Search Results

Search found 26712 results on 1069 pages for 'light show'.

Page 34/1069 | < Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >

  • Showing and hidding a DIV

    - by user1741568
    I'm in the process of building a gallery for my public art pieces. I was wondering if there was an easy way to show and hide a div? I only want the concept text to be seen on the first page of the following link: http://www.gerardtonti.com/PresentTense/PresentTense.html Right now I have the concept in a div called "concept" set to absolute positioning. Is there also a way for the text to conform relative to the size of the window like the background image? I've also tried using an iframe and colorbox instead of a div but had no idea how to make the iframe visible only on the first slide as well. Wether using an iframe or div, I was wondering if it was possible to hide either on the frames that follow the first slide. Any help would be greatly appreciated. Thank you, Gerry

    Read the article

  • New monitor connected to HDMI adaptor doesn't show output after booting

    - by Paul
    Hello out there in the multiple monitors’ world. I am a very old newbie in your world and need help. I just purchased a new Asus VH236H monitor and hooked it up the HDMI port of an ATI Radeon HD4300 / 4500 Series display adaptor. I left the old Princeton LCD19 (TMDS) hooked up to the DVI port of the same display adaptor. Both monitors displayed the boot sequence, after I fired good old Sarastro2 (Asus P5Q Pro Turbo – Dual Core E5300 – 2.60 GHz) up. The Asus lacked one half of a second behind the Princeton until the Windows 7 Ultimate SP 1 boot up was complete. Then the Asus displayed “HDMI NO SIGNAL” and went into hibernation. The Princeton stayed lit up as before. Both monitors are displayed on the “Screen Resolution Setup Display” and I plaid around with them for a while. The only thing I accomplished was to shove the desktop icons from the Princeton to the still hibernating Asus. The “Multiple displays:” is set to “Extend these displays”, the Orientation is “Landscape” and the Resolutions are set on both to the “recommended” one. Both monitors show that they work properly in the advanced Properties display. What am I doing wrong, what am I missing? Never mind the opinions about the different resolutions of the two monitors. I always can unhook the Princeton and give it to a Goodwill Store if I do not like the setup. I just would like to make it work. Any constructive help is very much appreciated, Thank you. Thank you Anees Bakrain Only the ATI Radeon HD 4300/4500 Series adapter is displayed in the Device Manager, for that reason I have to assume that the onboard display adaptor is not active. All 40 drivers of Sarastro2 are up to date and the HDMI cable can not be the problem because both monitors displayed the boot sequence up to the moment when Windows 7 was loaded completely. This was the moment, when the Asus monitor lost its signal. Both connectors, HDMI and DVI are connected and removing the DVI connector would not solve my problem of running both monitors simultaneously. However, your suggestions shifted my seventy one year old brain into the next gear. The only question remaining is; “Why the signals to the Asus monitor stop after the sequence is complete”. The ATI Radeon HD 4300/4500 Series adapter seems to be capable of sending simultaneous HDMI and DVI signals, what is done during the boot sequence. Why do the signals change after the boot sequence is complete is the key question or der springende Punkt? Is this a correct assumption slhck?

    Read the article

  • Can't get virtual desktops to show up on RDWeb for Server 2012 R2

    - by Scott Chamberlain
    I built a test lab using the Windows Server 2012 R2 Preview. The initial test lab has the following configuration (I have replaced our name with "OurCompanyName" because I would like it if Google searches for our name did not cause people to come to this site, please do the same in any responses) Physical hardware running Windows Server 2012 R2 Preview full GUI, acting as Hyper-V host (joined to the test domain as testVwHost.testVw.OurCompanyName.com) with the following VM's running on it VM running 2012 R2 Core acting as domain controller for the forest testVw.OurCompanyName.com (testDC.testVw.OurCompanyName.com) VM running 2012 R2 Core with nothing running on it joined to the test domain as testIIS.testVw.OurCompanyName.com A clean install of Windows 7, all that was done to it was all windows updates where loaded and sysprep /generalize /oobe /shutdown /mode:vm was run on it A clean install of Windows 8, all that was done to it was all windows updates where loaded and sysprep /generalize /oobe /shutdown /mode:vm was run on it I then ran "Add Roles and Features" from testVwHost and chose the "Remote Desktop Services Installation", "Standard Deployment", "Virtual machine-based desktop deployment". I choose testIIS for the roles "RD Connection Broker" and "RD Web Access" and testVwHost as "RD Virtualization Host" The Install of the roles went fine, I then went to Remote Desktop Services in server manager and wet to setup Deployment Properties. I set the certificate for all 3 roles to our certificate signed by a CA for *.OurCompanyName.com. I then created a new Virtual Desktop Collection for Windows 7 and Windows 8 and both where created without issue. On the Windows 7 pool I added RemoteApp to launch WordPad, For windows 8 I did not add any RemoteApp programs. Everything now appears to be fine from a setup perspective however if I go to https://testIIS.testVw.OurCompanyName.com/RDWeb and log in as the use Administrator (or any orher user) I don't see the virtual desktops I created nor the RemoteApp publishing of WordPad. I tried adding a licensing server, using testDC as the server but that made no difference. What step did I miss in setting this up that is causing this not to show up on RDWeb? If any additional information is needed pleas let me know. I have tried every possible thing I can think of and I am just groping around in the dark now. The virtual machines running on testVwHost The configuration screen for RD Services The Windows 7 Pool The Windows 8 Pool This is logged in as testVw\Administrator

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Intent and OnActivityResult causing Activity to get restart Actuomatically : Require to solve this issues

    - by Parth Dani
    i am having 20 imageview and i am having 20 button for them when i click any 1 button it gives me option to select image from gallery or camera when i select any option for example galley it will take me to the gallery and let me select image from their and let me display those images on my imageview for respective button now the problem is sometimes when i do the whole above process my activity is getting restart actuomatically and all the image which were first selected get vanished from their imageview For Refernce my code is as follow: @Override public void onCreate(Bundle savedInstanceState) { super.onCreate(savedInstanceState); setContentView(R.layout.new_upload); // **************Code to get Road worthy number and VIN number value in // Shared Preference starts here************************ SharedPreferences myPrefs1 = this.getSharedPreferences("myPrefs", MODE_WORLD_READABLE); roadworthynumber = myPrefs1.getString(MY_ROADWORTHY, "Road Worthy Number"); vinnumber = myPrefs1.getString(MY_VIN, "VIN Number"); // **************Code to get Road worthy number and VIN number value in // Shared Preference ends here************************ // **************Code to create Directory AUSRWC starts // here************************ if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { cacheDir = new File(Environment.getExternalStorageDirectory() + File.separator + "AUSRWC" + File.separator); cacheDir.mkdirs(); } // **************Code to Create Directory AUSRWC ends // here************************ // *****************Assigning Button variable their Id declare in XML // file starts here***************** new_select1 = (Button) findViewById(R.id.new_select1); new_select2 = (Button) findViewById(R.id.new_select2); new_select3 = (Button) findViewById(R.id.new_select3); new_select4 = (Button) findViewById(R.id.new_select4); new_select5 = (Button) findViewById(R.id.new_select5); new_select6 = (Button) findViewById(R.id.new_select6); new_select7 = (Button) findViewById(R.id.new_select7); new_select8 = (Button) findViewById(R.id.new_select8); new_select9 = (Button) findViewById(R.id.new_select9); new_select10 = (Button) findViewById(R.id.new_select10); new_select11 = (Button) findViewById(R.id.new_select11); new_select12 = (Button) findViewById(R.id.new_select12); new_select13 = (Button) findViewById(R.id.new_select13); new_select14 = (Button) findViewById(R.id.new_select14); new_select15 = (Button) findViewById(R.id.new_select15); new_select16 = (Button) findViewById(R.id.new_select16); new_select17 = (Button) findViewById(R.id.new_select17); new_select18 = (Button) findViewById(R.id.new_select18); new_select19 = (Button) findViewById(R.id.new_select19); new_select20 = (Button) findViewById(R.id.new_select20); // *****************Assigning Button variable their Id declare in XML // file ends here***************** // *****************Assigning Image variable their Id declare in XML // file starts here***************** new_selectimage1 = (ImageView) findViewById(R.id.new_selectImage1); new_selectimage2 = (ImageView) findViewById(R.id.new_selectImage2); new_selectimage3 = (ImageView) findViewById(R.id.new_selectImage3); new_selectimage4 = (ImageView) findViewById(R.id.new_selectImage4); new_selectimage5 = (ImageView) findViewById(R.id.new_selectImage5); new_selectimage6 = (ImageView) findViewById(R.id.new_selectImage6); new_selectimage7 = (ImageView) findViewById(R.id.new_selectImage7); new_selectimage8 = (ImageView) findViewById(R.id.new_selectImage8); new_selectimage9 = (ImageView) findViewById(R.id.new_selectImage9); new_selectimage10 = (ImageView) findViewById(R.id.new_selectImage10); new_selectimage11 = (ImageView) findViewById(R.id.new_selectImage11); new_selectimage12 = (ImageView) findViewById(R.id.new_selectImage12); new_selectimage13 = (ImageView) findViewById(R.id.new_selectImage13); new_selectimage14 = (ImageView) findViewById(R.id.new_selectImage14); new_selectimage15 = (ImageView) findViewById(R.id.new_selectImage15); new_selectimage16 = (ImageView) findViewById(R.id.new_selectImage16); new_selectimage17 = (ImageView) findViewById(R.id.new_selectImage17); new_selectimage18 = (ImageView) findViewById(R.id.new_selectImage18); new_selectimage19 = (ImageView) findViewById(R.id.new_selectImage19); new_selectimage20 = (ImageView) findViewById(R.id.new_selectImage20); // ****Assigning Image variable their Id declare in XML file ends // here***************** // **************Creating Dialog to give option to user to new_select // image from gallery or from camera starts here**************** final String[] items = new String[] { "From Camera", "From Gallery" }; ArrayAdapter<String> adapter = new ArrayAdapter<String>(this, android.R.layout.select_dialog_item, items); AlertDialog.Builder builder = new AlertDialog.Builder(this); builder.setTitle("select Image"); builder.setAdapter(adapter, new DialogInterface.OnClickListener() { public void onClick(DialogInterface dialog, int item) { if (item == 0) { if (android.os.Environment.getExternalStorageState() .equals(android.os.Environment.MEDIA_MOUNTED)) { Intent intent = new Intent( MediaStore.ACTION_IMAGE_CAPTURE); File file = new File(Environment .getExternalStorageDirectory(), "/AUSRWC/picture" + ".jpg"); mImageCaptureUri = Uri.fromFile(file); try { Toast.makeText(getBaseContext(), "Click Image", Toast.LENGTH_SHORT).show(); intent.putExtra( android.provider.MediaStore.EXTRA_OUTPUT, mImageCaptureUri); intent.putExtra("return-data", true); startActivityForResult(intent, PICK_FROM_CAMERA); } catch (Exception e) { e.printStackTrace(); } } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } dialog.cancel(); } else { Intent intent = new Intent(); Toast.makeText(getBaseContext(), "Select Image", Toast.LENGTH_SHORT).show(); intent.setType("image/*"); intent.setAction(Intent.ACTION_GET_CONTENT); startActivityForResult(Intent.createChooser(intent, "Complete action using"), PICK_FROM_FILE); } } }); dialog = builder.create(); // **************Creating Dialog to give option to user to new_select // image from gallery or from camera ends here**************** final Animation animAlpha = AnimationUtils.loadAnimation(this, R.anim.anim_alpha); // Animation Code for displaying Button // Clicked. // ********************Image 1 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select1.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 1; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 1 button code ends // here******************************* // ********************Image 2 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select2.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 2; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 2 button code ends // here******************************* // ********************Image 3 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select3.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 3; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 3 button code ends // here******************************* // ********************Image 4 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select4.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 4; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 4 button code ends // here******************************* // ********************Image 5 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select5.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 5; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 5 button code ends // here******************************* // ********************Image 6 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select6.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 6; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 6 button code ends // here******************************* // ********************Image 7 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select7.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 7; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 7 button code ends // here******************************* // ********************Image 8 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select8.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 8; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 8 button code ends // here******************************* // ********************Image 9 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select9.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 9; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 9 button code ends // here******************************* // ********************Image 10 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select10.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 10; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 10 button code ends // here******************************* // ********************Image 11 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select11.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 11; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 11 button code ends // here******************************* // ********************Image 12 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select12.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 12; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 12 button code ends // here******************************* // ********************Image 13 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select13.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 13; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 13 button code ends // here******************************* // ********************Image 14 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select14.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 14; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 14 button code ends // here******************************* // ********************Image 15 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select15.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 15; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 15 button code ends // here******************************* // ********************Image 16 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select16.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 16; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 16 button code ends // here******************************* // ********************Image 17 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select17.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 17; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 17 button code ends // here******************************* // ********************Image 18 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select18.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 18; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 18 button code ends // here******************************* // ********************Image 19 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select19.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 19; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 19 button code ends // here******************************* // ********************Image 20 button code starts // here******************************* if (android.os.Environment.getExternalStorageState().equals( android.os.Environment.MEDIA_MOUNTED)) { new_select20.setOnClickListener(new OnClickListener() { @Override public void onClick(View v) { v.startAnimation(animAlpha); buttonpressed = 20; dialog.show(); } }); } else { Toast.makeText(getBaseContext(), "Please insert SdCard First", Toast.LENGTH_SHORT).show(); } // ********************Image 20 button code ends // here******************************* } // *************************When Back Button is Pressed code begins // here************************************* @Override public void onBackPressed() { Toast.makeText(new_upload.this, "Sorry You are not allowed to go back", Toast.LENGTH_SHORT).show(); return; } // *************************When Back Button is Pressed code ends // here************************************* // ***********************To get Path of new_selected Image code starts // here************************************ public String getRealPathFromURI(Uri contentUri) { String[] proj = { MediaStore.Images.Media.DATA }; Cursor cursor = managedQuery(contentUri, proj, null, null, null); if (cursor == null) return null; int column_index = cursor .getColumnIndexOrThrow(MediaStore.Images.Media.DATA); cursor.moveToFirst(); return cursor.getString(column_index); } // ***********************To get Path of new_selected Image code ends // here************************************ // **********************Picture obtained from the camera or from gallery // code starts here************** @Override protected void onActivityResult(int requestCode, int resultCode, Intent data) { //path = ""; Log.e("","requestCode="+requestCode); switch (requestCode){ case PICK_FROM_FILE: if (resultCode == Activity.RESULT_OK) { mImageCaptureUri = data.getData(); path = getRealPathFromURI(mImageCaptureUri); // from Gallery Log.e("", "Imagepath from gallery=" + path); if (path == null) path = mImageCaptureUri.getPath(); // from File Manager if (path != null) { dialog1 = ProgressDialog.show(new_upload.this, "", "Processing Please wait...", true); new ImageDisplayTask().execute(); } } break; case PICK_FROM_CAMERA: if (resultCode == Activity.RESULT_OK) { try { path = mImageCaptureUri.getPath(); Log.e("", "Imagepath from Camera =" + path); // bitmap = BitmapFactory.decodeFile(path); } catch (Exception e) { e.printStackTrace(); } if (path != null) { dialog1 = ProgressDialog.show(new_upload.this, "", "Processing Please wait...", true); //new ImageDisplayTask1().execute(); new ImageDisplayTask().execute(); } } break; default: } } // ********************Picture obtained from the camera or from gallery code // ends here********************************************* // ******************Image Display on Button when new_selected from gallery // Ashynch Code starts here******************************** class ImageDisplayTask extends AsyncTask<Void, Void, String> { @Override protected String doInBackground(Void... unsued) { Bitmap src = BitmapFactory.decodeFile(path); Bitmap dest = Bitmap.createBitmap(src.getWidth(), src.getHeight(), Bitmap.Config.ARGB_8888); //Bitmap dest = Bitmap.createScaledBitmap(src, src.getWidth(),src.getHeight(), true); SimpleDateFormat sdf = new SimpleDateFormat("dd-MM-yyyy HH:mm:ss"); String dateTime = sdf.format(Calendar.getInstance().getTime()); // reading local `` String timestamp = dateTime + " " + roadworthynumber; SimpleDateFormat sdf1 = new SimpleDateFormat("dd-MM-yyyy HH:mm:ss"); String dateTime1 = sdf1.format(Calendar.getInstance().getTime()); Imagename = dateTime1.toString().trim().replaceAll(":", "") .replaceAll("-", "").replaceAll(" ", "") + roadworthynumber + ".jpg"; Canvas cs = new Canvas(dest); Paint tPaint = new Paint(); tPaint.setTextSize(100); tPaint.setTypeface(Typeface.SERIF); tPaint.setColor(Color.RED); tPaint.setStyle(Style.FILL); cs.drawBitmap(src, 0f, 0f, null); float height = tPaint.measureText("yY"); cs.drawText(timestamp, 5f, src.getHeight() - height + 5f, tPaint); try { dest.compress(Bitmap.CompressFormat.JPEG, 70, new FileOutputStream(new File(cacheDir, Imagename))); dest.recycle(); src.recycle(); } catch (FileNotFoundException e) { // TODO Auto-generated catch block e.printStackTrace(); } return null; } @Override protected void onProgressUpdate(Void... unsued) { } @Override protected void onPostExecute(String serverresponse) { String error = "noerror"; Display currentDisplay = getWindowManager().getDefaultDisplay(); int dw = currentDisplay.getWidth(); int dh = currentDisplay.getHeight() - 100; Log.e("", "width= " + dw + " Height= " + dh); try { BitmapFactory.Options bmpFactoryOptions = new BitmapFactory.Options(); bmpFactoryOptions.inJustDecodeBounds = true; Bitmap bmp = BitmapFactory.decodeFile( Environment.getExternalStorageDirectory() + "/AUSRWC/" + Imagename, bmpFactoryOptions); int heightRatio = (int) Math.ceil(bmpFactoryOptions.outHeight / (float) dh); int widthRatio = (int) Math.ceil(bmpFactoryOptions.outWidth / (float) dw); if (heightRatio > 1 && widthRatio > 1) { if (heightRatio > widthRatio) { bmpFactoryOptions.inSampleSize = heightRatio; } else { bmpFactoryOptions.inSampleSize = widthRatio; } } bmpFactoryOptions.inJustDecodeBounds = false; bmp = BitmapFactory.decodeFile( Environment.getExternalStorageDirectory() + "/AUSRWC/" + Imagename, bmpFactoryOptions); if (buttonpressed == 1) { new_selectimage1.setImageBitmap(bmp); //Image set on ImageView } else if (buttonpressed == 2) { new_selectimage2.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 3) { new_selectimage3.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 4) { new_selectimage4.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 5) { new_selectimage5.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 6) { new_selectimage6.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 7) { new_selectimage7.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 8) { new_selectimage8.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 9) { new_selectimage9.setImageBitmap(bmp);//Image set on ImageView } else if (buttonpressed == 10) { new_selectimage10.setImageBitmap(bmp); } else if (buttonpressed == 11) { new_selectimage11.setImageBitmap(bmp); } else if (buttonpressed == 12) { new_selectimage12.setImageBitmap(bmp); } else if (buttonpressed == 13) { new_selectimage13.setImageBitmap(bmp); } else if (buttonpressed == 14) { new_selectimage14.setImageBitmap(bmp); } else if (buttonpressed == 15) { new_selectimage15.setImageBitmap(bmp); } else if (buttonpressed == 16) { new_selectimage16.setImageBitmap(bmp); } else if (buttonpressed == 17) { new_selectimage17.setImageBitmap(bmp); } else if (buttonpressed == 18) { new_selectimage18.setImageBitmap(bmp); } else if (buttonpressed == 19) { new_selectimage19.setImageBitmap(bmp); } else if (buttonpressed == 20) { new_selectimage20.setImageBitmap(bmp); } } catch (Exc

    Read the article

  • Content-disposition:inline header won't show images inline?

    - by hamstar
    I'm trying to show an image inline on a page. It is being served by a codeigniter controller. class Asset extends MY_Controller { function index( $folder, $file ) { $asset = "assets/$folder/$file"; if ( !file_exists( $asset ) ) { show_404(); return; } switch ( $folder ) { case 'css': header('Content-type: text/css'); break; case 'js': header('Content-type: text/javascript'); break; case 'images': $ext = substr( $file, strrpos($file, '.') ); switch ( $ext ) { case 'jpg': $ext = 'jpeg'; break; case 'svg': $ext = 'svg+xml'; break; } header('Content-Disposition: inline'); header('Content-type: image/'.$ext); } readfile( $asset ); } } When I load a image in Chrome of FF its pops up the download window. I know when the browser can't display the content inline it will force a download anyway, but these are PNG and GIF images which display in the browser fine otherwise. In IE it doesn't force a download but it displays the image in ASCII. If I comment out the entire image case it FF and Chrome both display the ASCII but not the image. I thought setting the content type would allow FF and Chrome to show the actual image, and also allow the location to be used as an src. The javascript and css shows fine of course. Anyone got any ideas how I can make the images show properly? Thanks :)

    Read the article

  • DelphiTwain how to show form setting

    - by Erwan
    Hi, I'm using Delphitwain (delphitwain.sourceforge.net) to add scan functionality to my app. Everything was fine, when i click scan button on my app it will show scan mode with scanner's Properties such as Page Size, Scanning Side (canon dr-3010c) and there is a Scan button and Cancel button. If i click cancel of course all the properties back to it's value before. How can I show this Scanner's Properties only to change properties without Scan, since i can do scan without showing properties Twain.LoadLibrary; Twain.LoadSourceManager; Twain.Source[CurrentSource].Loaded := TRUE; Twain.Source[CurrentSource].TransferMode := TTwainTransferMode(0); Twain.Source[CurrentSource].EnableSource(True, True); while Twain.Source[CurrentSource].Enabled do Application.ProcessMessages; Twain.UnloadLibrary; Twain.Source[CurrentSource].EnableSource(True, True); The first True for ShowUI and the second True for Modal I know it can be achieved 'cos i've seen another application that can show scanner's properties without scan, only OK and Cancel button, i've searched google all over but no luck, or maybe it just the limitation of the delphitwain component? Thanks, any suggestion appreciated

    Read the article

  • show UIAlertView when In app purchase is in progress

    - by edie
    Hi... I've added an UIAlertView that has UIActivityIndicatior as a subview on my application. This alertView only show when the purchase is in progress. I've put my alert view in this way in my StoreObserver: - (void)paymentQueue:(SKPaymentQueue *)queue updatedTransactions:(NSArray *)transactions { for (SKPaymentTransaction *transaction in transactions) { switch (transaction.transactionState) { case SKPaymentTransactionStatePurchasing: [self stillPurchasing]; // this creates an alertView and shows break; case SKPaymentTransactionStatePurchased: [self completeTransaction:transaction]; break; case SKPaymentTransactionStateFailed: [self failedTransaction:transaction]; break; case SKPaymentTransactionStateRestored: [self restoreTransaction:transaction]; break; default: break; } } } - (void) stillPurchasing { UIAlertView *alert = [[UIAlertView alloc]initWithTitle: @"In App Purchase" message: @"Processing your purchase..." delegate: nil cancelButtonTitle: nil otherButtonTitles: nil]; self.alertView = alert; [alert release]; UIActivityIndicatorView *ind = [[UIActivityIndicatorView alloc]initWithActivityIndicatorStyle: UIActivityIndicatorViewStyleWhiteLarge]; self.indicator = ind; [ind release]; [self.indicator startAnimating]; [self.alertView addSubview: self.indicator]; [self.alertView show]; } When I tap my the buy button this UIAlertView shows together with my UIActivityIndicator.. But when the transaction completes the alertView still on the top of the view and the Indicator was the only one that was removed. My question was how should I release the alertView? Or where/When should I release it. I've added these command to release my alertView and Indicator on these cases: case SKPaymentTransactionStatePurchased: case SKPaymentTransactionStateFailed: case SKPaymentTransactionStateRestored: [self.indicator stopAnimating]; [self.indicator removeFromSuperview]; [self.alertView release]; [self.indicator release]; I've only added the alertView to show that the purchasing was still in progress. Any suggestion to create any feedback to users will be thankful for me.. Thanks

    Read the article

  • Want to show file association icon and skype like progress bar c#

    - by Thomas
    whenever user drag any file onto skype chat textbox then skype show right icon for that file and one custom progress bar rounded corner. i have 4 questions 1) i am working with win application not WPF. i like to know how to develop skype like corner progressbar. i search lot google to find out skype like progressbar. so if anyone knows how to develop that kind of progress bar then please share that knowledge or give me any url from where i can download similar look progressbar. 2) when i drag any file onto my richtextbox then how could i show right icon for that file on my richtextbox. anyone can give me idea. 3) what kind of richtextbox skype use? is there any advance richtextbox library which i can use for showing picture or button etc. 4) skype shows button on chat textbox called Cancel......is it button or any image. when user click on that button then button respond accordingly. so just tell me how could place any button on my rich textbox and when i will click on that button then a event should fire at my end. any idea. here i attach a picture from where you can see the image of progressbar that i am looking for. how i want to show the progress button and file associated icon on richtextbox. the object behind attaching the image is other person can understand what is my requirement and what i want to know. please anyone give me the idea for my above 4 points. thanks

    Read the article

  • VS 2008 created shortcut doesn't show up in "Send To" menu

    - by Brettski
    I have a WinForms application built using Visual Studio 2008. I added a Setup Project to the solution to create an installation MSI file. I need the setup project to create a shortcut pointing to the application's executable in the users Send To Menu. This way when someone right clicks on a file, my application will show in the Send To list and be selected. I figured out under the file system settings of the Setup project how to add a shortcut to the Users Send To Menu. The problem is, the shortcut doesn't show in the Send To menu when you right click on a file. If I manually create a shortcut to my executable the application does show in the Send To menu. I have read many suggestions on the web to required registry entries for this to work. There is a VBS file written by Ramesh Srinivasan which inserts them. On every system I have tried this on the registry values already existed, so this is not the problem. It seems more to be with the shortcut Visual Studio (or the msi anyway) is creating.

    Read the article

  • jQuery | Click child, hides parent

    - by Jamie
    Hey, I have a list of using ul and li: <span class="important">Show/Hide</span> <div id="important" class="hidden"> <ul class="sub"> <li> Value one </li> <li class="child"> <img src="../img/close.png" /> </li> </ul> </div> $(".important").click(function () { $("#important").slideToggle("fast"); }); When the child (class="child") is clicked on, it should slide up the div (id="important"), however, there are other lists that have different IDs, I want the div to slide up when the child is clicked I did this: $(".child").click(function () { $(".child < div").slideUp("fast"); }); I have no idea how to make it work, I've done other combinations, can't seem to do it.

    Read the article

  • Dynamic paging using divs and Javascript

    - by jethomas
    I have a recordset loop that creates a table, and every 9 items it wraps a div around them so basically looks like: <div> <table>rs1, rs2 ----> rs9</table> </div> <div> <table>rs10, rs11 ----> rs18</table> </div> etc... Now, I want it so at first only the first div is showing and the others are hidden, but I have ASP loop that generates clickable links for the various divs (pages) and clicking on any given link will show that div and hide all the others. Here is the asp code I have so far: Dim i If totalPages > 1 Then Response.Write("<div id='navigation'>") For i=1 to totalPages Response.Write ("<a href='' onlick=''>"& i &"</a> | ") Next Response.Write("</div>") End If Now I just need to figure out the javascript...

    Read the article

  • Javascript when to show results

    - by Pete
    This is my Javascript below I want to show records on load and also show new records when added to the database showrecords(); displays the records in the database where abouts can I put this in my code where it will work correctly. `$(document).ready(function() { //showrecords() function showrecords() { $.ajax({ type: "POST", url: "demo_show.php", cache: false, success: function(html){ $("#display").after(html); document.getElementById('content').value=''; $("#flash").hide(); } }); } $(".comment_button").click(function() { var element = $(this); var test = $("#content").val(); var dataString = 'content='+ test; if(test=='') { alert("Please Enter Some Text"); } else { $("#flash").show(); $("#flash").fadeIn(400).html('<img src="http://tiggin.com/ajax-loader.gif" align="absmiddle">&nbsp;<span class="loading">Loading Comment...</span>'); $.ajax({ type: "POST", url: "demo_insert.php", data: dataString, cache: false, success: function(html){ // $("#display").after(html); document.getElementById('content').value=''; $("#flash").hide(); //Function for showing records //showrecords(); } }); } return false; }); }); `

    Read the article

  • jQuery toggling div visibility

    - by Eef
    I have a HTML document with the below setup: <div class="main-div" style="padding: 5px; border: 1px solid green;"> <div class="first-div" style="width: 200px; height: 200px; padding: 5px; border: 1px solid purple"> First Div <a href="#" class="control">Control</a> </div> <div class="second-div hidden" style="width: 200px; height: 200px; padding: 5px; border: 1px solid red;"> Second Div <a href="#" class="control">Control</a> </div> </div> I also have a CSS class setup called hidden with display setup to none. I have jQuery setup like so: $('.control').click(function(){ var master = $(this).parent().parent(); var first_div = $(master).find(".first-div"); var second_div = $(master).find(".second-div"); $(first_div).toggleClass("hidden") $(second_div).toggleClass("hidden") }); This setup toggles the visibility of the divs, click the control button it hides one div and show the other. However this just hides and shows each div in a flash. I am looking to add some animation to the transitioning of the divs, maybe have one slide up and the other slide down when the 'control' is clicked and vice versa but I am unable to achieve this. Could anyone help out and give some advice on how to do this? Cheer Eef

    Read the article

  • Hide/Show Text Field based on Selected value - ROR

    - by Tau
    I am new to ROR. I am trying to show a "Others" text field only if the selected value is "others". I am trying to make hide/show function to be as general as possible, since I will need it in many controller. If anyone can help enlightening me, I will really appreciate it. BTW, I am using Rails 2.1.1 ruby 1.8.7 general_info.html.erb <div> <%= f.label :location_id, "Location:" %> <%= f.collection_select(:location_id, Event.locations, :id, :name, {:prompt => true}, {:onchange => remote_function( :url => {:action => "showHideDOMOther"}, :with => "'selectedText='+this.options[this.selectedIndex].text + '&other_div='+'loc_other'")}) %> </div> <div id="loc_other" style="display:none"> <%= f.label :location_others, "Others:" %> <%= f.text_field :location_others %> </div> info_controller.rb def showHideDomOther render :update do |page| page.showHideDOM("Others", params[:selectedText], params[:other_div]) end end ... application_helper.rb def showHideDOM(targetString, selectedText, targetDiv) if selectedText.casecmp targetString page.hide targetDiv else page.show targetDiv end end Seem to get the correct parameters value, but nothing seems to happen. This is what I see from the console when I changed the value of selection to "Others". Parameters: {"action"=>"showHideDOMOther", "authenticity_token"=>"e7da7ce4631480b482e29da9c0fde4c026a7a70d", "other_div"=>"loc_other", "controller"=>"events", "selectedText"=>"Others"} NoMethodError (undefined method search_generic_view_paths?' for #<EventsController:0xa41c720>): /vendor/plugins/active_scaffold/lib/extensions/generic_view_paths.rb:40:infind_template_extension_from_handler' C:/usr/lib/Ruby/lib/ruby/gems/1.8/gems/actionpack-2.1.1/lib/action_view/template_finder.rb:138:in pick_template_extension' C:/usr/lib/Ruby/lib/ruby/gems/1.8/gems/actionpack-2.1.1/lib/action_view/template_finder.rb:115:infile_exists?' : Rendering C:/usr/lib/Ruby/lib/ruby/gems/1.8/gems/actionpack-2.1.1/lib/action_controller/templates/rescues/layout.erb (internal_server_error)

    Read the article

  • Set the amount of rows JList show (Java)

    - by Alex Cheng
    Hi all. Problem: I have a method that creates a list from the parsed ArrayList. I manage to show the list in the GUI, without scrollbar. However, I am having problem setting it to show only the size of ArrayList. Meaning, say if the size is 6, there should only be 6 rows in the shown List. Below is the code that I am using. I tried setting the visibleRowCount as below but it does not work. I tried printing out the result and it shows that the change is made. private void createSuggestionList(ArrayList<String> str) { int visibleRowCount = str.size(); System.out.println("visibleRowCount " + visibleRowCount); listForSuggestion = new JList(str.toArray()); listForSuggestion.setSelectionMode(ListSelectionModel.SINGLE_SELECTION); listForSuggestion.setSelectedIndex(0); listForSuggestion.setVisibleRowCount(visibleRowCount); System.out.println(listForSuggestion.getVisibleRowCount()); listScrollPane = new JScrollPane(listForSuggestion); MouseListener mouseListener = new MouseAdapter() { @Override public void mouseClicked(MouseEvent mouseEvent) { JList theList = (JList) mouseEvent.getSource(); if (mouseEvent.getClickCount() == 2) { int index = theList.locationToIndex(mouseEvent.getPoint()); if (index >= 0) { Object o = theList.getModel().getElementAt(index); System.out.println("Double-clicked on: " + o.toString()); } } } }; listForSuggestion.addMouseListener(mouseListener); textPane.add(listScrollPane); repaint(); } To summarize: I want the JList to show as many rows as the size of the parsed ArrayList, without a scrollbar. Any ideas? Please help. Thanks. Please let me know if a picture of the problem is needed in case I did not phrase my question correctly.

    Read the article

  • Is there anyway to show a hidden div in the last row of a html table

    - by oo
    i have an html table. here is a simplified version: <table> <tr> <td><div style="display: none;" class="remove0">Remove Me</div></td> </tr> <tr> <td><div style="display: none;" class="remove1">Remove Me</div></td> </tr> <tr> <td><div class="remove2">Remove Me</div></td> </tr> </table> i have javascript that clicks on Remove Me in the last row and it deletes the html row using: $(this).parents("tr:first").remove(); the issue is that when i remove this last row, i also want the "Remove Me" text to now show up on the second row (which is now the new last row). how would i show this div so that it would dynamically show the "remove me" from the new last row?

    Read the article

  • TV Guide script - getting current date programmes to show

    - by whitstone86
    This is part of my TV guide script: //Connect to the database mysql_connect("localhost","root","PASSWORD"); //Select DB mysql_select_db("mytvguide"); //Select only results for today and future $result = mysql_query("SELECT programme, channel, episode, airdate, expiration, setreminder FROM mediumonair where airdate >= now()"); The episodes show up, so there are no issues there. However, it's getting the database to find data that's the issue. If I add a record for a programme that airs today this should show: Medium showing on TV4 8:30pm "Episode" Set Reminder Medium showing on TV4 May 18th - 6:25pm "Episode 2" Set Reminder Medium showing on TV4 May 18th - 10:25pm "Episode 3" Set Reminder Medium showing on TV4 May 19th - 7:30pm "Episode 3" Set Reminder Medium showing on TV4 May 20th - 1:25am "Episode 3" Set Reminder Medium showing on TV4 May 20th - 6:25pm "Episode 4" Set Reminder but this shows instead: Medium showing on TV4 May 18th - 6:25pm "Episode 2" Set Reminder Medium showing on TV4 May 18th - 10:25pm "Episode 3" Set Reminder Medium showing on TV4 May 19th - 7:30pm "Episode 3" Set Reminder Medium showing on TV4 May 20th - 1:25am "Episode 3" Set Reminder Medium showing on TV4 May 20th - 6:25pm "Episode 4" Set Reminder I almost have the SQL working; just not sure what the right code is here, to avoid the second mistake showing - as the record (which indicates a show currently airing) does not seem to work at present. Please can anyone help me with this? Thanks

    Read the article

  • jQuery - Show id, based on selected items class?

    - by Jon Hadley
    I have a layout roughly as follows: <div id="foo"> <!-- a bunch of content --> </div> <div id="thumbnails"> <div class="thumb-content1"></div> <div class="thumb-content2"></div> <div class="thumb-content3"></div> </div> <div id="content-1"> <!-- some text and pictures, including large-pic1 --> </div> <div id="content-2"> <!-- some text and pictures, including large-pic2 --> </div> <div id="content-3"> <!-- some text and pictures, including large-pic3 --> </div> etc .... On page load I want to show 'foo' and 'thumbnails' and hide the three content divs. As the user clicks each thumbnail, I want to hide foo, and replace it with the matching 'content-x'. I can get my head round jQuery show, hide and replace (although, bonus points if you want to include that in your example!). But how would I extract and construct the appropriate content id, from the thumbnail class, then pass it to the show hide code?

    Read the article

  • iPad Simulator Multitouch Cursors Don't Show Up When Window is Scaled 100%

    - by Joel
    I have the iPhone SDK 3.2 installed and been working on an iPad application. However, the iPad simulator doesn't show the two gray multitouch "cursors" when I hold down the ALT/OPTION button and move the mouse around. This only happens when the simulator scale size is set to 100%. If I have it set to 50% they show up. When I have it set to be an iPhone, they show up. It's only iPad 100% size. The multitouch still works fine, I just can't see where I'm "touching". I've trying closing the simulator completely, changing from the iPhone and back again. Resizing. All sorts of stuff. Has anyone else seen this problem? Anyone have any suggestions for fixing this? I've googled and searched SOF for anyone else having this problem, but I kinda wonder if it's just me. If it makes a difference I have a Mac Mini 1.83 GHz Intel Core 2 Duo with Snow Leopard 10.6.3 installed. Thanks.

    Read the article

  • How to show and update popup in 1 thread

    - by user3713986
    I have 1 app. 2 Forms are MainFrm and PopupFrm, 1 thread to update some information to PopupFrm Now to update PopupFrm i use: In MainFrm.cs private PopupFrm mypop; MainFrm() { .... PopupFrm mypop= new PopupFrm(); mypop.Show(); } MyThread() { Process GetData();... mypop.Update(); ... } In PopupFrm.cs public void Update() { this.Invoke((MethodInvoker)delegate .... }); } Problem here that mypopup alway display when MainFrm display (Start application not when has data to update). So i change MainFrm.cs to : private PopupFrm mypop; private bool firstdisplay=false; MainFrm() { .... PopupFrm mypop= new PopupFrm(); //mypop.Show(); } MyThread() { Process GetData();... if(!firstdisplay) { mypop.Show(); firstdisplay=true; } mypop.Update(); ... } But it can not update Popup GUI. So how can i fix this issue ? Thanks all.

    Read the article

  • Problems with show hide jquery

    - by Michael
    I am trying to get show hide to work on multiple objects but I am unable to get it to work. Any help would be nice an much appreciated... I am lost on how to do this. If I only do one show hide it works fine but more than one it does not work properly. <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <title>Show Hide Sample</title> <script src="js/jquery.js" type="text/javascript"></script> <script type="text/javascript"> $(document).ready(function(){ $('#content1').hide(); $('a').click(function(){ $('#content1').show('slow'); }); $('a#close').click(function(){ $('#content1').hide('slow'); }) }); </script> <style> body{font-size:12px; font-family:"Trebuchet MS"; background: #CCF} #content1{ border:1px solid #DDDDDD; padding:10px; margin-top:5px; width:300px; } </style> </head> <body> <a href="#" id="click">Test 1</a> <div class="box"> <div id="content1"> <h1 align="center">Hide 1</h1> <P> Lorem ipsum dolor sit amet, consectetuer adipiscing elit. Nullam pulvinar, enim ac hendrerit mattis, lorem mauris vestibulum tellus, nec porttitor diam nunc tempor dui. Aenean orci. Sed tempor diam eget tortor. Maecenas quis lorem. Nullam semper. Fusce adipiscing tellus non enim volutpat malesuada. Cras urna. Vivamus massa metus, tempus et, fermentum et, aliquet accumsan, lectus. Maecenas iaculis elit eget ipsum cursus lacinia. Mauris pulvinar.</p> <p><a href="#" id="close">Close</a></p> </div> </div> <a href="#" id="click">Test 2</a> <div class="box"> <div id="content1"> <h1 align="center">Hide 2</h1> <p> Lorem ipsum dolor sit amet, consectetuer adipiscing elit. Nullam pulvinar, enim ac hendrerit mattis, lorem mauris vestibulum tellus, nec porttitor diam nunc tempor dui. Aenean orci. Sed tempor diam eget tortor. Maecenas quis lorem. Nullam semper. Fusce adipiscing tellus non enim volutpat malesuada. Cras urna. Vivamus massa metus, tempus et, fermentum et, aliquet accumsan, lectus. Maecenas iaculis elit eget ipsum cursus lacinia. Mauris pulvinar.</p> <p><a href="#" id="close">Close</a></p> </div> </div> </body> </html>

    Read the article

  • Using javascript, show a certain amount of divs based on an answer

    - by Adam
    I'm building a form that first asks if you have 'foo'. If the answer is 'Yes', a div appears and asks 'How many foo do you have'? Based on the quantity answered, I'd like to show only that many divs. Thus if the user answers 1, only the first div will show. If they answer three, the first three will show. I have it set so that if the user answers no, the question of the amount remains hidden, but if they answer yes, they would be prompted for the quantity. This is what I've got so far... <script type="text/javascript"> $(document).ready(function(){ $(window).load(function() { $('#amt_of_foo,.foo_panels').hide(); }); $('#yes_foo').click(function() { $('#amt_of_foo').show(); }); $('#no_foo').click(function() { $('.foo_panels,#amt_of_foo').hide(); }); }); </script> </head> <body> <ul> <li> <div class="panel section_panel"> <h2>Questions About Your Foo</h2> <span>Do you have foo?:</span> <input type="radio" name="foo" id="no_foo" /> No <br /> <input type="radio" name="foo" id="yes_foo" /> Yes:</span></span> <span id="amt_of_foo"> <span>How many foo do you have?:</span> <span><input id="qty_of_foo" type="text" size="5" /> </span> </span> </div> </li> <!--answered yes to foo, and entered amount--> <div class="foo_panels"> <li> <li> <div class="panel foo_1"> <h1>First foo's information</h1> <span>Foo name:&nbsp;<input type="text" size="20" /></span> </div> </li> <li> <div class="panel foo_2"> <h1>Second foo's information</h1> <span>Foo name:&nbsp;<input type="text" size="20" /></span> </div> </li> <li> <div class="panel foo_3"> <h1>Third foo's information</h1> <span>Foo name:&nbsp;<input type="text" size="20" /></span> </div> </li> </div> <!--answered no to foo--> <li> <div class="panel"> <h1>Next Question, if no foo</h1> </div> </li> </ul> The ul is used for a jQuery 'slider' plugin. the 'panel' class is used for global css.

    Read the article

  • ruby on rails photo upload problem

    - by dodo00700
    Hallo rails version 2.3.5 I'm learning rails and I run into a problem. I'm doing some nesting forms from the railscasts tutorials. I changed the text area into a data field to upload photos and everything is working. Now i have to display the uploaded pictures and i simply can't do it. I Tried everything I could find on the net but nothing worked. PROBLEM I have the Article controller which handles the article CRUD. inside the article new form there is nested a form for uploading images. article controller def code_image @image_data = Photo.find(params[:id]) @image = @image_data.binary_data send_data(@image, :type => @image_data.content_type, :filename => @image_data.filename, :disposition => 'inline') end photo model def image_file=(input_data) self.filename = input_data.original_filename self.content_type = input_data.content_type.chomp self.binary_data = input_data.read end articles/show.html.erb <%=h @article.title %> <%=h @article.body %> <% for photos in @article.photos %> <%= image_tag(url_for({:action => 'code_image', :id => @article.photos.id})) -%> <% end %> articles/_formnew.html.erb <% form_for (:article, @article, :url => {:action=>'create'}, :html=> {:multipart=>true}) do |f| %> <%= f.error_messages % <%= f.label :title %><br /> <%= f.text_field :title %><br /><br /> <%= f.label :body %><br /> <%= f.text_area :body, :style => 'width: 600px;' %><br /><br /> <% f.fields_for :photos do |builder|%> <%= builder.label :content, "Photo"%><br /> <%= builder.file_field :image_file %><br /> <% end %> <br /> <%= f.submit "Create" %> <% end % Thanks

    Read the article

  • Why does my domain not show up in Google anymore?

    - by Earlz
    So I have had a website since about 2006. It's http://earlz.biz.tm . Recently I've noticed that no results will show up for it in google. I do have a secondary domain(that I plan on getting rid of) pointing to it but I don't understand why google would suddenly not show my site. I believe it was showing up a few months ago and my website is hardly ever down, like one or two days I believe has been the most it's been down in a row in this time period. Is there something wrong with my DNS or other configuration that would make google not index me? For reference I've tried: earlz.biz.tm site:earlz.biz.tm and the heading from my site "Earlz.biz.tm -- The reasoning is bacon" A few show up with the therusticstone.com domain(the one I plan to point somewhere else) but none show up directly linking to earlz.biz.tm.

    Read the article

< Previous Page | 30 31 32 33 34 35 36 37 38 39 40 41  | Next Page >