Search Results

Search found 1582 results on 64 pages for 'alleged homework'.

Page 33/64 | < Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >

  • display multiple errors via bool flag c++

    - by igor
    Been a long night, but stuck on this and now am getting "segmentation fault" in my compiler.. Basically I'm trying to display all the errors (the cout) needed. If there is more than one error, I am to display all of them. bool validMove(const Square board[BOARD_SIZE][BOARD_SIZE], int x, int y, int value) { int index; bool moveError = true; const int row_conflict(0), column_conflict(1), grid_conflict(2); int v_subgrid=x/3; int h_subgrid=y/3; getCoords(x,y); for(index=0;index<9;index++) if(board[x][index].number==value){ cout<<"That value is in conflict in this row\n"; moveError=false; } for(index=0;index<9;index++) if(board[index][y].number==value){ cout<<"That value is in conflict in this column\n"; moveError=false; } for(int i=v_subgrid*3;i<(v_subgrid*3 +3);i++){ for(int j=h_subgrid*3;j<(h_subgrid*3+3);j++){ if(board[i][j].number==value){ cout<<"That value is in conflict in this subgrid\n"; moveError=false; } } } return true; }

    Read the article

  • java programming

    - by Baiba
    ok i have version of t code, please tell me what i need to do when i need to get out of program The INDEX NUMBER OF COLUMN IN WHICH ARE LEAST ZEROS? class Uzd{ public static void main(String args[]){ int mas[][]= {{3,4,7,5,0}, {4,5,3,0,1}, {8,2,4,0,3}, {7,0,2,0,1}, {0,0,1,3,0}}; int nul_mas[] = new int[5]; int nul=0; for(int j=0;j<5;j++){// nul=0; for(int i=0;i<5;i++){ if(mas[i][j]==0){ nul++; } } nul_mas[j]=nul; } for(int i=0;i<5;i++){ for(int j=0;j<5;j++){ System.out.print(mas[i][j]); } System.out.println(); } System.out.println();// atstarpe System.out.println("///zeros in each column///"); for(int i=0;i<5;i++){System.out.print(nul_mas[i]);} System.out.println(); }} and after running it shows: 34750 45301 82403 70201 00130 ///zeros in each column/// But i need not in each column but i need to get out index of column in which zeros are least! in this situation it is column nubmer 2!! 12032

    Read the article

  • Problem with python class

    - by Tasbeer
    Hi I am new to Python and as a part of my assignment I have written the following class import nltk.stem.api class BanglaStemmer(nltk.stem.api.StemmerI): suffixList = ['\xef\xbb\xbf\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xbf\xe0\xa7\x9f\xe0\xa7\x8b\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa7\x87\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa7\x87\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\xe0\xa7\x87\n', '\xe0\xa6\x9a\xe0\xa7\x8d\xe0\xa6\x9b\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb2\n', '\xe0\xa6\x9b\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\x9b\xe0\xa6\xbf\n', '\xe0\xa6\x9b\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\x9b\n', '\xe0\xa6\xa4\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa6\xa4\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa6\xbe\xe0\xa6\xae\n', '\xe0\xa6\xb2\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xa4\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xac\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa7\x87\xe0\xa6\xa8\n', '\xe0\xa6\xbf\xe0\xa6\xb8\n', '\xe0\xa7\x81\xe0\xa6\xa8\n', '\xe0\xa7\x81\xe0\xa6\x95\n', '\xe0\xa6\xb2\xe0\xa7\x87\n', '\xe0\xa6\xac\xe0\xa7\x87\n', '\xe0\xa6\xb2\xe0\xa6\xbf\n', '\xe0\xa6\xac\xe0\xa6\xbf\n', '\xe0\xa6\xa4\xe0\xa6\xbf\n', '\xe0\xa6\xb2\n', '\xe0\xa6\xa4\n', '\xe0\xa7\x8b\n', '\xe0\xa6\xbf\n', '\xe0\xa7\x87\n', '\xe0\xa7\x8d\n', '\xe0\xa6\x87\n', '\xe0\xa6\xac\n', '\xe0\xa6\xb8\n', '\xe0\xa6\xa8\n', '\xe0\xa6\x95\n', '\xe0\xa6\x93\n', '\xe0\xa7\x9f\n'] def stem(self,token): for suffix in suffixList: if token.endswith(suffix): return token[:-len(suffix)] return token The problem is that when I try to compile run it by creating an instance and calling the stem() function with a parameter , it says that the suffixList is not defined. Couldn't figure out what's the problem. Is there a different way in which the class variables have to be declared ? please help

    Read the article

  • Java: How to check the random letters from a-z, out of 10 letters minimum 2 letter should be a vowel

    - by kalandar
    I am writing a program to validate the following scenarios: Scenario 1: I am using the Random class from java.util. The random class will generate 10 letters from a-z and within 10 letter, minimum 2 letters must be a vowels. Scenario 2: When the player 1 and player 2 form a word from A-Z, he will score some points. There will be a score for each letter. I have already assigned the values for A-Z. At the end of the game, the system should display a scores for player 1 and player 2. How do i do it? Please help. I will post my code here. Thanks a lot. =========================================== import java.util.Random; import java.util.Scanner; public class FindYourWords { public static void main(String[] args) { Random rand = new Random(); Scanner userInput = new Scanner(System.in); //==================Player object=============================================== Player playerOne = new Player(); playerOne.wordScore = 0; playerOne.choice = "blah"; playerOne.turn = true; Player playerTwo = new Player(); playerTwo.wordScore = 0; playerTwo.choice = "blah"; playerTwo.turn = false; //================== Alphabet ================================================== String[] newChars = { "a", "b", "c", "d", "e", "f", "g", "h", "i", "j", "k", "l", "m", "n", "o", "p", "q", "r", "s", "t", "u", "v", "w", "x", "y", "z" }; //values of the 26 alphabets to be used int [] letterScore = {1,3,3,2,1,4,2,4,1,8,5,1,3,1,1,3,10,1,1,1,1,4,4,8,4,10}; // to assign score to the player1 and player 2 String[] vowel = { "a", "e", "i", "o", "u" }; // values for vowels int vow=0; System.out.println("FINDYOURWORDS\n"); int[] arrayRandom = new int[10]; //int array for word limiter String[] randomLetter = new String[10]; //storing the letters in newChars into this array //=============================================================================== boolean cont = true; while (cont) { if (playerOne.turn) { System.out.print("Letters of Player 1: "); } else if (!playerOne.turn) { System.out.print("Letters of Player 2: "); } for (int i = 0; i < arrayRandom.length; i++) { //running through the array limiter int r = rand.nextInt(newChars.length); //assigning random nums to the array of letters randomLetter[i] = newChars[r]; System.out.print(randomLetter[i]+ " "); } //input section for player System.out.println(""); System.out.println("Enter your word (or '@' to pass or '!' to quit): "); if (playerOne.turn) { playerOne.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = false; } else if (!playerOne.turn){ playerTwo.choice = userInput.next(); System.out.println(playerOne.turn); playerOne.turn = true; } //System.out.println(choice); String[] wordList = FileUtil.readDictFromFile("words.txt"); //Still dunno what this is for if (playerOne.choice.equals("@")) { playerOne.turn = false; } else if (playerTwo.choice.equals("@")) { playerOne.turn = true; } else if (playerOne.choice.equals("!")) { cont = false; } for (int i = 0; i < wordList.length; i++) { //System.out.println(wordList[i]); if (playerOne.choice.equalsIgnoreCase(wordList[i]) || playerTwo.choice.equalsIgnoreCase(wordList[i])){ } } } }}

    Read the article

  • Passing an array of structs in C

    - by lelouch
    I'm having trouble passing an array of structs to a function in C. I've created the struct like this in main: int main() { struct Items { char code[10]; char description[30]; int stock; }; struct Items MyItems[10]; } I then access it like: MyItems[0].stock = 10; etc. I want to pass it to a function like so: ReadFile(MyItems); The function should read the array, and be able to edit it. Then I should be able to access the same array from other functions. I've tried heaps of declarations but none of them work. e.g. void ReadFile(struct Items[10]) I've had a look around for other questions, but the thing is they're all done different, with typedefs and asterisks. My teacher hasn't taught us pointers yet, so I'd like to do it with what I know. Any ideas? :S EDIT: Salvatore's answer is working after I fixed my prototype to: void ReadFile(struct Items[9]);

    Read the article

  • Can someone help with big O notation?

    - by Dann
    void printScientificNotation(double value, int powerOfTen) { if (value >= 1.0 && value < 10.0) { System.out.println(value + " x 10^" + powerOfTen); } else if (value < 1.0) { printScientificNotation(value * 10, powerOfTen - 1); } else // value >= 10.0 { printScientificNotation(value / 10, powerOfTen + 1); } } I understand how the method goes but I cannot figure out a way to represent the method. For example, if value was 0.00000009 or 9e-8, the method will call on printScientificNotation(value * 10, powerOfTen - 1); eight times and System.out.println(value + " x 10^" + powerOfTen); once. So the it is called recursively by the exponent for e. But how do I represent this by big O notation? Thanks!

    Read the article

  • Returning multiple aggregate functions as rows

    - by SDLFunTimes
    I need some help formulating a select statement. I need to select the total quantity shipped for each part with a distinct color. So the result should be a row with the color name and the total. Here's my schema: create table s ( sno char(5) not null, sname char(20) not null, status smallint, city char(15), primary key (sno) ); create table p ( pno char(6) not null, pname char(20) not null, color char(6), weight smallint, city char(15), primary key (pno) ); create table sp ( sno char(5) not null, pno char(6) not null, qty integer not null, primary key (sno, pno) );

    Read the article

  • Sum of even fibonacci numbers

    - by user300484
    This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

    Read the article

  • How do you determine using stat() whether a file is a symbolic link?

    - by hora
    I basically have to write a clone of the UNIX ls command for a class, and I've got almost everything working. One thing I can't seem to figure out how to do is check whether a file is a symbolic link or not. From the man page for stat(), I see that there is a mode_t value defined, S_IFLNK. This is how I'm trying to check whether a file is a sym-link, with no luck (note, stbuf is the buffer that stat() returned the inode data into): switch(stbuf.st_mode & S_IFMT){ case S_IFLNK: printf("this is a link\n"); break; case S_IFREG: printf("this is not a link\n"); break; } My code ALWAYS prints this is not a link even if it is, and I know for a fact that the said file is a symbolic link since the actual ls command says so, plus I created the sym-link... Can anyone spot what I may be doing wrong? Thanks for the help!

    Read the article

  • Linked Lists in Java - Help with assignment

    - by doron2010
    I have been trying to solve this assignment all day, please help me. I'm completely lost. Representation of a string in linked lists In every intersection in the list there will be 3 fields : The letter itself. The number of times it appears consecutively. A pointer to the next intersection in the list. The following class CharNode represents a intersection in the list : public class CharNode { private char _data; private int _value; private charNode _next; public CharNode (char c, int val, charNode n) { _data = c; _value = val; _next = n; } public charNode getNext() { return _next; } public void setNext (charNode node) { _next = node; } public int getValue() { return _value; } public void setValue (int v) { value = v; } public char getData() { return _data; } public void setData (char c) { _data = c; } } The class StringList represents the whole list : public class StringList { private charNode _head; public StringList() { _head = null; } public StringList (CharNode node) { _head = node; } } Add methods to the class StringList according to the details : (Pay attention, these are methods from the class String and we want to fulfill them by the representation of a string by a list as explained above) public char charAt (int i) - returns the char in the place i in the string. Assume that the value of i is in the right range. public StringList concat (String str) - returns a string that consists of the string that it is operated on and in its end the string "str" is concatenated. public int indexOf (int ch) - returns the index in the string it is operated on of the first appeareance of the char "ch". If the char "ch" doesn't appear in the string, returns -1. If the value of fromIndex isn't in the range, returns -1. public int indexOf (int ch, int fromIndex) - returns the index in the string it is operated on of the first appeareance of the char "ch", as the search begins in the index "fromIndex". If the char "ch" doesn't appear in the string, returns -1. public boolean equals (String str) - returns true if the string that it is operated on is equal to the string str. Otherwise returns false. This method must be written in recursion, without using loops at all. public int compareTo (String str) - compares between the string that the method is operated on to the string "str" that is in the parameter. The method returns 0 if the strings are equal. If the string in the object is smaller lexicographic from the string "str" in the paramater, a negative number will be returned. And if the string in the object is bigger lexicographic from the string "str", a positive number will be returned. public StringList substring (int i) - returns the list of the substring that starts in the place i in the string on which it operates. Meaning, the sub-string from the place i until the end of the string. Assume the value of i is in the right range. public StringList substring (int i, int j) - returns the list of the substring that begins in the place i and ends in the place j (not included) in the string it operates on. Assume the values of i, j are in the right range. public int length() - will return the length of the string on which it operates. Pay attention to all the possible error cases. Write what is the time complexity and space complexity of every method that you wrote. Make sure the methods you wrote are effective. It is NOT allowed to use ready classes of Java. It is NOT allowed to move to string and use string operations.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Creating ActionEvent object for CustomButton in Java

    - by Crystal
    For a hw assignment, we were supposed to create a custom button to get familiar with swing and responding to events. We were also to make this button an event source which confuses me. I have an ArrayList to keep track of listeners that would register to listen to my CustomButton. What I am getting confused on is how to notify the listeners. My teacher hinted at having a notify and overriding actionPerformed which I tried doing, but then I wasn't sure how to create an ActionEvent object looking at the constructor documentation. The source, id, string all confuses me. Any help would be appreciated. Thanks! code: import java.awt.*; import java.awt.event.*; import javax.swing.*; import java.util.List; import java.util.ArrayList; public class CustomButton { public static void main(String[] args) { EventQueue.invokeLater(new Runnable() { public void run() { CustomButtonFrame frame = new CustomButtonFrame(); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setVisible(true); } }); } public void addActionListener(ActionListener al) { listenerList.add(al); } public void removeActionListener(ActionListener al) { listenerList.remove(al); } public void actionPerformed(ActionEvent e) { System.out.println("Button Clicked!"); } private void notifyListeners() { ActionEvent event = new ActionEvent(CONFUSED HERE!!!!; for (ActionListener action : listenerList) { action.actionPerfomed(event); } } List<ActionListener> listenerList = new ArrayList<ActionListener>(); } class CustomButtonFrame extends JFrame { // constructor for CustomButtonFrame public CustomButtonFrame() { setTitle("Custom Button"); CustomButtonSetup buttonSetup = new CustomButtonSetup(); this.add(buttonSetup); this.pack(); } } class CustomButtonSetup extends JComponent { public CustomButtonSetup() { ButtonAction buttonClicked = new ButtonAction(); this.addMouseListener(buttonClicked); } // because frame includes borders and insets, use this method public Dimension getPreferredSize() { return new Dimension(200, 200); } public void paintComponent(Graphics g) { Graphics2D g2 = (Graphics2D) g; // first triangle coords int x[] = new int[TRIANGLE_SIDES]; int y[] = new int[TRIANGLE_SIDES]; x[0] = 0; y[0] = 0; x[1] = 200; y[1] = 0; x[2] = 0; y[2] = 200; Polygon firstTriangle = new Polygon(x, y, TRIANGLE_SIDES); // second triangle coords x[0] = 0; y[0] = 200; x[1] = 200; y[1] = 200; x[2] = 200; y[2] = 0; Polygon secondTriangle = new Polygon(x, y, TRIANGLE_SIDES); g2.drawPolygon(firstTriangle); g2.setColor(firstColor); g2.fillPolygon(firstTriangle); g2.drawPolygon(secondTriangle); g2.setColor(secondColor); g2.fillPolygon(secondTriangle); // draw rectangle 10 pixels off border int s1[] = new int[RECT_SIDES]; int s2[] = new int[RECT_SIDES]; s1[0] = 5; s2[0] = 5; s1[1] = 195; s2[1] = 5; s1[2] = 195; s2[2] = 195; s1[3] = 5; s2[3] = 195; Polygon rectangle = new Polygon(s1, s2, RECT_SIDES); g2.drawPolygon(rectangle); g2.setColor(thirdColor); g2.fillPolygon(rectangle); } private class ButtonAction implements MouseListener { public void mousePressed(MouseEvent e) { System.out.println("Click!"); firstColor = Color.GRAY; secondColor = Color.WHITE; repaint(); } public void mouseReleased(MouseEvent e) { System.out.println("Released!"); firstColor = Color.WHITE; secondColor = Color.GRAY; repaint(); } public void mouseEntered(MouseEvent e) {} public void mouseExited(MouseEvent e) {} public void mouseClicked(MouseEvent e) {} } public static final int TRIANGLE_SIDES = 3; public static final int RECT_SIDES = 4; private Color firstColor = Color.WHITE; private Color secondColor = Color.DARK_GRAY; private Color thirdColor = Color.LIGHT_GRAY; }

    Read the article

  • plane bombing problems- help

    - by peiska
    I'm training code problems, and on this one I am having problems to solve it, can you give me some tips how to solve it please. The problem is something like this: Your task is to find the sequence of points on the map that the bomber is expected to travel such that it hits all vital links. A link from A to B is vital when its absence isolates completely A from B. In other words, the only way to go from A to B (or vice versa) is via that link. Notice that if we destroy for example link (d,e), it becomes impossible to go from d to e,m,l or n in any way. A vital link can be hit at any point that lies in its segment (e.g. a hit close to d is as valid as a hit close to e). Of course, only one hit is enough to neutralize a vital link. Moreover, each bomb affects an exact circle of radius R, i.e., every segment that intersects that circle is considered hit. Due to enemy counter-attack, the plane may have to retreat at any moment, so the plane should follow, at each moment, to the closest vital link possible, even if in the end the total distance grows larger. Given all coordinates (the initial position of the plane and the nodes in the map) and the range R, you have to determine the sequence of positions in which the plane has to drop bombs. This sequence should start (takeoff) and finish (landing) at the initial position. Except for the start and finish, all the other positions have to fall exactly in a segment of the map (i.e. it should correspond to a point in a non-hit vital link segment). The coordinate system used will be UTM (Universal Transverse Mercator) northing and easting, which basically corresponds to a Euclidian perspective of the world (X=Easting; Y=Northing). Input Each input file will start with three floating point numbers indicating the X0 and Y0 coordinates of the airport and the range R. The second line contains an integer, N, indicating the number of nodes in the road network graph. Then, the next N (<10000) lines will each contain a pair of floating point numbers indicating the Xi and Yi coordinates (1 No two links will ever cross with each other. Output The program will print the sequence of coordinates (pairs of floating point numbers with exactly one decimal place), each one at a line, in the order that the plane should visit (starting and ending in the airport). Sample input 1 102.3 553.9 0.2 14 342.2 832.5 596.2 638.5 479.7 991.3 720.4 874.8 744.3 1284.1 1294.6 924.2 1467.5 659.6 1802.6 659.6 1686.2 860.7 1548.6 1111.2 1834.4 1054.8 564.4 1442.8 850.1 1460.5 1294.6 1485.1 17 1 2 1 3 2 4 3 4 4 5 4 6 6 7 7 8 8 9 8 10 9 10 10 11 6 11 5 12 5 13 12 13 13 14 Sample output 1 102.3 553.9 720.4 874.8 850.1 1460.5 102.3 553.9

    Read the article

  • Need help with basic optimization problem

    - by ??iu
    I know little of optimization problems, so hopefully this will be didactic for me: rotors = [1, 2, 3, 4...] widgets = ['a', 'b', 'c', 'd' ...] assert len(rotors) == len(widgets) part_values = [ (1, 'a', 34), (1, 'b', 26), (1, 'c', 11), (1, 'd', 8), (2, 'a', 5), (2, 'b', 17), .... ] Given a fixed number of widgets and a fixed number of rotors, how can you get a series of widget-rotor pairs that maximizes the total value where each widget and rotor can only be used once?

    Read the article

  • Running a Java program with input from a file

    - by Katy
    I am writing a program that reads the input from a file and then prints it to the screen. When I run it without taking the input from the file, it works perfectly fine. However, every time I try to run it from the file it gives me an "Exception in thread "main" java.util.NoSuchElementException: No line found at" error that occurs every place the input is suppose to be read. I have no idea what is going on.

    Read the article

  • Spinning a circle in J2ME using a Canvas.

    - by JohnQPublic
    Hello all! I have a problem where I need to make a multi-colored wheel spin using a Canvas in J2ME. What I need to do is have the user increase the speed of the spin or slow the spin of the wheel. I have it mostly worked out (I think) but can't think of a way for the wheel to spin without causing my cellphone to crash. Here is what I have so far, it's close but not exactly what I need. class MyCanvas extends Canvas{ //wedgeOne/Two/Three define where this particular section of circle begins to be drawn from int wedgeOne; int wedgeTwo; int wedgeThree; int spinSpeed; MyCanvas(){ wedgeOne = 0; wedgeTwo = 120; wedgeThree = 240; spinSpeed = 0; } //Using the paint method to public void paint(Graphics g){ //Redraw the circle with the current wedge series. g.setColor(255,0,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeOne, 120); g.setColor(0,255,0); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeTwo, 120); g.setColor(0,0,255); g.fillArc(getWidth()/2, getHeight()/2, 100, 100, wedgeThree, 120); } protected void keyPressed(int keyCode){ switch (keyCode){ //When the 6 button is pressed, the wheel spins forward 5 degrees. case KEY_NUM6: wedgeOne += 5; wedgeTwo += 5; wedgeThree += 5; repaint(); break; //When the 4 button is pressed, the wheel spins backwards 5 degrees. case KEY_NUM4: wedgeOne -= 5; wedgeTwo -= 5; wedgeThree -= 5; repaint(); } } I have tried using a redraw() method that adds the spinSpeed to each of the wedge values while(spinSpeed0) and calls the repaint() method after the addition, but it causes a crash and lockup (I assume due to an infinite loop). Does anyone have any tips or ideas how I could automate the spin so you do not have the press the button every time you want it to spin? (P.S - I have been lurking for a while, but this is my first post. If it's too general or asking for too much info (sorry if it is) and I either remove it or fix it. Thank you!)

    Read the article

  • Enumeration trouble: redeclared as different kind of symbol

    - by Matt
    Hello all. I am writing a program that is supposed to help me learn about enumeration data types in C++. The current trouble is that the compiler doesn't like my enum usage when trying to use the new data type as I would other data types. I am getting the error "redeclared as different kind of symbol" when compiling my trangleShape function. Take a look at the relevant code. Any insight is appreciated! Thanks! (All functions are their own .cpp files.) header file #ifndef HEADER_H_INCLUDED #define HEADER_H_INCLUDED #include <iostream> #include <iomanip> using namespace std; enum triangleType {noTriangle, scalene, isoceles, equilateral}; //prototypes void extern input(float&, float&, float&); triangleType extern triangleShape(float, float, float); /*void extern output (float, float, float);*/ void extern myLabel(const char *, const char *); #endif // HEADER_H_INCLUDED main function //8.1 main // this progam... #include "header.h" int main() { float sideLength1, sideLength2, sideLength3; char response; do //main loop { input (sideLength1, sideLength2, sideLength3); triangleShape (sideLength1, sideLength2, sideLength3); //output (sideLength1, sideLength2, sideLength3); cout << "\nAny more triangles to analyze? (y,n) "; cin >> response; } while (response == 'Y' || response == 'y'); myLabel ("8.1", "2/11/2011"); return 0; } triangleShape shape # include "header.h" triangleType triangleShape(sideLenght1, sideLength2, sideLength3) { triangleType triangle; return triangle; }

    Read the article

  • paintComponent method is not displaying anything on the panel

    - by Captain Gh0st
    I have been trying to debug this for hours. The program is supposed to be a grapher that graphs coordinates, but i cannot get anything to display not even a random line, but if i put a print statement there it works. It is a problem with the paintComponent Method. When I out print statement before g.drawLine then it prints, but it doesn't draw any lines even if i put a random line with coordinates (1,3), (2,4). import java.awt.*; import java.util.*; import javax.swing.*; public abstract class XYGrapher { abstract public Coordinate xyStart(); abstract public double xRange(); abstract public double yRange(); abstract public Coordinate getPoint(int pointNum); public class Paint extends JPanel { public void paintGraph(Graphics g, int xPixel1, int yPixel1, int xPixel2, int yPixel2) { super.paintComponent(g); g.setColor(Color.black); g.drawLine(xPixel1, yPixel1, xPixel2, yPixel2); } public void paintXAxis(Graphics g, int xPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(xPixel, 0, xPixel, pixelsHigh); } public void paintYAxis(Graphics g, int yPixel, int pixelsWide, int pixelsHigh) { super.paintComponent(g); g.setColor(Color.green); g.drawLine(0, yPixel, pixelsWide, yPixel); } } public void drawGraph(int xPixelStart, int yPixelStart, int pixelsWide, int pixelsHigh) { JFrame frame = new JFrame(); Paint panel = new Paint(); panel.setPreferredSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMinimumSize(new Dimension(pixelsWide, pixelsHigh)); panel.setMaximumSize(new Dimension(pixelsWide, pixelsHigh)); frame.setLocation(frame.getToolkit().getScreenSize().width / 2 - pixelsWide / 2, frame.getToolkit().getScreenSize().height / 2 - pixelsHigh / 2); frame.setDefaultCloseOperation(JFrame.EXIT_ON_CLOSE); frame.setResizable(false); frame.add(panel); frame.pack(); frame.setVisible(true); double xRange = xRange(); double yRange = yRange(); Coordinate xyStart = xyStart(); int xPixel = xPixelStart - (int) (xyStart.getX() * (pixelsWide / xRange)); int yPixel = yPixelStart + (int) ((xyStart.getY() + yRange) * (pixelsHigh / yRange)); System.out.println(xPixel + " " + yPixel); if(yPixel > 0 && (yPixel < pixelsHigh)) { System.out.println("y"); panel.paintYAxis(panel.getGraphics(), yPixel, pixelsWide, pixelsHigh); } if(xPixel > 0 && (xPixel < pixelsHigh)) { System.out.println("x"); panel.paintXAxis(panel.getGraphics(), xPixel, pixelsWide, pixelsHigh); } for(int i = 0; i>=0; i++) { Coordinate point1 = getPoint(i); Coordinate point2 = getPoint(i+1); if(point2 == null) { break; } else { if(point1.drawFrom() && point2.drawTo()) { int xPixel1 = (int) (xPixelStart + (point1.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel1 = (int) (yPixelStart + (xyStart.getY() + yRange-point1.getY()) * (pixelsHigh / yRange)); int xPixel2 = (int) (xPixelStart + (point2.getX() - xyStart.getX()) * (pixelsWide / xRange)); int yPixel2 = (int) (yPixelStart + (xyStart.getY() + yRange - point2.getY()) * (pixelsHigh / yRange)); panel.paintGraph(panel.getGraphics(), xPixel1, yPixel1, xPixel2, yPixel2); } } } frame.pack(); } } This is how i am testing it is supposed to be a square, but nothing shows up. public class GrapherTester extends XYGrapher { public Coordinate xyStart() { return new Coordinate(-2,2); } public double xRange() { return 4; } public double yRange() { return 4; } public Coordinate getPoint(int pointNum) { switch(pointNum) { case 0: return new Coordinate(-1,-1); case 1: return new Coordinate(1,-1); case 2: return new Coordinate(1,1); case 3: return new Coordinate(-1,1); case 4: return new Coordinate(-1,-1); } return null; } public static void main(String[] args) { new GrapherTester().drawGraph(100, 100, 500, 500); } } Coordinate class so if any of you want to run and try it out. That is all you would need. public class Coordinate { float x; float y; boolean drawTo; boolean drawFrom; Coordinate(double x, double y) { this.x = (float) x; this.y = (float) y; drawFrom = true; drawTo = true; } Coordinate(double x, double y, boolean drawFrom, boolean drawTo) { this.x = (float) x; this.y = (float) y; this.drawFrom = drawFrom; this.drawTo = drawTo; } public double getX() { return x; } public double getY() { return y; } public boolean drawTo() { return drawTo; } public boolean drawFrom() { return drawFrom; } }

    Read the article

  • Please quickly help with this problem I got 52 minutes left.

    - by Hamish Grubijan
    Write a program that prints the numbers from 1 to 100. But for multiples of three print "Fizz" instead of the number and for the multiples of five print "Buzz". For numbers which are multiples of both three and five print "FizzBuzz". Woman said use any common language. Please make it short and test it. My screen is small. Thanks. P.S. I have test anxiety particularly after talking to people in suits. I also stayed up all night studying Java codes.

    Read the article

  • How to create a simple Proxy to access web servers in C

    - by jesusiniesta
    Hi. I’m trying to create an small Web Proxy in C. First, I’m trying to get a webpage, sending a GET frame to the server. I don’t know what I have missed, but I am not receiving any response. I would really appreciate if you can help me to find what is missing in this code. int main (int argc, char** argv) { int cache_size, //size of the cache in KiB port, port_google = 80, dir, mySocket, socket_google; char google[] = "www.google.es", ip[16]; struct sockaddr_in socketAddr; char buffer[10000000]; if (GetParameters(argc,argv,&cache_size,&port) != 0) return -1; GetIP (google, ip); printf("ip2 = %s\n",ip); dir = inet_addr (ip); printf("ip3 = %i\n",dir); /* Creation of a socket with Google */ socket_google = conectClient (port_google, dir, &socketAddr); if (socket_google < 0) return -1; else printf("Socket created\n"); sprintf(buffer,"GET /index.html HTTP/1.1\r\n\r\n"); if (write(socket_google, (void*)buffer, LONGITUD_MSJ+1) < 0 ) return 1; else printf("GET frame sent\n"); strcpy(buffer,"\n"); read(socket_google, buffer, sizeof(buffer)); // strcpy(message,buffer); printf("%s\n", buffer); return 0; } And this is the code I use to create the socket. I think this part is OK, but I copy it just in case. int conectClient (int puerto, int direccion, struct sockaddr_in *socketAddr) { int mySocket; char error[1000]; if ( (mySocket = socket(AF_INET, SOCK_STREAM, 0)) == -1) { printf("Error when creating the socket\n"); return -2; } socketAddr->sin_family = AF_INET; socketAddr->sin_addr.s_addr = direccion; socketAddr->sin_port = htons(puerto); if (connect (mySocket, (struct sockaddr *)socketAddr,sizeof (*socketAddr)) == -1) { snprintf(error, sizeof(error), "Error in %s:%d\n", __FILE__, __LINE__); perror(error); printf("%s\n",error); printf ("-- Error when stablishing a connection\n"); return -1; } return mySocket; } Thanks!

    Read the article

< Previous Page | 29 30 31 32 33 34 35 36 37 38 39 40  | Next Page >