Search Results

Search found 4934 results on 198 pages for 'finding'.

Page 34/198 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Java - Optimize finding a string in a list

    - by Mark
    I have an ArrayList of objects where each object contains a string 'word' and a date. I need to check to see if the date has passed for a list of 500 words. The ArrayList could contain up to a million words and dates. The dates I store as integers, so the problem I have is attempting to find the word I am looking for in the ArrayList. Is there a way to make this faster? In python I have a dict and mWords['foo'] is a simple lookup without looping through the whole 1 million items in the mWords array. Is there something like this in java? for (int i = 0; i < mWords.size(); i++) { if ( word == mWords.get(i).word ) { mLastFindIndex = i; return mWords.get(i); } }

    Read the article

  • Algorithms for finding the intersections of intervals

    - by tomwu
    I am wondering how I can find the number of intervals that intersect with the ones before it. for the intervals [2, 4], [1, 6], [5, 6], [0, 4], the output should be 2. from [2,4] [5,6] and [5,6] [0,4]. So now we have 1 set of intervals with size n all containing a point a, then we add another set of intervals size n as well, and all of the intervals are to the right of a. Can you do this in O(nlgn) and O(nlg^2n)?

    Read the article

  • Finding existing tickets before opening new ones on trac

    - by Jens Jansson
    We're using Trac as the task management tool at the project we work in. However, Trac search is maybe not the most intuitive search out there, and we end up having multiple duplicates as the reporters can't effectively find if there already is a reported ticket of the question he or she found. Stack Overflow's "Related Questions" concept is great and works magnificently! I was wondering if someone has heard of some similar plugin to Trac, or if you have solved this problem some other way.

    Read the article

  • Adapting pseudocode to java implementation for finding the longest word in a trie

    - by user1766888
    Referring to this question I asked: How to find the longest word in a trie? I'm having trouble implementing the pseudocode given in the answer. findLongest(trie): //first do a BFS and find the "last node" queue <- [] queue.add(trie.root) last <- nil map <- empty map while (not queue.empty()): curr <- queue.pop() for each son of curr: queue.add(son) map.put(son,curr) //marking curr as the parent of son last <- curr //in here, last indicate the leaf of the longest word //Now, go up the trie and find the actual path/string curr <- last str = "" while (curr != nil): str = curr + str //we go from end to start curr = map.get(curr) return str This is what I have for my method public static String longestWord (DTN d) { Queue<DTN> holding = new ArrayQueue<DTN>(); holding.add(d); DTN last = null; Map<DTN,DTN> test = new ArrayMap<DTN,DTN>(); DTN curr; while (!holding.isEmpty()) { curr = holding.remove(); for (Map.Entry<String, DTN> e : curr.children.entries()) { holding.add(curr.children.get(e)); test.put(curr.children.get(e), curr); } last = curr; } curr = last; String str = ""; while (curr != null) { str = curr + str; curr = test.get(curr); } return str; } I'm getting a NullPointerException at: for (Map.Entry<String, DTN> e : curr.children.entries()) How can I find and fix the cause of the NullPointerException of the method so that it returns the longest word in a trie?

    Read the article

  • Finding the most similar numbers across multiple lists in Python

    - by new_sysadmin
    In Python, I have 3 lists of floating-point numbers (angles), in the range 0-360, and the lists are not the same length. I need to find the triplet (with 1 number from each list) in which the numbers are the closest. (It's highly unlikely that any of the numbers will be identical, since this is real-world data.) I was thinking of using a simple lowest-standard-deviation method to measure agreement, but I'm not sure of a good way to implement this. I could loop through each list, comparing the standard deviation of every possible combination using nested for loops, and have a temporary variable save the indices of the triplet that agrees the best, but I was wondering if anyone had a better or more elegant way to do something like this. Thanks!

    Read the article

  • JavaScript Coding for Finding Shipping Total

    - by user2913279
    I am having a very hard time with this code. I have been working on it for days and cannot seem to figure it out. Please help!! Here are the specific I need for the code: Many companies normally charge a shipping and handling charge for purchases. Create a Web page that allows a user to enter a purchase price into a text box and includes a JavaScript function that calculates shipping and handling. Add functionality to the script that adds a minimum shipping and handling charge of $1.50 for any purchase that is less than or equal to $25.00. For any orders over $25.00, add 10% to the total purchase price for shipping and handling, but do not include the $1.50 minimum shipping and handling charge. The formula for calculating a percentage is price * percent / 100. For example, the formula for calculating 10% of a $50.00 purchase price is 50 * 10 / 100, which results in a shipping and handling charge of $5.00. After you determine the total cost of the order (purchase plus shipping and handling), display it in an alert dialog box. Here is the code I have: <!DOCTYPE> <head> <title>Calculate Shipping</title> <script type="text/javascript"> function parseInt() { var salesPrice = document.salesForm.Price.value; var minCharge = salesPrice + 1.50; var shipping = salesPrice * 10/100; if (salesPrice <= 25) window.alert('Your sales total including shipping is $' + minCharge); else window.alert('Your sales total including shipping is $' + salesPrice + shipping); } </script> </head> <body> <form name="salesForm"> <div > <p>Enter Your Purchase Price</p> <input type="text" name="Price" /><br /><br /> <input type="button" name="Calculate" value="Calculate Shipping" onclick="parseInt ()" /> </div> </form> </body> </html> Everything works except for the math in the alert box. It will show an incorrect total...

    Read the article

  • Need Help for Listview WPF events for finding index of rows and columns

    - by Ravi
    I have a listview in WPF and i displayed data in line by line manner,i want to just find the indexs of the rows and columns,i am new to WPF,plz give me some idea about this. <Grid Margin="3"> <Grid.RowDefinitions> <RowDefinition></RowDefinition> <RowDefinition></RowDefinition> <RowDefinition></RowDefinition> <RowDefinition></RowDefinition> <RowDefinition></RowDefinition> </Grid.RowDefinitions> <Grid.ColumnDefinitions> <ColumnDefinition Width="600"></ColumnDefinition> <ColumnDefinition></ColumnDefinition> </Grid.ColumnDefinitions> <StackPanel Orientation="Horizontal" Grid.RowSpan="1"> <Label Name="lblID1" FontWeight="Bold" Grid.Row="0">ID:</Label> <Label Name="lblID" Grid.Row="0"> <TextBlock FontFamily="verdana" FontSize="12" FontWeight="Bold" Grid.Column="0" Padding="0" Text="{Binding Path=ID}"></TextBlock> </Label> <Label Name="lblDescrip1" FontWeight="Bold" Grid.Row="1">Description:</Label> <Label Name="lblDescrip"> <TextBlock FontFamily="verdana" FontSize="12" Grid.Column="1" Text="{Binding Path=DESCRIP}"></TextBlock> </Label> </StackPanel> Fee: Type: Special:

    Read the article

  • Safe way for getting/finding a vertex in a graph with custom properties -> good programming practice

    - by Shadow
    Hi, I am writing a Graph-class using boost-graph-library. I use custom vertex and edge properties and a map to store/find the vertices/edges for a given property. I'm satisfied with how it works, so far. However, I have a small problem, where I'm not sure how to solve it "nicely". The class provides a method Vertex getVertex(Vertexproperties v_prop) and a method bool hasVertex(Vertexproperties v_prop) The question now is, would you judge this as good programming practice in C++? My opinion is, that I have first to check if something is available before I can get it. So, before getting a vertex with a desired property, one has to check if hasVertex() would return true for those properties. However, I would like to make getVertex() a bit more robust. ATM it will segfault when one would directly call getVertex() without prior checking if the graph has a corresponding vertex. A first idea was to return a NULL-pointer or a pointer that points past the last stored vertex. For the latter, I haven't found out how to do this. But even with this "robust" version, one would have to check for correctness after getting a vertex or one would also run into a SegFault when dereferencing that vertex-pointer for example. Therefore I am wondering if it is "ok" to let getVertex() SegFault if one does not check for availability beforehand?

    Read the article

  • Finding whether a point lies inside a rectangle or not

    - by avd
    The rectangle can be oriented in any way...need not be axis aligned. Now I want to find whether a point lies inside the rectangle or not. One method I could think of was to rotate the rectangle and point coordinates to make the rectangle axis aligned and then by simply testing the coordinates of point whether they lies within that of rectangle's or not. The above method requires rotation and hence floating point operations. Is there any other efficient way to do this??

    Read the article

  • Finding minimum value in a Map

    - by Sunny
    I have a map and I want to find the minimum value (right hand side) in the map. Right now here is how I did it bool compare(std::pair<std::string ,int> i, pair<std::string, int> j) { return i.second < j.second; } //////////////////////////////////////////////////// std::map<std::string, int> mymap; mymap["key1"] = 50; mymap["key2"] = 20; mymap["key3"] = 100; std::pair<char, int> min = *min_element(mymap.begin(), mymap.end(), compare); std::cout << "min " << min.second<< " " << std::endl; This works fine and I'm able to get the minimum value the problem is when I put this code inside my class it doesn't seem to work int MyClass::getMin(std::map<std::string, int> mymap) { std::pair<std::string, int> min = *min_element(mymap.begin(), mymap.end(), (*this).compare); //error probably due to this return min.second; } bool MyClass::compare( std::pair<std::string, int> i, std::pair<std::string, int> j) { return i.second < j.second; } Also is there a better solution not involving to writing the additional compare function

    Read the article

  • Finding comma separated values with a colon delimiter

    - by iconMatrix
    I am setting values in my database for tourneyID,Selected,Paid,Entered,date then separating each selection with a colon So I have a string that may look like this 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 but it also could look like this 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 and some times is looks like this 87,S,,,07-11-2013:125,S,,,06-14-2013 I am trying to find this sequence: 187,S,,,09-21-2013 I have data stored like that because I paid a programmer to code it for me. Now, as I learn, I see it was not the best solution, but it is what I have till I learn more and it is working. My problem is when using LIKE it returns both the 187 and 87 values $getTeams = mysql_query("SELECT * FROM teams WHERE (team_tourney_vector LIKE '%$tid,S,P,,$tourney_start_date%' OR team_tourney_vector LIKE '%$tid,S,,,$tourney_start_date%') AND division='$division'"); I tried this using FIND_IN_SET() but it would only return the the team id for this string 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 and does not find the team id for this string 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 SELECT * FROM teams WHERE FIND_IN_SET('187',team_tourney_vector) AND (team_tourney_vector LIKE '%S,,,09-21-2013%') Any thoughts on how to achieve this?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Finding 'free' times in MySQL

    - by James Inman
    Hi, I've got a table as follows: mysql> DESCRIBE student_lectures; +------------------+----------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+----------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | course_module_id | int(11) | YES | MUL | NULL | | | day | int(11) | YES | | NULL | | | start | datetime | YES | | NULL | | | end | datetime | YES | | NULL | | | cancelled_at | datetime | YES | | NULL | | | lecture_type_id | int(11) | YES | | NULL | | | lecture_id | int(11) | YES | | NULL | | | student_id | int(11) | YES | | NULL | | | created_at | datetime | YES | | NULL | | | updated_at | datetime | YES | | NULL | | +------------------+----------+------+-----+---------+----------------+ I'm essentially wanting to find times when a lecture doesn't happen - so to do this I'm thinking a query to group overlapping lectures together (so, for example, 9am-10am and 10am-11am lectures will be shown as a single 9am-11am lecture). There may be more than two lectures back-to-back. I've currently got this: SELECT l.start, l2.end FROM student_lectures l LEFT JOIN student_lectures l2 ON ( l2.start = l.end ) WHERE l.student_id = 1 AND l.start >= '2010-04-26 09:00:00' AND l.end <= '2010-04-30 19:00:00' AND l2.end IS NOT NULL AND l2.end != l.start GROUP BY l.start, l2.end ORDER BY l.start, l2.start Which returns: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 11:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 12:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 14:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 15:15:00 | 2010-04-26 17:15:00 | | 2010-04-26 16:15:00 | 2010-04-26 18:15:00 | ...etc... The output I'm looking for from this would be: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 18:15:00 | Any help appreciated, thanks!

    Read the article

  • Finding the unique paths through a Neo4j graph

    - by Larry
    I have a Neo4j graph with 12 inputs and 4 outputs, and am trying to write a query with the Java Traverser that will return the 14 unique paths from an input to an output node. All the queries I have tried return only a subset of the 14 paths. For example, the code below returns 4 paths, but the other 10 all stop 1 node short of the output. RelationshipType relType = RelationshipTypes.EDGE; TraversalDescription td = new TraversalDescriptionImpl() .depthFirst() .relationships(relType, Direction.OUTGOING); for (Node node : inputs){ Traverser tv = td.traverse(node); Iterator<Path> iter = tv.iterator(); // ... print path } I've tried uniqueness and depth settings as well, with no effect. The query below returns all 14 paths using the web interface, but when I use the ExecutionEngine class, I only get 13 paths back. START s=node(*) MATCH (s)-[p:EDGE*]->(c) WHERE s.type! = "INPUT" AND c.type! = "OUTPUT" RETURN p How do I get all the unique paths using the Java API?

    Read the article

  • SQL finding overlapping of times pass midnight (across 2 days)

    - by janechii
    Hi everyone, I know there are lots of these types of questions, but i didn't see one that was similar enough to my criteria. So i'd like to ask for your help please. The fields i have are just start and end which are of time types. I cannot involve any specific dates in this. If the time ranges don't go pass midnight across day, i'd just compare two tuples as such: end1 > start2 AND start1 < end2 (end points touching are not considered overlapped here.) But when I involve time range that pass (or at) midnight, this obviously doesn't work. For example, given: start | end --------+-------- 06:00PM | 01:00AM 03:00PM | 09:00PM Without involving dates, how can i achieve this, please. My assumption is, if end is less than start, then we're involving 2 days. I'm trying to do this in plain standard SQL, so just a simple and concise logic in the WHERE clause. Thank you everyone!

    Read the article

  • Finding the longest road in a Settlers of Catan game algorithmically

    - by Jay
    I'm writing a Settlers of Catan clone for a class. One of the extra credit features is automatically determining which player has the longest road. I've thought about it, and it seems like some slight variation on depth-first search could work, but I'm having trouble figuring out what to do with cycle detection, how to handle the joining of a player's two initial road networks, and a few other minutiae. How could I do this algorithmically? For those unfamiliar with the game, I'll try to describe the problem concisely and abstractly: I need to find the longest possible path in an undirected cyclic graph.

    Read the article

  • jQuery: Finding file size and adding it to the link

    - by Ricardo
    Let me start by saying that I'm not a jQuery guru by any means and I genuinely know this is over my head, that's why I've come to SO. Is there a way with jQuery to find the file size of a link on a page and then inject/add the text of the file size next to the link? Here's my problem On one of my pages, I have a link to my resume which is a PDF file and to improve usability it's proper to have the file type and file size next to the link so the users have the option to decide if they want to click on that link or not. So the link would read something like "Download my resume (PDF / 80KB)" The problem is that I'm constantly updating my resume and uploading a new PDF file which, of course, has a different file size so I'm always going back to the HTML and changing the text to reflect the new file size. Is there a way to automate this with jQuery... or plain JavaScript for that matter? I found this script and made a demo here in Codepen but it doesn't seem to work. Any help with this would be greatly appreciated.

    Read the article

  • Finding which element is clicked in the DOM

    - by Bhupi
    The question was asked to me in an interview. How to find which element is clicked by the user in the DOM using JQuery or Javascript or Both? NOTE: User can click on any element in the DOM whether it is an img, div or even span. If you can suggest some example then it will be very much helpful. Thanks in advance

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >