Search Results

Search found 24037 results on 962 pages for 'every'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 337/962 | < Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >

  • regular expression

    - by xyz
    I need regular expression to match braces correct e.g for every open one close one abc{abc{bc}xyz} I need it get all it from {abc{bc}xyz} not get {abc{bc} I tried this ({.*?})

    Read the article

  • How to specify number of headers in section UITableView.

    - by Mr. McPepperNuts
    if ([tempArray containsObject: [sectionInfo indexTitle]]) { return nil; }else { [tempArray addObject: [sectionInfo indexTitle]]; return [sectionInfo indexTitle]; } return [sectionInfo indexTitle]; The code above groups the cells in alphabetical order but displays a blank header instead of the appropriate title. Could this possibly be because I did not specify the number of headers? This would naturally be a single header for every letter in the alphabet.

    Read the article

  • Displaying Data on the Form with C#

    - by The.Anti.9
    I'm searching files and returning lines that include the search text, and I'm not really sure the best way to display the information I get. Every time I get a match, I want to show, in some sort of control, the File it came from, and the whole text line. (aka streamreader.ReadLine() result). First I tried just putting it all in a read-only text box, but it doesn't have a scroll bar. What is the best form control to help me display this data neatly?

    Read the article

  • Logging broadcast Intents and manually trigger them (Android)

    - by poeschlorn
    Hey guys, during my development in android I've missed a function that can log every broadcast intent that occur. Sometimes it had been very useful to have a function like that... I'm also wondering how to trigger those broadcast intents manually on the emulator. Is there an entire overview of available broadcast intents? Would be great if someone would have some answers, greets, poeschlorn

    Read the article

  • Can't download the .mp3 file from an URL after a few days

    - by user252606
    Hello, I want to download a .mp3 file on a Website with NSSURLConnection on IPhone, This .mp3 URL of the file is: http://dl.mp3.kapsule.info/fsfsdfdsfdserwrwq3/fc90613208cc3f16ae6d6ba05d21880c/4b5244f0/b/7e/b7e80afa18d06fdd3dd9f9fa44b51fc0.mp3?filename=Every-Day-I-Love-You.mp3 When I built my app, it run OK. My app downloaded the .mp3 file successful and then played it. However, after a few days, I run my app again, the app can't downloaded the .mp3 file. How can I download the .mp3 file all the time? Thank you very much.

    Read the article

  • Scala println in a for loop

    - by random459
    The following Scala code does just what I expect it to - it prints each line of some_file.txt. import scala.io.Source val lines = Source.fromPath("some_file.txt").mkString for (line <- lines) print(line) If I use println instead of print, I expect to see some_file.txt printed out with double-spacing. Instead, the program prints a newline after every character of some_file.txt. Could someone explain this to me? I'm using Scala 2.8.0 Beta 1.

    Read the article

  • Creating a Web Service to automatically get information

    - by Sean P
    I want to create some sort of method of creating a web service that will run automatically and run DB queries and some API calls which will then store data that I can use/call without taking the processing or time penalty of doing it every time a user access my web service. Is this possible? If so, point me in the right direction on how to implement something like this Using vb.net and ASP.net Thanks in advance!!

    Read the article

  • How to design a grid in Android (for multi-screen)

    - by Cris
    Hello, i need to realize an app for Android using this background image: Over every cell i have to draw a TextView, but i don't know how to do it with the different screens; i have the background image with 3 resolutions (240x320, 320x480, 480x800) but i don't know what kind of layout to use; i would use GridView but i don't know if i can work with different column size. Can anyone help me? Thanks in advance

    Read the article

  • dynamic xpath expression

    - by Ferol
    Good day, colleagues! Tell me please, how to make a dynamic xpath-parsing: for example, instead of writing $domXPath-query('//[(@id = "article-id-18")]'); - write something like that $domXPath-query('//[(@id = "article-id-*")]');, because in my case, the site's script generate (every time) a new id for block, that contains article's text? So question, is above.

    Read the article

  • Trying to implement a method that can compare any two lists but it always returns false

    - by Tyler Pfaff
    Hello like the title says I'm trying to make a method that can compare any two lists for equality. I'm trying to compare them in a way that validates that every element of one list has the same value as every element of another list. My Equals method below always returns false, can anyone see why that is? Thank you! using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.Threading.Tasks; public class IEnumerableComparer<T> : IEqualityComparer<IEnumerable<T>> { public bool Equals(IEnumerable<T> x, IEnumerable<T> y) { for(int i = 0; i<x.Count();i++){ if(!Object.Equals(x.ElementAt(i), y.ElementAt(i))){ return false; } } return true; } public int GetHashCode(IEnumerable<T> obj) { if (obj == null) return 0; return unchecked(obj.Select(e => e.GetHashCode()).Aggregate(0, (a, b) => a + b)); } } Here is my data I'm using to test this Equals method. static void Main(string[] args) { Car car1 = new Car(); car1.make = "Toyota"; car1.model = "xB"; Car car2 = new Car(); car2.make = "Toyota"; car2.model = "xB"; List<Car> l1 = new List<Car>(); List<Car> l2 = new List<Car>(); l1.Add(car1); l2.Add(car2); IEnumerableComparer<Car> seq = new IEnumerableComparer<Car>(); bool b = seq.Equals(l1, l2); Console.Write(b); //always says false Console.Read(); } } Car class class Car { public String make { get; set; } public String model { get; set; } }

    Read the article

  • JSF SelectOneMenuItem onselect attribute

    - by William
    I have created selectOneMenuItem(JSF).I placed my events on valueChangeListener / onchange like that <h:selectOneMenu id="ddl" value="#{Foo.attr}" onchange="submit()" valueChangeListener="#{Foo.renderFoo}"> When I select one vlaue from selectOneMenuItem then event fires.Now when I reselect that value ,then event doesn't fire (because this is the valueChangeListener event) so it doesn't fire.I want that event should fire on every selection even on again the same selection.I found onselect but unable to find that is it right and how can i use this onselect.Anyu help would be greatly appreciable

    Read the article

  • Keeping DB Table sorted using multi-field formula (Microsoft SQL Server)

    - by user298167
    I have a JOB table, with two interesting columns: Creation Date Importance (high - 3, medium 2, low - 1). A JOB record's priority calculated like this: Priority = Importance * (time passed since creation) The problem is, every time I would like to pick 200 jobs with highest priority, and I don't want to resort the table. Is there a way to keep rows sorted? I was also thinking about having three tables one for High, Medium and Low and then sort those by Creation Date.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Is it Bad Practice to use C++ only for the STL containers?

    - by gmatt
    First a little background ... In what follows, I use C,C++ and Java for coding (general) algorithms, not gui's and fancy program's with interfaces, but simple command line algorithms and libraries. I started out learning about programming in Java. I got pretty good with Java and I learned to use the Java containers a lot as they tend to reduce complexity of book keeping while guaranteeing great performance. I intermittently used C++, but I was definitely not as good with it as with Java and it felt cumbersome. I did not know C++ enough to work in it without having to look up every single function and so I quickly reverted back to sticking to Java as much as possible. I then made a sudden transition into cracking and hacking in assembly language, because I felt I was concentrated too much attention on a much too high level language and I needed more experience with how a CPU interacts with memory and whats really going on with the 1's and 0's. I have to admit this was one of the most educational and fun experiences I've had with computers to date. For obviously reasons, I could not use assembly language to code on a daily basis, it was mostly reserved for fun diversions. After learning more about the computer through this experience I then realized that C++ is so much closer to the "level of 1's and 0's" than Java was, but I still felt it to be incredibly obtuse, like a swiss army knife with far too many gizmos to do any one task with elegance. I decided to give plain vanilla C a try, and I quickly fell in love. It was a happy medium between simplicity and enough "micromanagent" to not abstract what is really going on. However, I did miss one thing about Java: the containers. In particular, a simple container (like the stl vector) that expands dynamically in size is incredibly useful, but quite a pain to have to implement in C every time. Hence my code currently looks like almost entirely C with containers from C++ thrown in, the only feature I use from C++. I'd like to know if its consider okay in practice to use just one feature of C++, and ignore the rest in favor of C type code?

    Read the article

  • How can I get node coordinates from a graph, using Perl?

    - by jonny
    Ok, I have a flowchart definition (basically, array of nodes and edges for each node). Now I want to calculate coordinates for every task in the flow, preferably hierarchycal style. I need something like Graph::Easy::Layout but I have no idea how to get nodes coordinates: I render nodes myself and I only want to retrieve box coordinates/size. Any suggestions? What I need is a CPAN module available even in Debian repository.

    Read the article

  • Weirdest occurrence ever, UIButton @selector detecting right button, doing wrong 'else_if'?

    - by Scott
    So I dynamically create 3 UIButtons (for now), with this loop: NSMutableArray *sites = [[NSMutableArray alloc] init]; NSString *one = @"Constution Center"; NSString *two = @"Franklin Court"; NSString *three = @"Presidents House"; [sites addObject: one]; [one release]; [sites addObject: two]; [two release]; [sites addObject: three]; [three release]; NSString *element; int j = 0; for (element in sites) { UIButton *button = [UIButton buttonWithType:UIButtonTypeCustom]; //setframe (where on screen) //separation is 15px past the width (45-30) button.frame = CGRectMake(a, b + (j*45), c, d); [button setTitle:element forState:UIControlStateNormal]; button.backgroundColor = [SiteOneController myColor1]; [button addTarget:self action:@selector(showCCView:) forControlEvents:UIControlEventTouchUpInside]; [button setTag:j]; [self.view addSubview: button]; j++; } The @Selector method is here: - (void) showCCView:(id) sender { UIButton *button = (UIButton *)sender; int whichButton = button.tag; NSString* myNewString = [NSString stringWithFormat:@"%d", whichButton]; self.view = [[UIView alloc] initWithFrame:[[UIScreen mainScreen] applicationFrame]]; self.view.backgroundColor = [UIColor whiteColor]; UINavigationBar *cc = [SiteOneController myNavBar1:@"Constitution Center Content"]; UINavigationBar *fc = [SiteOneController myNavBar1:@"Franklin Court Content"]; UINavigationBar *ph = [SiteOneController myNavBar1:@"Presidents House Content"]; if (whichButton = 0) { NSLog(myNewString); [self.view addSubview:cc]; } else if (whichButton = 1) { NSLog(myNewString); [self.view addSubview:fc]; } else if (whichButton = 2) { NSLog(myNewString); [self.view addSubview:ph]; } } Now, it is printing the correct button tag to NSLog, as shown in the method, however EVERY SINGLE BUTTON is displaying a navigation bar with "Franklin Court" as the title, EVERY SINGLE ONE, even though when I click button 0, it says "Button 0 clicked" in the console, but still performs the else if (whichButton = 1) code. Am I missing something here?

    Read the article

  • Possible to "next track" e.g. Spotify from my app?

    - by parse
    I'm planning on doing a application for Android 2.1 that changes song every minute (through what I hope exists in Android, "next track") for the application using the audio device atm. So if I have Spotify (http://www.spotify.com) running in background already, playing music, can I through my program change to the next track? Let me know if I was unclear about anything. Thanks in advance!

    Read the article

  • can i quickly run entire page's text through a function on page load?

    - by korben
    i have setup a profanity filter with bad words in a XML file and have the following function to run on my page to replace the words: BadWordFilter.Instance.GetCleanString(TextBox1.Text); i'm about to go through my entire site now wrapping that function around every little text variable one by one and it's going to be a huge pain in the butt i'm hoping there's a way that i could just set my masterpage to automatically run all text through this thing on any page_load, so that the effect would be site-wide instantly. is this possible? much appreciated for any help

    Read the article

  • Wildcard DNS with URI Request

    - by gregavola
    So here is my problem. I want to redirect name.domain.com/trips/1 to domain.com?username=name&trip=1 using modrewrite. Is this possible? I have the dns set up correctly however - I am unsure about the htaccess file. Can I link all this information to one PHP or do I need to create a directory for every user? Thanks for your help.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 333 334 335 336 337 338 339 340 341 342 343 344  | Next Page >