Search Results

Search found 4934 results on 198 pages for 'finding'.

Page 34/198 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Oracle: Finding Columns with only null values

    - by Jorge Valois
    I have a table with a lot of columns and a type column. Some columns seem to be always empty for a specific type. I want to create a view for each type and only show the relevant columns for each type. Working under the assumption that if a column has ONLY null values for a specific type, then that columns should not be part of the view, how can you find that out with queries? Is there a SELECT [columnName] FROM [table] WHERE [columnValues] ARE ALL [null] I know I COMPLETELY made it all up above... I'm just trying to get the idea across. Thanks in advance!

    Read the article

  • Algorithms for finding the intersections of intervals

    - by tomwu
    I am wondering how I can find the number of intervals that intersect with the ones before it. for the intervals [2, 4], [1, 6], [5, 6], [0, 4], the output should be 2. from [2,4] [5,6] and [5,6] [0,4]. So now we have 1 set of intervals with size n all containing a point a, then we add another set of intervals size n as well, and all of the intervals are to the right of a. Can you do this in O(nlgn) and O(nlg^2n)?

    Read the article

  • Finding if a string is an iterative substring?

    - by EsotericMe
    I have a string S. How can I find if the string follows S = nT. Examples: Function should return true if 1) S = "abab" 2) S = "abcdabcd" 3) S = "abcabcabc" 4) S = "zzxzzxzzx" But if S="abcb" returns false. I though maybe we can repeatedly call KMP on substrings of S and then decide. eg: for "abab": call on KMP on "a". it returns 2(two instances). now 2*len("a")!=len(s) call on KMP on "ab". it returns 2. now 2*len("ab")==len(s) so return true Can you suggest any better algorithms?

    Read the article

  • SQL finding overlapping of times pass midnight (across 2 days)

    - by janechii
    Hi everyone, I know there are lots of these types of questions, but i didn't see one that was similar enough to my criteria. So i'd like to ask for your help please. The fields i have are just start and end which are of time types. I cannot involve any specific dates in this. If the time ranges don't go pass midnight across day, i'd just compare two tuples as such: end1 > start2 AND start1 < end2 (end points touching are not considered overlapped here.) But when I involve time range that pass (or at) midnight, this obviously doesn't work. For example, given: start | end --------+-------- 06:00PM | 01:00AM 03:00PM | 09:00PM Without involving dates, how can i achieve this, please. My assumption is, if end is less than start, then we're involving 2 days. I'm trying to do this in plain standard SQL, so just a simple and concise logic in the WHERE clause. Thank you everyone!

    Read the article

  • Finding out inside which iframe a script is executing

    - by juandopazo
    I have a page with several iframes. One of this iframes has a page from a different domain. Inside this iframe there's another iframe with a page from the parent domain. my page from mydomain.com -> an iframe -> iframe "#foo" from another-domain.com> -> iframe "#bar" from mydomain.com -> another iframe I need to get a reference to the "#foo" node inside the main page. The security model should allow me to do that because "#bar" has the same domain as the main page. So what I'm doing is iterating through the window.top array and comparing each element to the window object which is currently the "#bar" window object. My test code looks like: for (var i = 0; i < top.length; i++) { for (var j = 0; j < top[i].length; j++) { if (top[i][j] == window) { alert("The iframe number " + i + " contains me"); } } } This works fine in all browsers, but Internet Explorer 6 throws a security error when accesing top[i][j]. Any ideas on how to solve this on IE6? Thanks!

    Read the article

  • Help Needed Finding a Programmer

    - by ssean
    Good Morning, I am trying to find a programmer to code a piece of custom software for my business. I plan on using this software to manage my business, and possibly sell it to other companies (in the same industry) at a later date. I've never hired a programmer before, so I'm not sure what to expect or where to begin. I know exactly what features I need, and how I want it laid out, I just need someone who can take my ideas and make it happen. This software will be used to manage customer information, and keep track of orders. What I think I need: * SQL Server or similar database that will be located at our office. * Desktop Application, that connects via LAN to the database server (cannot be browser based) * Multiple User Support (Simultaneous users accesing the system) * Needs to be scalable (currently we have 5 employees, but who knows what the future will bring) * Multi-Platform Support (Windows, Linux) I posted a job offer through elance, which seems to raise more questions than answers. How do I decide what language(s) will work best for my situation? (I have received offers for C#, Eclipse, .NET, Powerbuilder, etc. - I want to make sure that I choose the best one now, so I don't run into problems later) Does the programmer hold any rights to the software? (I plan to offer the software for sale at a later date) Any help or insight would be appreciated, and I'd be happy to clarify anything if it helps. Thanks in advance!

    Read the article

  • Finding a Eulerian Tour

    - by user590903
    I am trying to solve a problem on Udacity described as follows: # Find Eulerian Tour # # Write a function that takes in a graph # represented as a list of tuples # and return a list of nodes that # you would follow on an Eulerian Tour # # For example, if the input graph was # [(1, 2), (2, 3), (3, 1)] # A possible Eulerian tour would be [1, 2, 3, 1] I came up with the following solution, which, while not as elegant as some of the recursive algorithms, does seem to work within my test case. def find_eulerian_tour(graph): tour = [] start_vertex = graph[0][0] tour.append(start_vertex) while len(graph) > 0: current_vertex = tour[len(tour) - 1] for edge in graph: if current_vertex in edge: if edge[0] == current_vertex: current_vertex = edge[1] else: current_vertex = edge[0] graph.remove(edge) tour.append(current_vertex) break return tour graph = [(1, 2), (2, 3), (3, 1)] print find_eulerian_tour(graph) >> [1, 2, 3, 1] However, when submitting this, I get rejected by the grader. I am doing something wrong? I can't see any errors.

    Read the article

  • Finding comma separated values with a colon delimiter

    - by iconMatrix
    I am setting values in my database for tourneyID,Selected,Paid,Entered,date then separating each selection with a colon So I have a string that may look like this 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 but it also could look like this 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 and some times is looks like this 87,S,,,07-11-2013:125,S,,,06-14-2013 I am trying to find this sequence: 187,S,,,09-21-2013 I have data stored like that because I paid a programmer to code it for me. Now, as I learn, I see it was not the best solution, but it is what I have till I learn more and it is working. My problem is when using LIKE it returns both the 187 and 87 values $getTeams = mysql_query("SELECT * FROM teams WHERE (team_tourney_vector LIKE '%$tid,S,P,,$tourney_start_date%' OR team_tourney_vector LIKE '%$tid,S,,,$tourney_start_date%') AND division='$division'"); I tried this using FIND_IN_SET() but it would only return the the team id for this string 187,S,,,09-21-2013:141,S,,,06-21-2013:144,S,,,05-24-2013 and does not find the team id for this string 145,S,,,07-12-2013:142,S,,,05-24-2013:187,S,,,09-21-2013 SELECT * FROM teams WHERE FIND_IN_SET('187',team_tourney_vector) AND (team_tourney_vector LIKE '%S,,,09-21-2013%') Any thoughts on how to achieve this?

    Read the article

  • jQuery: Finding file size and adding it to the link

    - by Ricardo
    Let me start by saying that I'm not a jQuery guru by any means and I genuinely know this is over my head, that's why I've come to SO. Is there a way with jQuery to find the file size of a link on a page and then inject/add the text of the file size next to the link? Here's my problem On one of my pages, I have a link to my resume which is a PDF file and to improve usability it's proper to have the file type and file size next to the link so the users have the option to decide if they want to click on that link or not. So the link would read something like "Download my resume (PDF / 80KB)" The problem is that I'm constantly updating my resume and uploading a new PDF file which, of course, has a different file size so I'm always going back to the HTML and changing the text to reflect the new file size. Is there a way to automate this with jQuery... or plain JavaScript for that matter? I found this script and made a demo here in Codepen but it doesn't seem to work. Any help with this would be greatly appreciated.

    Read the article

  • Finding the unique paths through a Neo4j graph

    - by Larry
    I have a Neo4j graph with 12 inputs and 4 outputs, and am trying to write a query with the Java Traverser that will return the 14 unique paths from an input to an output node. All the queries I have tried return only a subset of the 14 paths. For example, the code below returns 4 paths, but the other 10 all stop 1 node short of the output. RelationshipType relType = RelationshipTypes.EDGE; TraversalDescription td = new TraversalDescriptionImpl() .depthFirst() .relationships(relType, Direction.OUTGOING); for (Node node : inputs){ Traverser tv = td.traverse(node); Iterator<Path> iter = tv.iterator(); // ... print path } I've tried uniqueness and depth settings as well, with no effect. The query below returns all 14 paths using the web interface, but when I use the ExecutionEngine class, I only get 13 paths back. START s=node(*) MATCH (s)-[p:EDGE*]->(c) WHERE s.type! = "INPUT" AND c.type! = "OUTPUT" RETURN p How do I get all the unique paths using the Java API?

    Read the article

  • Finding existing tickets before opening new ones on trac

    - by Jens Jansson
    We're using Trac as the task management tool at the project we work in. However, Trac search is maybe not the most intuitive search out there, and we end up having multiple duplicates as the reporters can't effectively find if there already is a reported ticket of the question he or she found. Stack Overflow's "Related Questions" concept is great and works magnificently! I was wondering if someone has heard of some similar plugin to Trac, or if you have solved this problem some other way.

    Read the article

  • Finding minimum value in a Map

    - by Sunny
    I have a map and I want to find the minimum value (right hand side) in the map. Right now here is how I did it bool compare(std::pair<std::string ,int> i, pair<std::string, int> j) { return i.second < j.second; } //////////////////////////////////////////////////// std::map<std::string, int> mymap; mymap["key1"] = 50; mymap["key2"] = 20; mymap["key3"] = 100; std::pair<char, int> min = *min_element(mymap.begin(), mymap.end(), compare); std::cout << "min " << min.second<< " " << std::endl; This works fine and I'm able to get the minimum value the problem is when I put this code inside my class it doesn't seem to work int MyClass::getMin(std::map<std::string, int> mymap) { std::pair<std::string, int> min = *min_element(mymap.begin(), mymap.end(), (*this).compare); //error probably due to this return min.second; } bool MyClass::compare( std::pair<std::string, int> i, std::pair<std::string, int> j) { return i.second < j.second; } Also is there a better solution not involving to writing the additional compare function

    Read the article

  • Safe way for getting/finding a vertex in a graph with custom properties -> good programming practice

    - by Shadow
    Hi, I am writing a Graph-class using boost-graph-library. I use custom vertex and edge properties and a map to store/find the vertices/edges for a given property. I'm satisfied with how it works, so far. However, I have a small problem, where I'm not sure how to solve it "nicely". The class provides a method Vertex getVertex(Vertexproperties v_prop) and a method bool hasVertex(Vertexproperties v_prop) The question now is, would you judge this as good programming practice in C++? My opinion is, that I have first to check if something is available before I can get it. So, before getting a vertex with a desired property, one has to check if hasVertex() would return true for those properties. However, I would like to make getVertex() a bit more robust. ATM it will segfault when one would directly call getVertex() without prior checking if the graph has a corresponding vertex. A first idea was to return a NULL-pointer or a pointer that points past the last stored vertex. For the latter, I haven't found out how to do this. But even with this "robust" version, one would have to check for correctness after getting a vertex or one would also run into a SegFault when dereferencing that vertex-pointer for example. Therefore I am wondering if it is "ok" to let getVertex() SegFault if one does not check for availability beforehand?

    Read the article

  • SQL Reporting Services: Finding the folder a report is in

    - by Bob
    Hi there, If I have the report name how can I programmatically get the name of the project/folder the report is in? So for example if I have a report like so http://server/Reports/Pages/Report.aspx?ItemPath=/ReportProject1/ReportName Given "ReportName" how can I figure out that the report is in the folder "ReportProject1"? So I guess is there a function where I can pass int he report name and get it's details or else query the report server for a list of its report folders and I can loop through these and check some how that the report is inside?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Finding 'free' times in MySQL

    - by James Inman
    Hi, I've got a table as follows: mysql> DESCRIBE student_lectures; +------------------+----------+------+-----+---------+----------------+ | Field | Type | Null | Key | Default | Extra | +------------------+----------+------+-----+---------+----------------+ | id | int(11) | NO | PRI | NULL | auto_increment | | course_module_id | int(11) | YES | MUL | NULL | | | day | int(11) | YES | | NULL | | | start | datetime | YES | | NULL | | | end | datetime | YES | | NULL | | | cancelled_at | datetime | YES | | NULL | | | lecture_type_id | int(11) | YES | | NULL | | | lecture_id | int(11) | YES | | NULL | | | student_id | int(11) | YES | | NULL | | | created_at | datetime | YES | | NULL | | | updated_at | datetime | YES | | NULL | | +------------------+----------+------+-----+---------+----------------+ I'm essentially wanting to find times when a lecture doesn't happen - so to do this I'm thinking a query to group overlapping lectures together (so, for example, 9am-10am and 10am-11am lectures will be shown as a single 9am-11am lecture). There may be more than two lectures back-to-back. I've currently got this: SELECT l.start, l2.end FROM student_lectures l LEFT JOIN student_lectures l2 ON ( l2.start = l.end ) WHERE l.student_id = 1 AND l.start >= '2010-04-26 09:00:00' AND l.end <= '2010-04-30 19:00:00' AND l2.end IS NOT NULL AND l2.end != l.start GROUP BY l.start, l2.end ORDER BY l.start, l2.start Which returns: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 11:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 12:00:00 | | 2010-04-26 10:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 14:15:00 | 2010-04-26 16:15:00 | | 2010-04-26 15:15:00 | 2010-04-26 17:15:00 | | 2010-04-26 16:15:00 | 2010-04-26 18:15:00 | ...etc... The output I'm looking for from this would be: +---------------------+---------------------+ | start | end | +---------------------+---------------------+ | 2010-04-26 09:00:00 | 2010-04-26 13:00:00 | | 2010-04-26 13:15:00 | 2010-04-26 18:15:00 | Any help appreciated, thanks!

    Read the article

  • Architecture of finding movable geotagged objects

    - by itsme
    I currently have a Postgres DB filled with approx. 300.000 data-sets of moving vehicles all over the world. My very frequently repeated query is: Give me all vehicles in a 5/10/20mile radius. Currently I spend around 600 to 1200 ms in the DB to prepare the set of located vehicle-objects. I am looking to vastly improve this time by ideally one or two orders of magnitude if possible. I am working in a Ruby on Rails 3.0beta environment if this is relevant. Any ideas how to architect the whole system to accelerate this query? Any NoSQL database able to deliver this kind of geolocation performance? I know of MongoDB working on an extension to facilitate this scenario but haven't tried it yet. Any intelligent use of Redis to achieve this? One problem with SQL-DBs here seems to be that I can't possibly use indexes because my vehicles are mostly moving around, meaning I had to constantly created DB indexes which, by itself, is probably more expensive than just doing the searching without index. Looking forward to your thoughs, Thanks!

    Read the article

  • Finding whether a point lies inside a rectangle or not

    - by avd
    The rectangle can be oriented in any way...need not be axis aligned. Now I want to find whether a point lies inside the rectangle or not. One method I could think of was to rotate the rectangle and point coordinates to make the rectangle axis aligned and then by simply testing the coordinates of point whether they lies within that of rectangle's or not. The above method requires rotation and hence floating point operations. Is there any other efficient way to do this??

    Read the article

  • Finding center of fingerprints.

    - by an_ant
    If we suppose that every fingerprint is made of concentric curves (ellipses or circles) - and I'm aware of the fact that not every fingerprint is - how can I find center of those concentric curves? Let's take this "ideal" fingerprint and try to find out its center ... My approaches were to try: Find the spectrum through columns/rows of the image and try to find columns/rows that maximize particular band of the spectrum. I thought that column going through the center would have most regular pattern of changing amplitudes - therefore, most recognizible harmonic. My second approach was to try to count the changes of black-and-white also through the columns and rows, and to maximize that amount among rows and columns also. While these methods work to the some extant, with some additional filtering, they fail, when fingerprint is "not ideal as this one is". Can you think of any different approach? Are there standard ways to do it?

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >