Search Results

Search found 4934 results on 198 pages for 'finding'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 34/198 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • tomcat startup.sh trouble finding JAVA_HOME

    - by peter
    I am a bit puzzled by this strange behavior on CentOs 5.4 when starting Tomcat 6.0 as a service I've added a script at /etc/init.d/tomcat that can start/stop/restart Apache Tomcat 6.0 with user 'tomcat', and registered it as service. The problem with the service is that I am getting a 'Neither the JAVA_HOME nor the JRE_HOME environment variable is defined'. But when type 'sudo -u tomcat echo $JAVA_HOME' I get '/usr/java/jdk1.5.0_22' which is correct since I am using that JDK. What can I do about this?

    Read the article

  • finding the maximum in series

    - by peril brain
    I need to know a code that will automatically:- search a specific word in excel notes it row or column number (depends on data arrangement) searches numerical type values in the respective row or column with that numeric value(suppose a[7][0]or a[0][7]) it compares all other values of respective row or column(ie. a[i][0] or a[0][i]) sets that value to the highest value only if IT HAS GOT NO FORMULA FOR DERIVATION i know most of coding but at a few places i got myself stuck... i'm writing a part of my program upto which i know: using System; using System.Collections.Generic; using System.Linq; using System.Text; using System.IO; using System.Threading; using Microsoft.Office.Interop; using Excel = Microsoft.Office.Interop.Excel; Excel.Application oExcelApp; namespace a{ class b{ static void main(){ try { oExcelApp = (Excel.Application)System.Runtime.InteropServices.Marshal.GetActiveObject("Excel.Application"); ; if(oExcelApp.ActiveWorkbook != null) {Excel.Workbook xlwkbook = (Excel.Workbook)oExcelApp.ActiveWorkbook; Excel.Worksheet ws = (Excel.Worksheet)xlwkbook.ActiveSheet; Excel.Range rn; rn = ws.Cells.Find("maximum", Type.Missing, Excel.XlFindLookIn.xlValues, Excel.XlLookAt.xlPart,Excel.XlSearchOrder.xlByRows, Excel.XlSearchDirection.xlNext, false, Type.Missing, Type.Missing); }}} now ahead of this i only know tat i have to use cell.value2 ,cell.hasformula methods..... & no more idea can any one help me with this..

    Read the article

  • jquery -> finding elements and navigating throug?

    - by mathiregister
    Hey guys, i wonder how i can solve the following problem. i have a horizontal scrollbar with floating divs side by side (.picture_holder). I wonder if i can find() this elements and animate a scroll event to the startpoint of every image. If i reach the last div i it to scroll to the first. # $('.next').click(function(){ # $('html, body').animate({scrollTo:Position von .picture_holder2}, 'slow'); # }); ?? any ideas how i could solve this?

    Read the article

  • jquery selectors (finding tag)

    - by matthewsteiner
    I'm sure this is simple, but I can't seem to figure it out. I need to be able to pass a function an element id, and know what element tag it is. For example: <a id="first"></a> <input id="last" /> If I know the id is "first", how can I get that the tag is "a"?

    Read the article

  • Finding images on the web

    - by Britt
    I sent someone a photo of me and they replied that this particular photo was all over the web. How do I find out where this photo is and is there any way that I can see if there are other photos of myself that someoe has shared without my knowledge? I am very worried about this and want to find out where these pictures are please help me!

    Read the article

  • Function in c++ for finding if a word is prefix

    - by VaioIsBorn
    Let say i have some words AB, AAB, AA. AB is not a prefix to AAB but AA is a prefix to AAB because if i just add B at the end of AA it will become AAB, which is not possible with AB. So, is there any function in c++ (STL) so that i can determine of two words if one is prefix to the another ? Thanks.

    Read the article

  • Finding out inside which iframe a script is executing

    - by juandopazo
    I have a page with several iframes. One of this iframes has a page from a different domain. Inside this iframe there's another iframe with a page from the parent domain. my page from mydomain.com -> an iframe -> iframe "#foo" from another-domain.com> -> iframe "#bar" from mydomain.com -> another iframe I need to get a reference to the "#foo" node inside the main page. The security model should allow me to do that because "#bar" has the same domain as the main page. So what I'm doing is iterating through the window.top array and comparing each element to the window object which is currently the "#bar" window object. My test code looks like: for (var i = 0; i < top.length; i++) { for (var j = 0; j < top[i].length; j++) { if (top[i][j] == window) { alert("The iframe number " + i + " contains me"); } } } This works fine in all browsers, but Internet Explorer 6 throws a security error when accesing top[i][j]. Any ideas on how to solve this on IE6? Thanks!

    Read the article

  • Finding vars from dynamically created namespaces in clojure

    - by Tom Crayford
    The following test fails: (ns clojure_refactoring.rename-fn-test (:use clojure.test)) (deftest test-fn-location (in-ns 'refactoring-test-fn-rename) (clojure.core/refer-clojure) (defn a [b] (inc b)) (in-ns 'clojure_refactoring.rename-fn-test) (is (not= (find-var 'refactoring-test-fn-rename/a) nil)) (remove-ns 'refactoring-test-fn-rename)) That is, find-var (of a var I've just created, in a namespace I've just create) returns nil. This behaviour doesn't happen at the repl, where typing out the steps of the test works just fine. Am I doing something wrong, or is this just something that doesn't work in clojure right now?

    Read the article

  • A tool for finding duplicate code in PHP

    - by Toby
    Are there any tools available that can scan multiple .php files and report back duplicated lines/chunks of code? It doesn't have to be really smart but basically give me a starting point for manual scans to improve the codebase of some of my apps.

    Read the article

  • Finding object count where a field is unique in Django

    - by Johnd
    I have a model that is something like this: class Input(models.Model): details = models.CharField(max_length=1000) user = models.ForeignKey(User) class Case(Input): title = models.CharField(max_length=200) views = models.IntegerField() class Argument(Input): case = models.ForeignKey(Case) side = models.BooleanField() A user can submit many arguments, per case. I want to be able to say how many users have submitted side=true arguments. I mean if 1 user had 10 arguments and another user had 2 arguments (both side=true) I'd want the count to be 2, not 12.

    Read the article

  • Architecture of finding movable geotagged objects

    - by itsme
    I currently have a Postgres DB filled with approx. 300.000 data-sets of moving vehicles all over the world. My very frequently repeated query is: Give me all vehicles in a 5/10/20mile radius. Currently I spend around 600 to 1200 ms in the DB to prepare the set of located vehicle-objects. I am looking to vastly improve this time by ideally one or two orders of magnitude if possible. I am working in a Ruby on Rails 3.0beta environment if this is relevant. Any ideas how to architect the whole system to accelerate this query? Any NoSQL database able to deliver this kind of geolocation performance? I know of MongoDB working on an extension to facilitate this scenario but haven't tried it yet. Any intelligent use of Redis to achieve this? One problem with SQL-DBs here seems to be that I can't possibly use indexes because my vehicles are mostly moving around, meaning I had to constantly created DB indexes which, by itself, is probably more expensive than just doing the searching without index. Looking forward to your thoughs, Thanks!

    Read the article

  • Python finding repeating sequence in list of integers?

    - by tijko
    I have a list of lists and each list has a repeating sequence. I'm trying to count the length of repeated sequence of integers in the list: list_a = [111,0,3,1,111,0,3,1,111,0,3,1] list_b = [67,4,67,4,67,4,67,4,2,9,0] list_c = [1,2,3,4,5,6,7,8,9,0,1,2,3,4,5,6,7,8,9,0,23,18,10] Which would return: list_a count = 4 (for [111,0,3,1]) list_b count = 2 (for [67,4]) list_c count = 10 (for [1,2,3,4,5,6,7,8,9,0]) Any advice or tips would be welcome. I'm trying to work it out with re.compile right now but, its not quite right.

    Read the article

  • finding middle element of an array

    - by senthil
    Hi all, I came cross a question in my interview. Question: Array of integers will be given as the input and you should find out the middle element when sorted , but without sorting. For Example. Input: 1,3,5,4,2 Output: 3 When you sort the given input array, it will be 1,2,3,4,5 where middle element is 3. You should find this in one pass without sorting. Any solutions for this?

    Read the article

  • Finding number of different paths

    - by peiska
    I have a game that one player X wants to pass a ball to player Y, but he can be playing with more than one player and the others players can pass the ball to Y. I want to know how many different paths can the ball take from X to Y? for example if he is playing with 3 players there are 5 different paths, 4 players 16 paths, if he is playing with 20 players there are 330665665962404000 paths, and 40 players 55447192200369381342665835466328897344361743780 that the ball can take. the number max. of players that he can play with is 500. I was thinking in using Catalan Numbers? do you think is a correct approach to solve this? Can you give me some tips.

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Help Needed Finding a Programmer

    - by ssean
    Good Morning, I am trying to find a programmer to code a piece of custom software for my business. I plan on using this software to manage my business, and possibly sell it to other companies (in the same industry) at a later date. I've never hired a programmer before, so I'm not sure what to expect or where to begin. I know exactly what features I need, and how I want it laid out, I just need someone who can take my ideas and make it happen. This software will be used to manage customer information, and keep track of orders. What I think I need: * SQL Server or similar database that will be located at our office. * Desktop Application, that connects via LAN to the database server (cannot be browser based) * Multiple User Support (Simultaneous users accesing the system) * Needs to be scalable (currently we have 5 employees, but who knows what the future will bring) * Multi-Platform Support (Windows, Linux) I posted a job offer through elance, which seems to raise more questions than answers. How do I decide what language(s) will work best for my situation? (I have received offers for C#, Eclipse, .NET, Powerbuilder, etc. - I want to make sure that I choose the best one now, so I don't run into problems later) Does the programmer hold any rights to the software? (I plan to offer the software for sale at a later date) Any help or insight would be appreciated, and I'd be happy to clarify anything if it helps. Thanks in advance!

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >