniquely). Specifically the trees are from a collection of parsed sentences (see http://en.wikipedia.org/wiki/Treebank). I wish to extract the most common subtrees from the collection - performance is not (yet) an issue. I'd be grateful for algorithms (ideally Java) or pointers to tools which do this for treebanks. Note that order of child nodes is important. EDIT @mjv. We are working in a limited domain (chemistry) which has a stylised language so the varirty of the trees is not huge - probably similar to children's readers. Simple tree for "the cat sat on the mat". <sentence> <nounPhrase> <article/> <noun/> </nounPhrase> <verbPhrase> <verb/> <prepositionPhrase> <preposition/> <nounPhrase> <article/> <noun/> </nounPhrase> </prepositionPhrase> </verbPhrase> </sentence> Here the sentence contains two identical part-of-speech subtrees (the actual tokens "cat". "mat" are not important in matching). So the algorithm would need to detect this. Note that not all nounPhrases are identical - "the big black cat" could be: <nounPhrase> <article/> <adjective/> <adjective/> <noun/> </nounPhrase> The length of sentences will be longer - between 15 to 30 nodes. I would expect to get useful results from 1000 trees. If this does not take more than a day or so that's acceptable. Obviously the shorter the tree the more frequent, so nounPhrase will be very common. EDIT If this is to be solved by flattening the tree then I think it would be related to Longest Common Substring, not Longest Common Sequence. But note that I don't necessarily just want the longest - I want a list of all those long enough to be "interesting" (criterion yet to be decided).

  Read the article

• daily rsync backups with hard links, checksums, and a new computer

  - by user75058

  I backup my laptop to a Fedora desktop daily using rsync with hard links. This has worked great for almost a year. I recently purchased a new computer, transferred over my data, and would like to continue backing up this computer daily. However, due to the data transfer from the old laptop to the new laptop, the timestamps have obviously changed, and will thus cause my daily rsync backup to re-transfer all of the data. I thought that by adding the -c (checksum) switch to my rsync backup it would match files based on checksum, instead of timestamp and size, and only transfer those files that are different or not present. This appeared to work, but upon examining the new backup, hard links are not being created, and it appears the files that should be hard linked are simply being copied to the new backup directory from the previous backup directory on the backup server. This is very peculiar behavior to me, and I am having trouble figuring out why this is occurring. Checksums match for files that I think should be hard linked. I have looked through the rsync man page and Google'd around a bit and have been unable to find anything for me to better understand this behavior.

  Read the article

• Specifying a Single Request To Use Credentials with HttpClient

  - by jiduvah

  I am using OAuth2 on my android project. The idea is to use a singleton HttpClient used with a ThreadSafeClientConnManager. For a normal request to the server we construct an Authorization header and send that. The header is constructed from values received from the server. This works fine. However every 15 minutes we must get new values from the server to construct the header. To Received these values I must set the credentials like so. client.getCredentialsProvider().setCredentials( new AuthScope(AuthScope.ANY_HOST, AuthScope.ANY_PORT), new UsernamePasswordCredentials(creds.clientId, creds.clientSecret)); In order for this to work I must set up and new DefaultHttpClient. If I use the original singleton httpclient I receive some errors. My question is.. is it possible to set the credentials to be used only on this one request? I noticed that there is an AuthScope. The host and port would not be suitable for this but maybe the realm would? I can't find anything that tells me what a realm is or how to use it. 06-05 10:12:55.969: W/System.err(23843): org.apache.http.NoHttpResponseException: The target server failed to respond 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultResponseParser.parseHead(DefaultResponseParser.java:85) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.io.AbstractMessageParser.parse(AbstractMessageParser.java:174) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.AbstractHttpClientConnection.receiveResponseHeader(AbstractHttpClientConnection.java:179) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.DefaultClientConnection.receiveResponseHeader(DefaultClientConnection.java:235) 06-05 10:12:55.969: W/System.err(23843): at org.apache.http.impl.conn.AbstractClientConnAdapter.receiveResponseHeader(AbstractClientConnAdapter.java:259) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.doReceiveResponse(HttpRequestExecutor.java:279) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.protocol.HttpRequestExecutor.execute(HttpRequestExecutor.java:121) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:504) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:555) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:487) 06-05 10:12:55.975: W/System.err(23843): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:465) So After more testing I have found where the problem lies. I want to configure a pooled connection manager like so SchemeRegistry schemeRegistry = new SchemeRegistry(); schemeRegistry.register( new Scheme("http", PlainSocketFactory.getSocketFactory(), 80)); schemeRegistry.register( new Scheme("https", PlainSocketFactory.getSocketFactory(), 443)); ClientConnectionManager conManager = new ThreadSafeClientConnManager(new BasicHttpParams(), schemeRegistry); DefaultHttpClient httpClient = new DefaultHttpClient(); But when configure like this, I get the error above. If I use the normal default httpclient like so DefaultHttpClient httpClient = new DefaultHttpClient(); Then it works fine. Any ideas?

  Read the article

• Multiple task in one page?(php - mysql - jquery)

  - by python

  My goal is to build an application in a page that can be use multiple task(crud) for example in this html code.there are multiple submit,multiple action in the same page after (user submit (CURD) it will load result table below.) In juery how Can I do this.? <script type="text/javascript" src="jquery.js"></script> <script> $(document).ready(function(){ $("#button1").click(function(){ $('form#crudform').attr({action: "script_1.php"}); $('form#crudform').submit(); }); $("#button2").click(function(){ $('form#crudform').attr({action: "script_2.php"}); $('form#crudform').submit(); }); $("#button3").click(function(){ $('form#crudform').attr({action: "script_3.php"}); $('form#crudform').submit(); }); }); </script> Form CRUD: <form id="crudform" method="post"> <p>Name: <input type="text" name="name"/></p> <p>Age: <input type="text" name="age"/></p> <input type="button" id="button1" value="Cancel" /> <input type="button" id="button2" value="Save" /> <input type="button" id="button3" value="Update" /> </form> Result: <form id="result" method="post"> <table border="1"> <tr> <tr><td></td><td>Name</td><td>Age</td> </tr> <tr><td><input type="checkbox" name="name1"></td><td>Name1</td><td>10</td><tr> <tr><td><input type="checkbox" name="name1"></td><td>Name2</td><td>15</td></tr> <tr><td><input type="checkbox" name="name3"></td><td>Name3</td><td>16</td></tr> </table> <input type="button" id="button4" value="change" /> <input type="button" id="button5" value="drop" /> </form> Anybody know the tutorials relating ..with my tasks.or tips,guide.....are welconme :)

  Read the article

• Creating a Jenkins build farm in a hands-off manner?

  - by user183394

  My colleague and I have set up and run Jenkins on a KVM guest running Ubuntu 12.04 with good results for a while now. We are thinking about deploying a cluster of Jenkins CI hosts in master/slave configuration, with the libvirt slave plugin to keep our hardware count low. Our environment is strictly Linux (CentOS, Scientific Linux, Fedora, and Ubuntu). Both of us are competent in setting up large clusters. We typically use tools like cobbler + a configuration management tool (Puppet, Chef, and alike) to set up a large number of machines (physical and/or virtual) hands off (hundreds of nodes in less than an hour typical). We would like to do the same for nodes running Jenkins. But the step by step guide doesn't give us any clues in this regard. I did see a Multi-slave config plugin. But, being used to dealing with hundreds or more machines completely hands-off, clicking the UI for many machines just doesn't feel right. Can someone point to us a reference that talks about how to set up large cluster of Jenkins CI hosts more in the hands-off way?

  Read the article

• On linux, what does it mean when a directory has size 0 instead of 4096?

  - by kdt

  Here's a strange thing I haven't seen before -- a directory whose size is reported by ls as 0 instead of 4096, and I can't create any files within it. # ls -ld lib home drwxr-xr-x. 2 root root 0 Feb 7 03:10 home <-- it has zero size dr-xr-xr-x. 11 root root 4096 Feb 4 09:28 lib # touch home/foo touch: cannot touch `home/foo': No such file or directory <-- and I can't create files in it # rm home rm: cannot remove `home': Is a directory <-- look, it really is a dir So what does it mean for a directory to have size 0 instead of 4096? Filesystem is ext4 on fedora core 14. The output of mount is: /dev/mapper/vg_dev-lv_root on / type ext4 (rw) proc on /proc type proc (rw) sysfs on /sys type sysfs (rw) devpts on /dev/pts type devpts (rw,gid=5,mode=620) tmpfs on /dev/shm type tmpfs (rw,rootcontext="system_u:object_r:tmpfs_t:s0") /dev/vda1 on /boot type ext4 (rw) none on /proc/sys/fs/binfmt_misc type binfmt_misc (rw) sunrpc on /var/lib/nfs/rpc_pipefs type rpc_pipefs (rw) Output of du -s /home: 0 /home Output of stat /home: File: `/home' Size: 0 Blocks: 0 IO Block: 1024 directory Device: 15h/21d Inode: 34913 Links: 2 Access: (0755/drwxr-xr-x) Uid: ( 0/ root) Gid: ( 0/ root) Access: 2011-02-07 03:45:46.188995765 -0800 Modify: 2011-02-07 03:11:59.980995019 -0800 Change: 2011-02-06 07:58:45.874995002 -0800

  Read the article

• Catching error caused by InitialContext.lookup

  - by Martin Schröder

  I'm developing a command line client (Java SE6) that now needs to talk to a Glassfish 2.1 server. The code for setting up this connection is try { final InitialContext context = new InitialContext(); final String ejbName = GeneratorCancelledRemote.class.getName(); generatorCancelled = (GeneratorCancelledRemote) context.lookup(ejbName); } catch (Throwable t) { System.err.println("--> Could not call server:"); t.printStackTrace(System.err); runWithOutEJB = true; } I'm now testing it without a running server and the client (when run from Eclipse 4.2) just bombs with 31.10.2012 10:40:09 com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl WARNUNG: "IOP00410201: (COMM_FAILURE) Connection failure: socketType: IIOP_CLEAR_TEXT; hostname: localhost; port: 3700" org.omg.CORBA.COMM_FAILURE: vmcid: SUN minor code: 201 completed: No at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2783) at com.sun.corba.ee.impl.logging.ORBUtilSystemException.connectFailure(ORBUtilSystemException.java:2804) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:261) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:274) at com.sun.corba.ee.impl.transport.SocketOrChannelContactInfoImpl.createConnection(SocketOrChannelContactInfoImpl.java:130) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.beginRequest(CorbaClientRequestDispatcherImpl.java:192) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.request(CorbaClientDelegateImpl.java:184) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.is_a(CorbaClientDelegateImpl.java:328) at org.omg.CORBA.portable.ObjectImpl._is_a(ObjectImpl.java:112) at org.omg.CosNaming.NamingContextHelper.narrow(NamingContextHelper.java:69) at com.sun.enterprise.naming.SerialContext.narrowProvider(SerialContext.java:134) at com.sun.enterprise.naming.SerialContext.getCachedProvider(SerialContext.java:259) at com.sun.enterprise.naming.SerialContext.getRemoteProvider(SerialContext.java:204) at com.sun.enterprise.naming.SerialContext.getProvider(SerialContext.java:159) at com.sun.enterprise.naming.SerialContext.lookup(SerialContext.java:409) at javax.naming.InitialContext.lookup(InitialContext.java:392) at com.werkii.latex.generator.Generator.main(Generator.java:344) Caused by: java.lang.RuntimeException: java.net.ConnectException: Connection refused: connect at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:347) at com.sun.corba.ee.impl.transport.SocketOrChannelConnectionImpl.(SocketOrChannelConnectionImpl.java:244) ... 14 more Caused by: java.net.ConnectException: Connection refused: connect at sun.nio.ch.Net.connect(Native Method) at sun.nio.ch.SocketChannelImpl.connect(SocketChannelImpl.java:532) at com.sun.corba.ee.impl.orbutil.ORBUtility.openSocketChannel(ORBUtility.java:105) at com.sun.enterprise.iiop.IIOPSSLSocketFactory.createSocket(IIOPSSLSocketFactory.java:332) ... 15 more It's o.k. for now (while I'm still in development) that it bombs, but it does this repeatedly and the catch clause is never reached (even though I'm catching Throwable) - the message is not printed. So how can I handle connection errors during lookup in my program?

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• Setting XFCE terminal PS1 value and making it permanent

  - by Matt

  I'm trying to add the value PS1='\u@\h: \w\$ ' to my terminal in XFCE. I added the line to (what I think is) the correct area in /etc/profile. The relevant segment is: # Set a default shell prompt: #PS1='`hostname`:`pwd`# ' PS1='\u@\h: \w\$ ' if [ "$SHELL" = "/bin/pdksh" ]; then # PS1='! $ ' PS1='\u@\h: \w\$ ' elif [ "$SHELL" = "/bin/ksh" ]; then # PS1='! ${PWD/#$HOME/~}$ ' PS1='\u@\h: \w\$ ' elif [ "$SHELL" = "/bin/zsh" ]; then # PS1='%n@%m:%~%# ' PS1='\u@\h: \w\$ ' elif [ "$SHELL" = "/bin/ash" ]; then # PS1='$ ' PS1='\u@\h: \w\$ ' else PS1='\u@\h: \w\$ ' fi Most of that was already there, I just commented out the existing value and added the one I want. By manually opening the terminal and doing . profile, I can load these values, but they don't stick - I close the terminal and reopen, and I'm back to sh-4.1$. Maybe I'm doing this in the wrong place, but how can I make that value stick? All the info I've found on google is Fedora/Ubuntu-specific. I use Slackware. Any help on this matter would be greatly appreciated.

  Read the article

• extra white line under li items that have no border

  - by isabel018

  I have a problem with extra white lines showing up under my list items. It's not a border as I haven't set any borders, except the one under My Account, it's just to show that the white line is not a border. The one under it is -- a 4px border the same color as the background. This problem occurred after I had resolved a conflict between my Nivo Slider and the Woocommerce plugin on my WP site. I got both of them to work together, but then this other issue with the list cropped up. Any ideas as to what caused this and how to fix it? Here's my CSS if that helps: #header #navigation ul.nav > li.current_page_item > a { color: #D4145A;} #header #navigation ul.nav > li:hover a { border-width: 0px 0px 4px; border-style: none none solid; border-color: -moz-use-text-color -moz-use-text-color rgb(212, 20, 90); -moz-border-top-colors: none; -moz-border-right-colors: none; -moz-border-bottom-colors: none; -moz-border-left-colors: none; border-image: none; background: none repeat scroll 0% 0% rgb(212, 20, 90);} and the HTML for it too: <nav id="navigation" class="col-full parent" role="navigation"> <ul id="main-nav" class="nav fl parent"> <li class="page_item"></li> <li class="page_item page-item-11"></li> <li class="page_item page-item-12"></li> <li class="page_item page-item-13 parent"></li> <li class="page_item page-item-15 current_page_item parent"> <a href=""></a> <ul class="children"></ul></li> </ul> </nav> Help please! I'm at my wits' end! Thanks!

  Read the article

• Software RAID 1 Configuration

  - by Corve

  I have created a software RAID 1 quite some while ago and it always seemed to work for me. However I am not completely sure that I have configured everything right and do not have the experience to check so I would be very grateful for some advice or just verification that all seems right so far. I am using Linux Fedora 20 (32 bit with plans to upgrade to 64bit) The RAID 1 should consist of two 1TB SATA hard drives. This is the output of mdadm --detail /dev/md0 /dev/md0: Version : 1.2 Creation Time : Sun Jan 29 11:25:18 2012 Raid Level : raid1 Array Size : 976761424 (931.51 GiB 1000.20 GB) Used Dev Size : 976761424 (931.51 GiB 1000.20 GB) Raid Devices : 2 Total Devices : 1 Persistence : Superblock is persistent Update Time : Sat Jun 7 10:38:09 2014 State : clean, degraded Active Devices : 1 Working Devices : 1 Failed Devices : 0 Spare Devices : 0 Name : argo:0 (local to host argo) UUID : 1596d0a1:5806e590:c56d0b27:765e3220 Events : 996387 Number Major Minor RaidDevice State 0 0 0 0 removed 1 8 0 1 active sync /dev/sda The RAID is mounted successfully: friedrich@argo:~ ? sudo mount -l | grep md0 /dev/md0 on /mnt/raid type ext4 (rw,relatime,data=ordered) Basically my question are: Why do I only have 1 active device? What does the State removed at bottom mean? Also I noticed some strange error messages that I see on the console on system start and shutdown and always repeating in the background when I switch with Ctrl + Alt + F2: ... ata2: irq_stat 0x00000040 connection status changed ata2: SError: { CommWake DevExch } ata2: COMRESET failed (errno=-32) ata2: exception Emask 0x10 SAct 0x0 SErr 0x4040000 action 0xe frozen ata2: irq_stat 0x00000040 connection status changed ata2: SError: { CommWake DevExch } ata2: exception Emask 0x10 SAct 0x0 SErr 0x4040000 action 0xe frozen ... Are these errors related to the RAID? Something seems wrong with the SATA devices.. All together the system works (I can read and write to the mounted raid) but I always had these strange errors on startup shutdown (probably always in the background). Thx for your help

  Read the article

• App losing db connection

  - by DaveKub

  I'm having a weird issue with an old Delphi app losing it's database connection. Actually, I think it's losing something else that then makes the connection either drop or be unusable. The app is written in Delphi 6 and uses the Direct Oracle Access component (v4.0.7.1) to connect to an Oracle 9i database. The app runs as a service and periodically queries the db using a TOracleQuery object (qryAlarmList). The method that is called to do this looks like this: procedure TdmMain.RefreshAlarmList; begin try qryAlarmList.Execute; except on E: Exception do begin FStatus := ssError; EventLog.LogError(-1, 'TdmMain.RefreshAlarmList', 'Message: ' + E.Message); end; end; end; It had been running fine for years, until a couple of Perl scripts were added to this machine. These scripts run every 15 minutes and look for datafiles to import into the db, and then they do a some calculations and a bunch of reads/writes to/from the db. For some reason, when they are processing large amounts of data, and then the Delphi app tries to query the db, the Delphi app throws an exception at the "qryAlarmList.Execute" line in the above code listing. The exception is always: Access violation at address 00000000. read of address 00000000 HOW can something that the Perl scripts are doing cause this?? There are other Perl scripts on this machine that load data using the same modules and method calls and we didn't have problems. To make it even weirder, there are two other apps that will also suddenly lose their ability to talk to the database at the same time as the Perl stuff is running. Neither of those apps run on this machine, but both are Delphi 6 apps that use the same DOA component to connect to the same database. We have other apps that connect to the same db, written in Java or C# and they don't seem to have any problems. I've tried adding code before the '.Execute' method is called to: check the session's connection (session.CheckConnection(true); always comes back as 'ccOK'). see whether I can access a field of the qryAlarmList object to see if maybe it's become null; can access it fine. check the state of the qryAlarmList; always says it's qsIdle. Does anyone have any suggestions of something to try? This is driving me nuts! Dave

  Read the article

• Trouble using South with Django and Heroku

  - by Dan

  I had an existing Django project that I've just added South to. I ran syncdb locally. I ran manage.py schemamigration app_name locally I ran manage.py migrate app_name --fake locally I commit and pushed to heroku master I ran syncdb on heroku I ran manage.py schemamigration app_name on heroku I ran manage.py migrate app_name on heroku I then receive this: $ heroku run python notecard/manage.py migrate notecards Running python notecard/manage.py migrate notecards attached to terminal... up, run.1 Running migrations for notecards: - Migrating forwards to 0005_initial. > notecards:0003_initial Traceback (most recent call last): File "notecard/manage.py", line 14, in <module> execute_manager(settings) File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 438, in execute_manager utility.execute() File "/app/lib/python2.7/site-packages/django/core/management/__init__.py", line 379, in execute self.fetch_command(subcommand).run_from_argv(self.argv) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 191, in run_from_argv self.execute(*args, **options.__dict__) File "/app/lib/python2.7/site-packages/django/core/management/base.py", line 220, in execute output = self.handle(*args, **options) File "/app/lib/python2.7/site-packages/south/management/commands/migrate.py", line 105, in handle ignore_ghosts = ignore_ghosts, File "/app/lib/python2.7/site-packages/south/migration/__init__.py", line 191, in migrate_app success = migrator.migrate_many(target, workplan, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 221, in migrate_many result = migrator.__class__.migrate_many(migrator, target, migrations, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 292, in migrate_many result = self.migrate(migration, database) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 125, in migrate result = self.run(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 99, in run return self.run_migration(migration) File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 81, in run_migration migration_function() File "/app/lib/python2.7/site-packages/south/migration/migrators.py", line 57, in <lambda> return (lambda: direction(orm)) File "/app/notecard/notecards/migrations/0003_initial.py", line 15, in forwards ('user', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['auth.User'])), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 226, in create_table ', '.join([col for col in columns if col]), File "/app/lib/python2.7/site-packages/south/db/generic.py", line 150, in execute cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/util.py", line 34, in execute return self.cursor.execute(sql, params) File "/app/lib/python2.7/site-packages/django/db/backends/postgresql_psycopg2/base.py", line 44, in execute return self.cursor.execute(query, args) django.db.utils.DatabaseError: relation "notecards_semester" already exists I have 3 models. Section, Semester, and Notecards. I've added one field to the Notecards model and I cannot get it added on Heroku. Thank you.

  Read the article

• complex URL remapping with friendly_id

  - by DerNalia

  I have the URL http://acme.example.com/view/view_container_content/15?javascript_disabled=true&container=aoeu but I want it to look like http://acme.example.com/view/container_name/content_name/ with friendly_id, I've seen how to do URL mapping with one object... but I haven't seen an example with two... ideas?

  Read the article

• iPhone: how to keep integer value on UILabel

  - by Nandakishore

  i am working on Twitter on iPhone now i have to keep the count of Friend, Tweets, Followers etc on UILabel how to work with this (void)userInfoReceived:(NSArray *)userInfo forRequest:(NSString *)connectionIdentifier { NSLog(@"User Info Received: %@", userInfo); // userInfo contains all user details like userName, screenName, count of Friends, Followers, Following, Status Count etc NSLog(@"User Info Received: %d", [userInfo count]); NSMutableDictionary *profileData = [userInfo objectAtIndex:0]; //converting userInfo array into profileData dictionary lblUserName.text = [profileData objectForKey:@"name"]; // lblUserName is UILabel, userName keeping on Label lblLocation.text = [profileData objectForKey:@"location"]; // lblLocation is UILabel, Location keeping on Label lblDescription.text = [profileData objectForKey:@"description"]; // lblDescription is UILabel, Location keeping on Label /////* Up to here all working but how to Keep integer value on UILabel *///// lblFolCount = (NSNumber *)[profileData objectForKey:@"followers_count"]; //how to keep user Followers Count on UILable lblFavCount = (NSNumber *)[profileData objectForKey:@"favourites_count"]; //how to keep user Followers Count on UILable lblStatusCount = (NSNumber *) [profileData objectForKey:@"statuses_count"]; //how to keep user statuses count on UILable lblFriends = (NSNumber *) [profileData objectForKey:@"friends_count"]; //how to keep user friends count on UILable } ////**This info Display on debugger console*/////// ////NSLog(@"User Info Received: %@", userInfo); // by this we get info on debugger console User Info Received: ( { "created_at" = "Tue Nov 02 14:42:42 +0000 2010"; description = "being honest"; favorited = false; "favourites_count" = 0; "followers_count" = 5; "friends_count" = 21; "listed_count" = 0; location = Chennai; name = "nanda kishore reddyv"; "profile_background_color" = EDECE9; "profile_background_image_url" = "http://a2.twimg.com/a/1292975674/images/themes/theme3/bg.gif"; "profile_background_tile" = false; "profile_image_url" = "http://a2.twimg.com/a/1292975674/images/default_profile_6_normal.png"; "retweet_count" = 0; "screen_name" = velugotinanda; source = "<a href=\"http://www.icodeblog.com\" rel=\"nofollow\">iCodeBlog Oauth Demo</a>"; status = "Mon Dec 27 09:22:44 +0000 2010"; "statuses_count" = 15; "time_zone" = "Indiana (East)"; verified = false; } ) 2011-01-01 10:38:29.460 IdeaTweet[471:207] User Info Received: 1 Thanks YOU can you tell me how to Keep integer Value on UILabel

  Read the article

< Previous Page | 319 320 321 322 323 324 325 326 327 328 329 330  | Next Page >