Search Results

Search found 35302 results on 1413 pages for 'string literals'.

Page 330/1413 | < Previous Page | 326 327 328 329 330 331 332 333 334 335 336 337  | Next Page >

  • C# and com for vb6

    - by Jim
    Hi all I have an issue with C# and COM. :( [Guid("f7d936ba-d816-48d2-9bfc-c18be6873b4d")] [ComVisible(true)] [ClassInterface(ClassInterfaceType.None)] public class Process : IProcess { public Process() { } public int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount) { return 10; } } [ComVisible(true)] [Guid("5c640a0f-0dce-47d4-87df-07cee3b9a1f9")] [InterfaceType(ComInterfaceType.InterfaceIsIUnknown)] public interface IProcess { int UpdateBalance(string accountNumber, string adminEventDescription, decimal curAmount); } And the VB code Private Sub Command1_Click() Dim test As Object Set test = New Forwardslash_PlayerTrackingSystem_Api.Process End Sub I get the following ActiveX component can't create object?

    Read the article

  • linq selecting into custom object

    - by user276640
    what is wrong with such code public List<SearchItem> Search(string find) { return (from i in _dataContext.News where i.Text.Contains(find) select new SearchItem { ControllerAction = "test", id = i.Id.ToString(), LinkText = "test" }).ToList(); } public struct SearchItem { public string ControllerAction; public string LinkText; public string id; }

    Read the article

  • Java: How can a constructor return a value?

    - by HH
    $ cat Const.java public class Const { String Const(String hello) { return hello; } public static void main(String[] args) { System.out.println(new Const("Hello!")); } } $ javac Const.java Const.java:7: cannot find symbol symbol : constructor Const(java.lang.String) location: class Const System.out.println(new Const("Hello!")); ^ 1 error

    Read the article

  • dynamic class property $$value in php

    - by cellis
    How can i reference a class property knowing only a string? class Foo { public $bar; public function TestFoobar() { $this->foobar('bar'); } public function foobar($string) { echo $this->$$string; //doesn't work } } what is the correct way to eval the string?

    Read the article

  • vim: How do I line up ruby options?

    - by TheDeeno
    With vim how do I to turn this: t.string :crypted_password :null => false t.string :password_salt, :null => false into this: t.string :crypted_password, :null => false t.string :password_salt, :null => false without manually adding the spaces to each line?

    Read the article

  • Detecting that a MemberExpression has a value

    - by cs
    How do I detect if a MemberExpression has a value that needs to be compiled/evaluated? I have two separate member expression outputs, the first which has a value, and the second which doesn't. What is the best way to differentiate between the two? exp **{value(Microsoft.Connect.Api.Client.Tests.SearchQueryUnitTests+<>c__DisplayClass6).handle}** [System.Linq.Expressions.MemberExpression]: **{value(Microsoft.Connect.Api.Client.Tests.SearchQueryUnitTests+<>c__DisplayClass6).handle}** NodeType: MemberAccess Type: {Name = "String" FullName = "System.String"} vs exp {x.CreatedBy} [System.Linq.Expressions.MemberExpression]: {x.CreatedBy} NodeType: MemberAccess Type: {Name = "String" FullName = "System.String"}

    Read the article

  • Is it possible to swap lines of xml code in soap

    - by John
    I wish to send a request like <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <connectionId i:type="d:string">connectionId</connectionId> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> what i get is <v:Envelope xmlns:i="xxx"> <v:Header /> <v:Body> <sendTwoWaySmsMessage xmlns="xxx" id="o0" c:root="1"> <twoWaySmsMessage> <message i:type="d:string">love it. It seems to work</message> <mobiles i:type="d:string">345</mobiles> <messageId i:type="d:string">123</messageId> </twoWaySmsMessage> <connectionId i:type="d:string">connectionId</connectionId> </sendTwoWaySmsMessage> </v:Body> </v:Envelope> code is SoapObject request = new SoapObject(WSDL_TARGET_NAMESPACE, url); SoapObject message = new SoapObject("", "twoWaySmsMessage"); request.addProperty("connectionId", did); message.addProperty("message", "love it. It seems to work"); message.addProperty("mobiles", "435"); message.addProperty("messageId", "123"); request.addSoapObject(message); request.setProperty(0, "connectionId"); when i use SoapUI with the second with the "connectionId" swaped it seem to work can anyone help. of have ideas. I have looked at just about every ksoap question out there and cant seem to find an answer?

    Read the article

  • Using \b in C# regular expressions doesn't work?

    - by Nikhil
    I am wondering why the following regex does not match. string query = "\"1 2\" 3"; string pattern = string.Format(@"\b{0}\b", Regex.Escape("\"1 2\"")); string repl = Regex.Replace(query, pattern, "", RegexOptions.CultureInvariant); Note that if I remove the word boundary characters (\b) from pattern, it matches fine. Is there something about '\b' that might be tripping this up?

    Read the article

  • C# Working with Linq binding

    - by Isuru
    I have designed Types as follow: class Cricket { string type; Team tm; public Team Team { get { return tm; } set { tm = value; } } public string Type { get { return type; } set { type = value; } } } class Team { string country; Players plr; public Players Players { get {return plr; } set { plr = value; } } public string Country { get { return country; } set { country = value; } } } class Players { string name; DateTime dob; int run; public string Name { get { return name; } set { name = value; } } public DateTime DOB { get { return dob; } set { dob = value; } } public int Run { get { return run; } set { run = value; } } } I have to get the following using LINQ techniques. 1) Youngest all data of the youngest player among all teams 2) Oldest Player of each team 3) The highest run scorer will receive Gold Medal,rest of the players of all team will receive Silver medal. (Please look at the GetPlayer() i have declared var Medal=new String[] {"Gold","Silver"} to associate the Medal ) public void GetPlayer() { var TeamMatrix = new Cricket[] { new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1989"), Name="Russel", Run=45}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="England", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1991"), Name="Joel", Run=56}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1990"), Name="Clark", Run=145}}}, new Cricket{ Type="Twenty20", Team=new Team{ Country="Australia", Players=new Players{ DOB=Convert.ToDateTime("01/Jan/1971"), Name="Bevan", Run=156}}} }; var Medal = new string[] { "Gold", "Silver" }; var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); Console.WriteLine("Youngest Age={0}",tm); } When I declare var tm = (from mat in TeamMatrix select new { mat.Team.Players.DOB }).Max(); I receive error atleast one object must implement IComparable. What is the actual way to complete the above three tasks? ( Tasks 1 ,2 ,3 are explained above). Thanks to all.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Print XML file and download it

    - by Pankaj
    I am create xml using serialization and trying to print them using this code string xmlDate = xml.GetXML(); string name = string.Format("{0}_HighEST", ProjectName); Response.AddHeader("Content-disposition", "attachment; filename=\"" + name + "_HighEST.xml\""); Response.ContentType = string.Format("application/.xml", name); how can assign my xmldata to Response so that data will write on downloaded xml?

    Read the article

  • Serialization of non-required fields in protobuf-net

    - by David Hedlund
    I have a working java client that is communicating with Google, through ProtoBuf serialized messages. I am currently trying to translate that client into C#. I have a .proto file where the parameter appId is an optional string. Its default value in the C# representation as generated by the protobuf-net library is an empty string, just as it is in the java representation of the same file. message AppsRequest { optional AppType appType = 1; optional string query = 2; optional string categoryId = 3; optional string appId = 4; optional bool withExtendedInfo = 6; } I find that when I explicitly set appId to "" in the java client, the client stops working (403 Bad Request from Google). When I explicitly set appId to null in the java client, everything works, but only because hasAppId is being set to false (I'm uncertain as to how that affects the serialization). In the C# client, I always get 403 responses. I don't see any logic behind the distinction between not setting a value, and setting the default value, that seems to make all the difference in the java client. Since the output is always a binary stream, I am not sure if the successful java messages are being serialized with an empty string, or not serialized at all. In the C# client, I've tried setting IsRequired to true on the ProtoMember attribute, to force them to serialize, and I've tried setting the default value to null, and explicitly set "", so I'm quite sure I've tried some configuration where the value is being serialized. I've also played around with ProtoBuf.ProtoIgnore and at some point, removing the appId parameter altogether, but I haven't been able to avoid the 403 errors in C#. I've tried manually copying the serialized string from java, and that resolved my issues, so I'm certain that the rest of the HTTP Request is working, and the error can be traced to the serialized object. My serialization is simply this: var clone = ProtoBuf.Serializer.DeepClone(request); MemoryStream ms = new MemoryStream(2000); ProtoBuf.Serializer.Serialize(ms, clone); var bytearr = ms.ToArray(); string encodedData = Convert.ToBase64String(bytearr); I'll admit to not being quite sure about what DeepClone does. I've tried both with and without it...

    Read the article

  • Type problem with Observable.Create from Boo

    - by Tristan
    I'm trying to use Reactive Extensions from Boo and am running into type problems. Here's the basic example: def OnSubscribe(observer as IObservable[of string]) as callable: print "subscribing" def Dispose(): print "disposing" return Dispose observable = System.Linq.Observable.Create[of string](OnSubscribe) observer = System.Linq.Observer.Create[of string]({x as string | print x}) observable.Subscribe(observer) The Subscribe here gives a System.InvalidCastException: Cannot cast from source type to destination type. The issue appears to be with how I'm creating the observable, but I've struggled to see where the type problem arises from. Ideas?

    Read the article

  • How does Java pick which method to call?

    - by Gaurav
    Given the following code: public class Test { public void method(Object o){ System.out.println("object"); } public void method(String s) { System.out.println("String"); } public void method() { System.out.println("blank"); } /** * @param args */ public static void main(String[] args) { // TODO Auto-generated method stub Test test=new Test(); test.method(null); } } Java prints "String". Why is this the case?

    Read the article

  • How to use LINQ to query list of strings that do not contain substring entries from another list

    - by p.campbell
    string candidates = new string[] { "Luke_jedi", "Force_unknown", "Vader_jedi" , "Emperor_human", "r2d2_robot" }; string[] disregard = new string[] {"_robot", "_jedi"}; //find those that aren't jedi or robots. var nonJedi = candidates.Where(c=> c.??? //likely using EndsWith() and Any() ); How would you implement this solution using LINQ to find all those that do not end with any of the disregards items?

    Read the article

  • asp.net mvc HttpPostedFileBase getting file extension

    - by mazhar kaunain baig
    public string ContructOrganizationNameLogo(HttpPostedFileBase upload, string OrganizationName, int OrganizationID,string LangName) { var UploadedfileName = Path.GetFileName(upload.FileName); string type = upload.ContentType; } I want to get the extension of the file to dynamically generate the name of the file.One way i will use to split the type. but can i use HttpPostedFileBase object to get the extension in the clean way?

    Read the article

  • convert 0.5 to 0.50 in C#

    - by Rohit
    I have a string which holds 0.5. I have to convert in to 0.50. I have tried following ways but nothing works.Please help hdnSliderValue.Value is 0.5,I want workFlow.QualityThresholdScore to be 0.50 workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:d}",hdnSliderValue.Value)); workFlow.QualityThresholdScore = Convert.ToDecimal(String.format("{0:0.00}",hdnSliderValue.Value)); IS there any built in function or will i have to do string handling to accomplish this.

    Read the article

  • Recursion problem; completely lost

    - by timeNomad
    So I've been trying to solve this assignment whole day, just can't get it. The following function accepts 2 strings, the 2nd (not 1st) possibly containing *'s (asterisks). An * is a replacement for a string (empty, 1 char or more), it can appear appear (only in s2) once, twice, more or not at all, it cannot be adjacent to another * (ab**c), no need to check that. public static boolean samePattern(String s1, String s2) It returns true if strings are of the same pattern. It must be recursive, not use any loops, static & global variables. Can use local variables & method overloading. Can use only these methods: charAt(i), substring(i), substring(i, j), length(). Examples: 1: TheExamIsEasy; 2: "The*xamIs*y" --- true 1: TheExamIsEasy; 2: "Th*mIsEasy*" --- true 1: TheExamIsEasy; 2: "*" --- true 1: TheExamIsEasy; 2: "TheExamIsEasy" --- true 1: TheExamIsEasy; 2: "The*IsHard" --- FALSE I tried comparing the the chars one by one using charAt until an asterisk is encountered, then check if the asterisk is an empty one by comparing is successive char (i+1) with the char of s1 at position i, if true -- continue recursion with i+1 as counter for s2 & i as counter for s1; if false -- continue recursion with i+1 as counters for both. Continue this until another asterisk is found or end of string. I dunno, my brain loses track of things, can't concentrate, any pointers / hints? Am I in the right direction? Also, it's been told that a backtracking technique is to be used to solve this. My code so far (doesn't do the job, even theoretically): public static boolean samePattern(String s1, String s2) { if (s1.equals(s2) || s2 == "*") { return true; } return samePattern(s1, s2, 1); } public static boolean samePattern(String s1, String s2, int i) { if (s1.equals(s2)) return true; if (i == s2.length() - 1) // No *'s found -- not same pattern. return false; if (s1.substring(0, i).equals(s2.substring(0, i))) samePattern(s1, s2, i+1); else if (s2.charAt(i-1) == '*') samePattern(s1.substring(0, i-1), s2.substring(0, i), 1); // new smaller strings. else samePattern(s1.substring(1), s2, i); }

    Read the article

  • Is Abstract Factory Pattern implemented correctly for given scenario.... ???

    - by Amit
    First thing... I am novice to pattern world, so correct me if wrong anywhere Scenario: There are multiple companies providing multiple products of diff size so there are 3 entities i.e. Companies, Their Product and size of product I have implement Abstract Pattern on this i.e. so that I will create instance of IProductFactory interface to get desired product... Is below implementation of Abstract Factory Pattern correct ??? If not then please correct the approach + Also tell me if any other pattern can be used for such scenario Thanks in advance... public enum Companies { Samsung = 0, LG = 1, Philips = 2, Sony = 3 } public enum Product { PlasmaTv = 0, DVD = 1 } public enum ProductSize { FortyTwoInch, FiftyFiveInch } interface IProductFactory { IPhilips GetPhilipsProduct(); ISony GetSonyProduct(); } interface ISony { string CreateProducts(Product product, ProductSize size); } interface IPhilips { string CreateProducts(Product product, ProductSize size); } class ProductFactory : IProductFactory { public IPhilips GetPhilipsProduct() { return new Philips(); } public ISony GetSonyProduct() { return new Sony(); } } class Philips : IPhilips { #region IPhilips Members public string CreateProducts(Product product, ProductSize size) {// I have ingnore size for now.... string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } class Sony : ISony {// I have ingnore size for now.... #region ISony Members public string CreateProducts(Product product, ProductSize size) { string output = string.Empty; if (product == Product.PlasmaTv) { output = "Plasma TV Created !!!"; } else if (product == Product.DVD) { output = "DVD Created !!!"; } return output; } #endregion } IProductFactory prodFactory = new ProductFactory(); IPhilips philipsObj = prodFactory.GetPhilipsProduct(); MessageBox.Show(philipsObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch)); or //ISony sonyObj = prodFactory.GetSonyProduct(); //MessageBox.Show(sonyObj.CreateProducts(Product.DVD, ProductSize.FortyTwoInch));

    Read the article

  • How to make html image clickable inside a TextView

    - by Gonan
    I have the following text in a string in the resources file: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;</a> It shows the image fine (I implemented ImageGetter) but it is not clickable. I have tried adding the Linkify thingy but I don't think it's meant for this case, and so it doesn't work. The setMovementMethod doesn't work either. I have tried different combinations of the above: <a href="mailto:[email protected]">&lt;img src="mail_big" /&gt;hello</a> Here, even the "hello" part is not clickable (neither blue nor underlined). <a href="mailto:[email protected]"><img src="mail_big" /></a> This doesn't even show the image. &lt;a href="mailto:[email protected]"&gt;&lt;img src="mail_big" /&gt;&lt;/a&gt; If I just write the email, without the <a> tag it works perfectly, but I would like to use the image of an envelope that the user can click on. It's not possible to use an imagebutton because this text is in the middle of a string and so I can't split it. Any ideas? Thanks! EDIT: I found a solution or rather found how to do it correctly. All I had to do was adding the setMovementMethod call before the call to setText in the TextView and ALSO, and COMPLETELY NECESSARY, remove the attribute "android:autoLink="all" from the layout. Apparently, parsing mails and urls in a string is mutually exclusive to interpreting the link tags in a string. So one or the other but not both. Finally my layout is just a TextView with nothing special, just width and height. The activity is like this: TextView tv = (TextView)findViewById(R.id.about_text); tv.setMovementMethod(LinkMovementMethod.getInstance()); tv.setText(Html.fromHtml(getString(R.string.about_content), new ImageGetter(), null)); And the string is like this: <string name="about_content"><a href="mailto:[email protected]"><img src="mail" /></a></string>

    Read the article

  • How to access a field's value in an object using reflection

    - by kentcdodds
    My Question: How to overcome an IllegalAccessException to access the value of a an object's field using reflection. Expansion: I'm trying to learn about reflection to make some of my projects more generic. I'm running into an IllegalAccessException when trying to call field.getValue(object) to get the value of that field in that object. I can get the name and type just fine. If I change the declaration from private to public then this works fine. But in an effort to follow the "rules" of encapsulation I don't want to do this. Any help would be greatly appreciated! Thanks! My Code: package main; import java.lang.reflect.Field; public class Tester { public static void main(String args[]) throws Exception { new Tester().reflectionTest(); } public void reflectionTest() throws Exception { Person person = new Person("John Doe", "555-123-4567", "Rover"); Field[] fields = person.getClass().getDeclaredFields(); for (Field field : fields) { System.out.println("Field Name: " + field.getName()); System.out.println("Field Type: " + field.getType()); System.out.println("Field Value: " + field.get(person)); //The line above throws: Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" } } public class Person { private final String name; private final String phoneNumber; private final String dogsName; public Person(String name, String phoneNumber, String dogsName) { this.name = name; this.phoneNumber = phoneNumber; this.dogsName = dogsName; } } } The Output: run: Field Name: name Field Type: class java.lang.String Exception in thread "main" java.lang.IllegalAccessException: Class main.Tester can not access a member of class main.Tester$Person with modifiers "private final" at sun.reflect.Reflection.ensureMemberAccess(Reflection.java:95) at java.lang.reflect.AccessibleObject.slowCheckMemberAccess(AccessibleObject.java:261) at java.lang.reflect.AccessibleObject.checkAccess(AccessibleObject.java:253) at java.lang.reflect.Field.doSecurityCheck(Field.java:983) at java.lang.reflect.Field.getFieldAccessor(Field.java:927) at java.lang.reflect.Field.get(Field.java:372) at main.Tester.reflectionTest(Tester.java:17) at main.Tester.main(Tester.java:8) Java Result: 1 BUILD SUCCESSFUL (total time: 0 seconds)

    Read the article

  • Several client waiting for the same event

    - by ff8mania
    I'm developing a communication API to be used by a lot of generic clients to communicate with a proprietary system. This proprietary system exposes an API, and I use a particular classes to send and wait messages from this system: obviously the system alert me that a message is ready using an event. The event is named OnMessageArrived. My idea is to expose a simple SendSyncMessage(message) method that helps the user/client to simply send a message and the method returns the response. The client: using ( Communicator c = new Communicator() ) { response = c.SendSync(message); } The communicator class is done in this way: public class Communicator : IDisposable { // Proprietary system object ExternalSystem c; String currentRespone; Guid currentGUID; private readonly ManualResetEvent _manualResetEvent; private ManualResetEvent _manualResetEvent2; String systemName = "system"; String ServerName = "server"; public Communicator() { _manualResetEvent = new ManualResetEvent(false); //This methods are from the proprietary system API c = SystemInstance.CreateInstance(); c.Connect(systemName , ServerName); } private void ConnectionStarter( object data ) { c.OnMessageArrivedEvent += c_OnMessageArrivedEvent; _manualResetEvent.WaitOne(); c.OnMessageArrivedEvent-= c_OnMessageArrivedEvent; } public String SendSync( String Message ) { Thread _internalThread = new Thread(ConnectionStarter); _internalThread.Start(c); _manualResetEvent2 = new ManualResetEvent(false); String toRet; int messageID; currentGUID = Guid.NewGuid(); c.SendMessage(Message, "Request", currentGUID.ToString()); _manualResetEvent2.WaitOne(); toRet = currentRespone; return toRet; } void c_OnMessageArrivedEvent( int Id, string root, string guid, int TimeOut, out int ReturnCode ) { if ( !guid.Equals(currentGUID.ToString()) ) { _manualResetEvent2.Set(); ReturnCode = 0; return; } object newMessage; c.FetchMessage(Id, 7, out newMessage); currentRespone = newMessage.ToString(); ReturnCode = 0; _manualResetEvent2.Set(); } } I'm really noob in using waithandle, but my idea was to create an instance that sends the message and waits for an event. As soon as the event arrived, checks if the message is the one I expect (checking the unique guid), otherwise continues to wait for the next event. This because could be (and usually is in this way) a lot of clients working concurrently, and I want them to work parallel. As I implemented my stuff, at the moment if I run client 1, client 2 and client 3, client 2 starts sending message as soon as client 1 has finished, and client 3 as client 2 has finished: not what I'm trying to do. Can you help me to fix my code and get my target? Thanks!

    Read the article

  • Scala Map conversion

    - by Benjamin Metz
    I'm a Scala newbie I'm afraid: I'm trying to convert a Map to a new Map based on some simple logic: val postVals = Map("test" - "testing1", "test2" - "testing2", "test3" - "testing3") I want to test for value "testing1" and change the value (while creating a new Map) def modMap(postVals: Map[String, String]): Map[String, String] = { postVals foreach {case(k, v) => if(v=="testing1") postVals.update(k, "new value")} }

    Read the article

  • Get individual query parameters from Uri

    - by Ghostrider
    I have a uri string like: http://example.com/file?a=1&b=2&c=string%20param Is there an existing function that would convert query parameter string into a dictionary same way as ASP.NET Context.Request does it. I'm writing a console app and not a web-service so there is no Context.Request to parse the URL for me. I know that it's pretty easy to crack the query string myself but I'd rather use a FCL function is if exists.

    Read the article

  • Can't figure out where race condition is occuring

    - by Nik
    I'm using Valgrind --tool=drd to check my application that uses Boost::thread. Basically, the application populates a set of "Book" values with "Kehai" values based on inputs through a socket connection. On a seperate thread, a user can connect and get the books send to them. Its fairly simple, so i figured using a boost::mutex::scoped_lock on the location that serializes the book and the location that clears out the book data should be suffice to prevent any race conditions. Here is the code: void Book::clear() { boost::mutex::scoped_lock lock(dataMutex); for(int i =NUM_KEHAI-1; i >= 0; --i) { bid[i].clear(); ask[i].clear(); } } int Book::copyChangedKehaiToString(char* dst) const { boost::mutex::scoped_lock lock(dataMutex); sprintf(dst, "%-4s%-13s",market.c_str(),meigara.c_str()); int loc = 17; for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(ask[i].changed > 0) { sprintf(dst+loc,"A%i%-21s%-21s%-21s%-8s%-4s",i,ask[i].price.c_str(),ask[i].volume.c_str(),ask[i].number.c_str(),ask[i].postTime.c_str(),ask[i].status.c_str()); loc += 77; } } for(int i = 0; i < Book::NUM_KEHAI; ++i) { if(bid[i].changed > 0) { sprintf(dst+loc,"B%i%-21s%-21s%-21s%-8s%-4s",i,bid[i].price.c_str(),bid[i].volume.c_str(),bid[i].number.c_str(),bid[i].postTime.c_str(),bid[i].status.c_str()); loc += 77; } } return loc; } The clear() function and the copyChangedKehaiToString() function are called in the datagetting thread and data sending thread,respectively. Also, as a note, the class Book: struct Book { private: Book(const Book&); Book& operator=(const Book&); public: static const int NUM_KEHAI=10; struct Kehai; friend struct Book::Kehai; struct Kehai { private: Kehai& operator=(const Kehai&); public: std::string price; std::string volume; std::string number; std::string postTime; std::string status; int changed; Kehai(); void copyFrom(const Kehai& other); Kehai(const Kehai& other); inline void clear() { price.assign(""); volume.assign(""); number.assign(""); postTime.assign(""); status.assign(""); changed = -1; } }; std::vector<Kehai> bid; std::vector<Kehai> ask; tm recTime; mutable boost::mutex dataMutex; Book(); void clear(); int copyChangedKehaiToString(char * dst) const; }; When using valgrind --tool=drd, i get race condition errors such as the one below: ==26330== Conflicting store by thread 1 at 0x0658fbb0 size 4 ==26330== at 0x653AE68: std::string::_M_mutate(unsigned int, unsigned int, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653AFC9: std::string::_M_replace_safe(unsigned int, unsigned int, char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B064: std::string::assign(char const*, unsigned int) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x653B134: std::string::assign(char const*) (in /usr/lib/libstdc++.so.6.0.8) ==26330== by 0x8055D64: Book::Kehai::clear() (Book.h:50) ==26330== by 0x8094A29: Book::clear() (Book.cpp:78) ==26330== by 0x808537E: RealKernel::start() (RealKernel.cpp:86) ==26330== by 0x804D15A: main (main.cpp:164) ==26330== Allocation context: BSS section of /usr/lib/libstdc++.so.6.0.8 ==26330== Other segment start (thread 2) ==26330== at 0x400BB59: pthread_mutex_unlock (drd_pthread_intercepts.c:633) ==26330== by 0xC59565: pthread_mutex_unlock (in /lib/libc-2.5.so) ==26330== by 0x805477C: boost::mutex::unlock() (mutex.hpp:56) ==26330== by 0x80547C9: boost::unique_lock<boost::mutex>::~unique_lock() (locks.hpp:340) ==26330== by 0x80949BA: Book::copyChangedKehaiToString(char*) const (Book.cpp:134) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x8092D05: BookSnapshotManager::getSnaphotDataList() (BookSnapshotManager.cpp:72) ==26330== by 0x8088179: SnapshotServer::getDataList() (SnapshotServer.cpp:246) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) ==26330== by 0x808BB90: boost::_bi::bind_t<void, boost::_mfi::mf0<void, RealThread>, boost::_bi::list1<boost::_bi::value<RealThread*> > >::operator()() (bind_template.hpp:20) ==26330== Other segment end (thread 2) ==26330== at 0x400B62A: pthread_mutex_lock (drd_pthread_intercepts.c:580) ==26330== by 0xC59535: pthread_mutex_lock (in /lib/libc-2.5.so) ==26330== by 0x80546B8: boost::mutex::lock() (mutex.hpp:51) ==26330== by 0x805473B: boost::unique_lock<boost::mutex>::lock() (locks.hpp:349) ==26330== by 0x8054769: boost::unique_lock<boost::mutex>::unique_lock(boost::mutex&) (locks.hpp:227) ==26330== by 0x8094711: Book::copyChangedKehaiToString(char*) const (Book.cpp:113) ==26330== by 0x80937EE: BookSerializer::serializeBook(Book const&, std::string const&) (BookSerializer.cpp:41) ==26330== by 0x808870F: SnapshotServer::run() (SnapshotServer.cpp:183) ==26330== by 0x808BAF5: boost::_mfi::mf0<void, RealThread>::operator()(RealThread*) const (mem_fn_template.hpp:49) ==26330== by 0x808BB4D: void boost::_bi::list1<boost::_bi::value<RealThread*> >::operator()<boost::_mfi::mf0<void, RealThread>, boost::_bi::list0>(boost::_bi::type<void>, boost::_mfi::mf0<void, RealThread>&, boost::_bi::list0&, int) (bind.hpp:253) For the life of me, i can't figure out where the race condition is. As far as I can tell, clearing the kehai is done only after having taken the mutex, and the same holds true with copying it to a string. Does anyone have any ideas what could be causing this, or where I should look? Thank you kindly.

    Read the article

< Previous Page | 326 327 328 329 330 331 332 333 334 335 336 337  | Next Page >