Search Results

Search found 16107 results on 645 pages for 'fulltext search'.

Page 343/645 | < Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Which cms or script for social network wiki?

    - by Jason
    Hi, I am building a social network. I need a cms that will allow users to contribute content. Each content item will need to have a google map, list of features, ratings, comments, etc. And the content must be editable by other users with revision control. Also, each user should have a profile with their bookmarked content items, contributed items, comments, etc. It's very important that I can create a template for the wiki/content entries so that each item looks uniform. (and as a kick in the teeth, I would like to be able to search for wiki items using a radial search or map) Joomla was my first choice, as I've used it for many projects, but the wiki functionality is not there. I was also setting up a grou.ps site, but the wiki is so-so - not feature rich and it really doesn't have the option I need. Additionally, I know someone out there will mention Drupal. I may consider it if I can see it put to use without and overabundance of custom programming (I don't mind initial coding, but drupal requires constant coding & recoding - with this site, I dont' have that time commitment) I thought about using mediawiki with buddypress, but i'm not sure if that's the way to go. Thoughts?

    Read the article

  • Statistical analysis on large data set to be published on the web

    - by dassouki
    I have a non-computer related data logger, that collects data from the field. This data is stored as text files, and I manually lump the files together and organize them. The current format is through a csv file per year per logger. Each file is around 4,000,000 lines x 7 loggers x 5 years = a lot of data. some of the data is organized as bins item_type, item_class, item_dimension_class, and other data is more unique, such as item_weight, item_color, date_collected, and so on ... Currently, I do statistical analysis on the data using a python/numpy/matplotlib program I wrote. It works fine, but the problem is, I'm the only one who can use it, since it and the data live on my computer. I'd like to publish the data on the web using a postgres db; however, I need to find or implement a statistical tool that'll take a large postgres table, and return statistical results within an adequate time frame. I'm not familiar with python for the web; however, I'm proficient with PHP on the web side, and python on the offline side. users should be allowed to create their own histograms, data analysis. For example, a user can search for all items that are blue shipped between week x and week y, while another user can search for sort the weight distribution of all items by hour for all year long. I was thinking of creating and indexing my own statistical tools, or automate the process somehow to emulate most queries. This seemed inefficient. I'm looking forward to hearing your ideas Thanks

    Read the article

  • Hosting an Access DB

    - by Mitciv
    Hey, So I'm inexperienced in hosting DB's and I've always had the luxury of someone else getting the db setup. I was going to help a friend out with getting a webpage setup, I've got experience in Asp.Net MVC so I'm going with that. They want to setup a search page to query a db and display the results. My question I have is in getting the DB setup and hosted. They currently just have the Access DB on a local computer. There is basically only one table that would need to be queried for the search. What is the best approach to getting this table/db accessible? They would like to keep the main copy of the db on the local machine, so copying the entire db over to the hosted site would be time consuming, could the lone table needed be solely copied to the host? Should I try to convince them to make changes on the hosted db and just make copies of that for their local machines? Any suggestions are welcome, Again I'm a total noob when it comes to hosting databases. Thanks

    Read the article

  • Escape characters in MySQL, in Ruby

    - by Swards
    I have a couple escaped characters in user-entered fields that I can't figure out. I know they are the "smart" single and double quotes, but I don't know how to search for them in mysql. The characters in ruby, when output from Ruby look like \222, \223, \224 etc irb> "\222".length => 1 So - do you know how to search for these in mysql? When I look in mysql, they look like '?'. I'd like to find all records that have this character in the text field. I tried mysql> select id from table where field LIKE '%\222%' but that did not work. Some more information - after doing a mysqldump, this is how one of the characters is represented - '\\xE2\\x80\\x99'. It's the smart single quote. Ultimately, I'm building an RTF file and the characters are coming out completely wrong, so I'm trying to replace them with 'dumb' quotes for now. I was able to do a gsub(/\222\, "'"). Thanks.

    Read the article

  • object not getting released in iphone

    - by mohsinpathan
    NSString *strSql = @"select tblrecentsearch_id,xmlrequest,company,postcode,city,kilometer,date from tblrecentsearch"; returnValue = sqlite3_prepare_v2(database, [strSql UTF8String], -1, &selectStatement, NULL); if(returnValue == SQLITE_OK) { arrRecentSearch=[[NSMutableArray alloc] init]; while(sqlite3_step(selectStatement)==SQLITE_ROW) { Search *ObjSearch = [[Search alloc]init]; ObjSearch.intRecentSearchId = sqlite3_column_int(selectStatement, 0); ObjSearch.xmlRequest = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 1) encoding:NSUTF8StringEncoding]; ObjSearch.strCompnay=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 2) encoding:NSUTF8StringEncoding]; ObjSearch.strPostCode=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 3) encoding:NSUTF8StringEncoding]; ObjSearch.strPlace = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 4) encoding:NSUTF8StringEncoding]; ObjSearch.strKilometer = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 5) encoding:NSUTF8StringEncoding]; ObjSearch.strDate = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 6) encoding:NSUTF8StringEncoding]; [arrRecentSearch addObject:ObjSearch]; [ObjSearch release]; } } sqlite3_finalize(selectStatement); I want release arrRecentSearch but it will return from function . How can i realese this array. Please help me.I am fetching data from databse.

    Read the article

  • object not getting released in iphone

    - by Jaimin
    i m writing this code in my code to store the data in database.. Search *objSearchDetail = [[Search alloc] init]; objSearchDetail = [xmlResponseDetail objectAtIndex:i]; sql = "INSERT INTO tblsearchdetail(tblrecentsearch_id,name,address,email,url,street,postcode,city,telephone,mobile) VALUES(?,?,?,?,?,?,?,?,?,?)"; returnValue = sqlite3_prepare_v2(database, sql, -1, &insertStatement, NULL); if(returnValue == SQLITE_OK){ sqlite3_bind_int(insertStatement, 1, intLastRecentSearchId); sqlite3_bind_text(insertStatement, 2, [objSearchDetail.strName UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 3, [objSearchDetail.strAddress UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 4, [objSearchDetail.strEmail UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 5, [objSearchDetail.strUrl UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 6, [objSearchDetail.strStreet UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 7, [objSearchDetail.strPostCode UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 8, [objSearchDetail.strPlace UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 9, [objSearchDetail.strTelephone UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 10, [objSearchDetail.strMobile UTF8String], -1,SQLITE_TRANSIENT); if(sqlite3_step(insertStatement)==SQLITE_DONE) { //Data; } } NSLog(@"count %d",[objSearchDetail retainCount]); [objSearchDetail release]; now the nslog shows refrence count as 2 so even if i release the refrence count will still be one and the object will not be destroyed.. plz help me....

    Read the article

  • Help with a loop to return UIImage from possible matches

    - by Canada Dev
    I am parsing a list of locations and would like to return a UIImage with a flag based on these locations. I have a string with the location. This can be many different locations and I would like to search this string for possible matches in an NSArray, and when there's a match, it should find the appropriate filename in an NSDictionary. Here's an example of the NSDictionary and NSArray: NSDictionary *dict = [NSDictionary dictionaryWithObjectsAndKeys: @"franceFlag", @"france", @"greeceFlag", @"greece", @"spainFlag", @"spain", @"norwayFlag", @"norway", nil]; NSArray *array = [NSArray arrayWithObjects: @"france" @"greece" @"spain" @"portugal" @"ireland" @"norway", nil]; Obviously I'll have a lot more countries and flags in both. Here's what I have got to so far: -(UIImage *)flagFromOrigin:(NSString *)locationString { NSRange range; for (NSString *arrayString in countryArray) { range = [locationString rangeOfString:arrayString]; if (range.location != NSNotFound) { return [UIImage imageWithContentsOfFile:[[NSBundle mainBundle] pathForResource:[dictionary objectForKey: arrayString] ofType:@"png"]]; } } return nil; } Now, the above doesn't actually work. I am missing something (and perhaps not even doing it right in the first place) The issue is, the locationString could have several locations in the same country, described something like this "Barcelona, Spain", "Madrid, Spain", "North Spain", etc., but I just want to retrieve "Spain" in this case. (Also, notice caps for each country). Basically, I want to search the locationString I pass into the method for a possible match with one of the countries listed in the NSArray. If/When one is found, it should continue into the NSDictionary and grab the appropriate flag based on the correct matched string from the array. I believe the best way would then to take the string from the array, as this would be a stripped-out version of the location. Any help to point me in the right direction for the last bit is greatly appreciated.

    Read the article

  • Using Linq-To-SQL I'm getting some weird behavior doing text searches with the .Contains method. Loo

    - by Nate Bross
    I have a table, where I need to do a case insensitive search on a text field. If I run this query in LinqPad directly on my database, it works as expected Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase")) // also, adding in the same constraints I'm using in my repository works in LinqPad // Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase") && tbl.IsActive == true) In my application, I've got a repository which exposes IQueryable objects which does some initial filtering and it looks like this var dc = new MyDataContext(); public IQueryable<Table> GetAllTables() { var ret = dc.Tables.Where(t => t.IsActive == true); return ret; } In the controller (its an MVC app) I use code like this in an attempt to mimic the LinqPad query: var rpo = new RepositoryOfTable(); var tables = rpo.GetAllTables(); // for some reason, this does a CASE SENSITIVE search which is NOT what I want. tables = tables.Where(tbl => tbl.Title.Contains("StringWithAnyCase"); return View(tables); The column is defiend as an nvarchar(50) in SQL Server 2008. Any help or guidance is greatly appreciated!

    Read the article

  • Indexing table with duplicates MySQL/MSSQL with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In MSSQL you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • Best way of showing more results with javascript/css

    - by Ricardo Neves
    I'm developing a website and i'm having troubles showing the search results to the user the way I want. Basically, after the user search, the page makes a couple of ajax requests and as soon as a response arrive it appends the info to a specific element on my page. Each results is shown as a line... The problem is that in most case there are going to be more than 1000 results and this would make the page have a large scroll. My idea was to show only the first 15 results and when the user clicks "show more" the element would expand and show the next 15 results and so on... This would be easier to do if the website wasn't responsive, but because it is I can't find the proper way of implementing what I want without lowering the website perfomance. I have "2 ideas": The first is by using something like #element .div:nth-child(-n+15) on my css and figure a way of changing the "15" to how much results I want to show... I don't know if this can be done. Is it possible to call css rules with parameters? Maybe with less css? The second option is probably a bad option if i don't want to lower the website performance. Using javascript I would check if there is a specific css class(like .show-15 .show30 .show45) and add that class to my element and if it don't exist, create it somehow.. Any help would be appreciated.

    Read the article

  • Error: '$viewMap[...]' is null or not an object

    - by DK
    My jQuery/Javascript knowledge is limited I'm afraid. I have a "how did you hear about us" dropdown on a form. However, I get the following Javascript error on change: Error: '$viewMap[...]' is null or not an object My dropdown looks like this: <select onchange="setSourceID(this.value)" name="sourceID" id="sourceID" class="required"> <option value="" selected="selected">Please choose&#8230;</option> <option value="National Paper">National Paper</option> <option value="Magazine">Magazine</option> <option value="Regional Paper">Regional Paper</option> <option value="9682">Internet Search</option> <option value="9684">Recommendation</option> <option value="9683">Other</option> </select> <!-- some additional dropdowns below that appear based on what's selected above --> <select onchange="setSourceID(this.value)" name="referrerName[]" id="referrer1" class="smartField"> <option value="" selected="selected">Please choose&#8230;</option> <option value="The Times">The Times</option> etc... </select> and so on... My Javascript looks like this: $(document).ready(function() { $('.smartField').hide(); $.viewMap = { '' : $([]), 'National Paper' : $('#referrer1'), 'Magazine' : $('#referrer2'), 'Regional Paper' : $('#referrer3') //'Internet Search' : $('#referrer4'), //'Recommendation' : $('#referrer5'), //'Other' : $('#referrer6') }; $("#sourceID").bind(($.browser.msie ? "click" : "change"), function () { $.each($.viewMap, function() { this.hide(); }); // hide all $.viewMap[$(this).val()].show(); // show current }); }); Does anybody have any idea where I'm going wrong? Any help very much appreciated.

    Read the article

  • lists searches in SYB or uniplate haskell

    - by Chris
    I have been using uniplate and SYB and I am trying to transform a list For instance type Tree = [DataA] data DataA = DataA1 [DataB] | DataA2 String | DataA3 String [DataA] deriving Show data DataB = DataB1 [DataA] | DataB2 String | DataB3 String [DataB] deriving Show For instance, I would like to traverse my tree and append a value to all [DataB] So my first thought was to do this: changeDataB:: Tree -> Tree changeDataB = everywhere(mkT changeDataB') chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> or if I was using uniplate changeDataB:: Tree -> Tree changeDataB = transformBi changeDataB' chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> The problem is that I only want to search on the full list. Doing either of these searches will cause a search on the full list and all of the sub-lists (including the empty list) The other problem is that a value in [DataB] may generate a [DataB], so I don't know if this is the same kind of solution as not searching chars in a string. I could pattern match on DataA1 and DataB3, but in my real application there are a bunch of [DataB]. Pattern matching on the parents would be extensive. The other thought that I had was to create a data DataBs = [DataB] and use that to transform on. That seems kind of lame, there must be a better solution.

    Read the article

  • Test for `point` within an attachment in `mail-mode`

    - by lawlist
    I'm looking for a better test to determine when point is within a hidden attachment in mail-mode (which is used by wl-draft-mode). The attachments are mostly hidden and look like this: --[[application/xls Content-Disposition: attachment; filename="hello-world.xls"][base64]] The test of invisible-p yields a result of nil. I am current using the following test, but it seems rather poor: (save-excursion (goto-char (point-max)) (goto-char (previous-char-property-change (point))) (goto-char (previous-char-property-change (point))) (re-search-backward "]]" (point-at-bol) t))) Any suggestions would be greatly appreciated. Here is the full snippet: (goto-char (point-max)) (cond ((= (save-excursion (abs (skip-chars-backward "\n\t"))) 0) (insert "\n\n")) ((and (= (save-excursion (abs (skip-chars-backward "\n\t"))) 1) (not (save-excursion (goto-char (previous-char-property-change (point))) (goto-char (previous-char-property-change (point))) (re-search-backward "]]" (point-at-bol) t)))) (insert "\n"))) GOAL:  If there are no attachments and no new lines at the end of the buffer, then insert \n\n and then insert the attachment thereafter. If there is just one new line at the end of the buffer, then insert \n and then insert the attachment thereafter. If there is an attachment at the end of the buffer, then do not insert any new lines.

    Read the article

  • Computer Science taxonomy

    - by Bakhtiyor
    I am developing web application where users have collection of tags. I need to create a suggestion list for users based on the similarity of their tags. For example, when a user logs in to the system, system gets his tags and search these tags in the DB of users and showing users who have similar tags. For instance if User 1 has following tags [Linux, Apache, MySQL, PHP] and User 2 has [Windows, IIS, PHP, MySQL] it says that User 2 matchs User 1 with a weight of 50%, because he has 2 similar tags(PHP and MySQL). But imagine the situation where User 1 has [ASP, IIS, MS Access] and User 2 has [PHP, Apache, MySQL]. In this situation my system doesn't suggest User 2 as a "friend" to User 1 or vice versa. But we now that these two users has similarity on the the field of work, both works on Web Technology (or Web Programming, etc). So, that is why I need kind of taxonomy of computer science (right now, but probably I would need taxonomy of other fields also, like medicine, physics, mathematics, etc.) where these concepts are categorized and so that when I search for similarity of ASP and PHP, for example, it can say that they have similarity and belong into one group(or category). I hope I described my problem clearly, but if something wrong explained would be happy for your corrections. Thanks

    Read the article

  • Speed/expensive of SQLite query vs. List.contains() for "in-set" icon on list rows

    - by kpdvx
    An application I'm developing requires that the app main a local list of things, let's say books, in a local "library." Users can access their local library of books and search for books using a remote web service. The app will be aware of other users of the app through this web service, and users can browse other users' lists of books in their library. Each book is identified by a unique bookId (represented as an int). When viewing books returned through a search result or when viewing another user's book library, the individual list row cells need to visually represent if the book is in the user's local library or not. A user can have at most 5,000 books in the library, stored in SQLite on the device (and synchronized with the remote web service). My question is, to determine if the book shown in the list row is in the user's library, would it be better to directly ask SQLite (via SELECT COUNT(*)...) or to maintain, in-memory, a List or int[] array of some sort containing the unique bookIds. So, on each row display do I query SQLite or check if the List or int[] array contains the unique bookId? Because the user can have at most 5,000 books, each bookId occupies 4 bytes so at most this would use ~ 20kB. In thinking about this, and in typing this out, it seems obvious to me that it would be far better for performance if I maintained a list or int[] array of in-library bookIds vs. querying SQLite (the only caveat to maintaining an int[] array is that if books are added or removed I'll need to grow or shrink the array by hand, so with this option I'll most likely use an ArrayList or Vector, though I'm not sure of the additional memory overhead of using Integer objects as opposed to primitives). Opinions, thoughts, suggestions?

    Read the article

  • Concept: Information Into Memory Location.

    - by Richeve S. Bebedor
    I am having troubles conceptualizing an algorithm to be used to transform any information or data into a specific appropriate and reasonable memory location in any data structure that I will be devising. To give you an idea, I have a JPanel object instance and I created another Container type object instance of any subtype (note this is in Java because I love this language), then I collected those instances into a data structure not specifically just for those instances but also applicable to any type of object. Now my procedure for fetching those data again is to extract the object specific features similar in category to all object in that data structure and transform it into a integer data memory location (specifically as much as possible) or any type of data that will pertain to this transformation. And I can already access that memory location without further sorting or applications of O(n) time complex algorithms (which I think preferable but I wanted to do my own way XD). The data structure is of any type either binary tree, linked list, arrays or sets (and the like XD). What is important is I don't need to have successive comparing and analysis of data just to locate information in big structures. To give you a technical idea, I have to an array DS that contains JLabel object instance with a specific name "HelloWorld". But array DS contains other types of object (in multitude). Now this JLabel object has a location in the array at index [124324] (which is if you do any type of searching algorithm just to arrive at that location is conceivably slow because added to it the data structure used was an array *note please disregard the efficiency of the data structure to be used I just want to explain to you my concept XD). Now I want to equate "HelloWorld" to 124324 by using a conceptually made function applicable to all data types. So that I can do a direct search by doing this DS[extractLocation("HelloWorld")] just to get that JLabel instance. I know this may sound crazy but I want to test my concept of non-sorting feature extracting search algorithm for any data structure wherein my main problem is how to transform information to be stored into memory location of where it was stored.

    Read the article

  • Advice on Minimizing Stored Procedure Parameters

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC Web Application that interacts with a SQL Server 2008 database via Entity Framework 4.0. On a particular page, i call a stored procedure in order to pull back some results based on selections on the UI. Now, the UI has around 20 different input selections, ranging from a textbox, dropdown list, checkboxes, etc. Each of those inputs are "grouped" into logical sections. Example: Search box : "Foo" Checkbox A1: ticked, Checkbox A2: unticked Dropdown A: option 3 selected Checkbox B1: ticked, Checkbox B2: ticked, Checkbox B3: unticked So i need to call the SPROC like this: exec SearchPage_FindResults @SearchQuery = 'Foo', @IncludeA1 = 1, @IncludeA2 = 0, @DropDownSelection = 3, @IncludeB1 = 1, @IncludeB2 = 1, @IncludeB3 = 0 The UI is not too important to this question - just wanted to give some perspective. Essentially, i'm pulling back results for a search query, filtering these results based on a bunch of (optional) selections a user can filter on. Now, My questions/queries: What's the best way to pass these parameters to the stored procedure? Are there any tricks/new ways (e.g SQL Server 2008) to do this? Special "table" parameters/arrays - can we pass through User-Defined-Types? Keep in mind im using Entity Framework 4.0 - but could always use classic ADO.NET for this if required. What about XML? What are the serialization/de-serialization costs here? Is it worth it? How about a parameter for each logical section? Comma-seperated perhaps? Just thinking out loud. This page is particulary important from a user point of view, and needs to perform really well. The stored procedure is already heavy in logic, so i want to minimize the performance implications - so keep that in mind. With that said - what is the best approach here?

    Read the article

  • How to make checkboxes have the same submit behavior as other inputs?

    - by Tim Santeford
    I have a search form where several checkboxes are checked by default. When the form submits, as a GET, the url will only contain the list of checkboxes that were left checked. http://www.example.com/page/?checkbox1=yes&checkbox2=yes It is difficult with this scenario to determine the difference between when a user first arrives at this search page and when they submit the form with all checkboxes unchecked because the querystrings look the same. To combat this problem I have started injecting a hidden field before the checkbox with the same name and a 'no' value. When the checkbox is unchecked the browser will send the hidden field's no value and when the checkbox is set then the browser is overriding the hidden field with the checkbox's 'yes' value. <input type="hidden" name="checkbox1" value="no" /> <input type="checkbox" name="checkbox1" value="yes" /> when the user submits the form with all checkboxes unchecked I get this querystring: http://www.example.com/page/?checkbox1=no&checkbox2=no This seems to work on ff, chrome, ie5.5+ so I'am I safe in using this method or is there a better way to make checkboxes submit like inputs and selects?

    Read the article

  • Clear button at uisearchbar not working at all

    - by kevin.ng
    I created a search bar programmatically and added to my view using the codes below: - (void)viewDidLoad { searchBar = [[UISearchBar alloc] initWithFrame:CGRectMake(xPositionForSearchBar, yPositionForSearchBar, widthForSearchBar, heightForSearchBar)]; UIView *bg = [[searchBar subviews] objectAtIndex:0]; searchBar.delegate = self; searchBar.placeholder = @"Search record"; for(UIView *view in searchBar.subviews){ if([view isKindOfClass:[UITextField class]]){ UITextField *tf = (UITextField *)view; tf.delegate = self; break; } } [bg removeFromSuperview]; [self.view addSubview: searchBar]; } The code is implemented with UISearchBarDelegate and UITextFieldDelegate. I have tried using - (void)searchBarCancelButtonClicked:(UISearchBar *)aSearchBar { NSLog(@"cancel clicked"); searchBar.text = @""; [aSearchBar resignFirstResponder]; } - (BOOL)textFieldShouldClear:(UITextField *)textField { NSLog(@"clear"); [self performSelector:@selector(searchBarCancelButtonClicked:) withObject:searchBar afterDelay: 0.1]; return YES; } and yet, the text inside the searchBar is not cleared at all when i click on the "clear button" - a circle with a "X" inside. The clear button works when I implemented it in IB. Wonder why? Kindly advice, many thanks.

    Read the article

  • jQuery select by two name roots and perform one of two function depending on which root was selected

    - by RetroCoder
    I'm trying to get this code to work in jQuery and I'm trying to make sure that for each iteration of each root element, its alternate root element for that same iteration doesn't contain anything. Otherwise it sets the .val("") property to an empty string. Looking for a simple solution if possible using search, find, or swap. Each matching number is on the same row level and the same iteration count. I have two input types of input text elements with two different root names like so: 1st Root is "rootA" <input type="text" name="rootA1" /> <input type="text" name="rootA2 /> <input type="text" name="rootA3" /> 2nd Root is "rootB" <input type="text" name="rootB1" /> <input type="text" name="rootB2 /> <input type="text" name="rootB3" /> On blur if any of rootA is called call function fnRootA();. On blur if any of rootB is called call function fnRootB();. Again, I'm trying to make sure that for each iteration like 1 that the alternate root doesn't contain anything, else it sets the .val("") property to an empty string of the root being blurred. My current code works for a single element but wanted to use find or search but not sure how to construct it.. $("input[name='rootA1']").blur(function(e) { fnRootA(1); // this code just removes rootA1's value val("") //if rootB1 has something in it value property // the (1) in parenthesis is the iteration number });

    Read the article

  • Loading specific files from arbitrary directories?

    - by Haydn V. Harach
    I want to load foo.txt. foo.txt might exist in the data/bar/ directory, or it might exist in the data/New Folder/ directory. There might be a different foo.txt in both of these directories, in which case I would want to either load one and ignore the other according to some order that I've sorted the directories by (perhaps manually, perhaps by date of creation), or else load them both and combine the results somehow. The latter (combining the results of both/all foo.txt files) is circumstantial and beyond the scope of this question, but something I want to be able to do in the future. I'm using SDL and boost::filesystem. I want to keep my list of dependencies as small as possible, and as cross-platform as possible. I'm guessing that my best bet would be to get a list of every directory (within the data/ folder), sort/filter this list, then when I go to load foo.txt, I search for it in each potential directory? This sounds like it would be very inefficient, if I have dozens of potential directories to search through every time. What's the best way to go about accomplishing this? Bonus: What if I want some of the directories to be archives? ie. considering both data/foo/ and data/bar.zip to both be valid, and pull foobar.txt from either one without caring.

    Read the article

  • Indexing table with duplicates MySQL/SQL Server with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In SQL Server you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • HTML form with single text field + preventing postback in Internet Explorer

    - by SudheerKovalam
    I have noticed a rather strange behaviour in IE. I have a HTML form with a single input text field and a submit button On Submit click I need to execute a client side JavaScript function that does the necessary. Now when I want to prevent the postback in the text field (on enter key press) I have added a key press JavaScript function that looks like this: <input type=text onkeypress="return OnEnterKeyPress(event)" /> function OnEnterKeyPress(event) { var keyNum = 0; if (window.event) // IE { keyNum = event.keyCode; } else if (event.which) // Netscape/Firefox/Opera { keyNum = event.which; } else return true; if (keyNum == 13) // Enter Key pressed, then start search, else do nothing. { OnButtonClick(); return false; } else return true; } Strangly this doesn't work. But if I pass the text field to the function : <input type=text onkeypress="return OnEnterKeyPress(this,event);" /> function OnEnterKeyPress(thisForm,event) { var keyNum = 0; if (window.event) // IE { keyNum = event.keyCode; } else if (event.which) // Netscape/Firefox/Opera { keyNum = event.which; } else return true; if (keyNum == 13) // Enter Key pressed, then start search, else do nothing. { OnButtonClick(); return false; } else return true; } I am able to prevent the postback. Can anyone confirm what is exactly happening here?? the HTML form has just one text box and a submit button The resultant o/p of the JavaScript function executed on submit is displayed in a HTML text area in a separate div.

    Read the article

  • Java: Using GSon incorrectly? (null pointer exception)

    - by Rosarch
    I'm trying to get the hits of a google search from a string of the query. public class Utils { public static int googleHits(String query) throws IOException { String googleAjax = "http://ajax.googleapis.com/ajax/services/search/web?v=1.0&q="; String json = stringOfUrl(googleAjax + query); JsonObject hits = new Gson().fromJson(json, JsonObject.class); return hits.get("estimatedResultCount").getAsInt(); } public static String stringOfUrl(String addr) throws IOException { ByteArrayOutputStream output = new ByteArrayOutputStream(); URL url = new URL(addr); IOUtils.copy(url.openStream(), output); return output.toString(); } public static void main(String[] args) throws URISyntaxException, IOException { System.out.println(googleHits("odp")); } } The following exception is thrown: Exception in thread "main" java.lang.NullPointerException at odp.compling.Utils.googleHits(Utils.java:48) at odp.compling.Utils.main(Utils.java:59) What am I doing incorrectly? Should I be defining an entire object for the Json return? That seems excessive, given that all I want to do is get one value. For reference: the returned JSON structure.

    Read the article

< Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >