Search Results

Search found 16107 results on 645 pages for 'fulltext search'.

Page 343/645 | < Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >

  • Advice on Minimizing Stored Procedure Parameters

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC Web Application that interacts with a SQL Server 2008 database via Entity Framework 4.0. On a particular page, i call a stored procedure in order to pull back some results based on selections on the UI. Now, the UI has around 20 different input selections, ranging from a textbox, dropdown list, checkboxes, etc. Each of those inputs are "grouped" into logical sections. Example: Search box : "Foo" Checkbox A1: ticked, Checkbox A2: unticked Dropdown A: option 3 selected Checkbox B1: ticked, Checkbox B2: ticked, Checkbox B3: unticked So i need to call the SPROC like this: exec SearchPage_FindResults @SearchQuery = 'Foo', @IncludeA1 = 1, @IncludeA2 = 0, @DropDownSelection = 3, @IncludeB1 = 1, @IncludeB2 = 1, @IncludeB3 = 0 The UI is not too important to this question - just wanted to give some perspective. Essentially, i'm pulling back results for a search query, filtering these results based on a bunch of (optional) selections a user can filter on. Now, My questions/queries: What's the best way to pass these parameters to the stored procedure? Are there any tricks/new ways (e.g SQL Server 2008) to do this? Special "table" parameters/arrays - can we pass through User-Defined-Types? Keep in mind im using Entity Framework 4.0 - but could always use classic ADO.NET for this if required. What about XML? What are the serialization/de-serialization costs here? Is it worth it? How about a parameter for each logical section? Comma-seperated perhaps? Just thinking out loud. This page is particulary important from a user point of view, and needs to perform really well. The stored procedure is already heavy in logic, so i want to minimize the performance implications - so keep that in mind. With that said - what is the best approach here?

    Read the article

  • Problem with generic list and extension method(C#3.0)

    - by Newbie
    I have an issue. I am making an extension class for a Collection and it is generic.. like public static class ListExtensions { public static ICollection<T> Search<T>(this ICollection<T> collection, string stringToSearch) { ICollection<T> t1=null; foreach (T t in collection) { Type k = t.GetType(); PropertyInfo pi = k.GetProperty("Name"); if (pi.GetValue(t,null).Equals(stringToSearch)) { t1.Add(t); } } return t1; } } But I cannot add items to t1 as it is declared null. Error: object reference not set to an instance of the object. I am calling the method like List<TestClass> listTC = new List<TestClass>(); listTC.Add(new TestClass { Name = "Ishu", Age = 21 }); listTC.Add(new TestClass { Name = "Vivek", Age = 40 }); listTC.Add(new TestClass { Name = "some one else", Age = 12 }); listTC.Search("Ishu"); And the test class is public class TestClass { public string Name { get; set; } public int Age { get; set; } } Using : (C#3.0) & Framework - 3.5 Thanks

    Read the article

  • Using Linq-To-SQL I'm getting some weird behavior doing text searches with the .Contains method. Loo

    - by Nate Bross
    I have a table, where I need to do a case insensitive search on a text field. If I run this query in LinqPad directly on my database, it works as expected Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase")) // also, adding in the same constraints I'm using in my repository works in LinqPad // Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase") && tbl.IsActive == true) In my application, I've got a repository which exposes IQueryable objects which does some initial filtering and it looks like this var dc = new MyDataContext(); public IQueryable<Table> GetAllTables() { var ret = dc.Tables.Where(t => t.IsActive == true); return ret; } In the controller (its an MVC app) I use code like this in an attempt to mimic the LinqPad query: var rpo = new RepositoryOfTable(); var tables = rpo.GetAllTables(); // for some reason, this does a CASE SENSITIVE search which is NOT what I want. tables = tables.Where(tbl => tbl.Title.Contains("StringWithAnyCase"); return View(tables); The column is defiend as an nvarchar(50) in SQL Server 2008. Any help or guidance is greatly appreciated!

    Read the article

  • $query returns results but not the ones i want: $query looks good to me :S

    - by Toni Michel Caubet
    I'll start again, Lets say My data is: Table element (id,name,....) 1, name element 1, .... 2, name element 2, .... 3, name element 3, .... Table tags (id,name,id_element, ....) 1, happy , 1 2, result, 1 3, very , 1 4, element, 2 5, another, 3 6, element, 1 7, happy, 2 So if search is 'very, happy,element,result': Results i would like 1) element with id = 2 because it has all tags 2) element with id = 1 because it has the tag 'element' and the tag 'happy' (only 2 less taggs) 3) .... (only 3 less taggs) So if search is 'happy,element': Results i would like 1) element with id = 1 because it has all tags (and no more) 2) element with id = 2 because it has the tag 'element' and the tag 'happy' (and two more tags) 3) .... and 3 more tags This is an echo to my query: (it doesn't fit al requirements i wrote, but its first test to find with matched tags) SELECT element.id as id_deseada,tagg.* FROM element,tagg WHERE tagg.id_element = element.id AND tagg.nombre IN ('happy','tagg','result') GROUP BY tagg.id_element ORDER BY element.votos This returns 10 duplicated elements... :S and doen't even have all taggs (and on database there are taggs with 'happy' results) if it helps, thats how i get the elements of a tag (by name and with only one tagg) $query = "SELECT element.id FROM element,tagg WHERE tagg.nombre = '$nombre_tagg' AND tagg.id_element = element.id AND lan = '$lan' GROUP BY tagg.id_element"; I hope it's a bit easier to understand now, excuse my english.. :) Thanks a lot for you possible aportation!

    Read the article

  • jQuery select by two name roots and perform one of two function depending on which root was selected

    - by RetroCoder
    I'm trying to get this code to work in jQuery and I'm trying to make sure that for each iteration of each root element, its alternate root element for that same iteration doesn't contain anything. Otherwise it sets the .val("") property to an empty string. Looking for a simple solution if possible using search, find, or swap. Each matching number is on the same row level and the same iteration count. I have two input types of input text elements with two different root names like so: 1st Root is "rootA" <input type="text" name="rootA1" /> <input type="text" name="rootA2 /> <input type="text" name="rootA3" /> 2nd Root is "rootB" <input type="text" name="rootB1" /> <input type="text" name="rootB2 /> <input type="text" name="rootB3" /> On blur if any of rootA is called call function fnRootA();. On blur if any of rootB is called call function fnRootB();. Again, I'm trying to make sure that for each iteration like 1 that the alternate root doesn't contain anything, else it sets the .val("") property to an empty string of the root being blurred. My current code works for a single element but wanted to use find or search but not sure how to construct it.. $("input[name='rootA1']").blur(function(e) { fnRootA(1); // this code just removes rootA1's value val("") //if rootB1 has something in it value property // the (1) in parenthesis is the iteration number });

    Read the article

  • Loading specific files from arbitrary directories?

    - by Haydn V. Harach
    I want to load foo.txt. foo.txt might exist in the data/bar/ directory, or it might exist in the data/New Folder/ directory. There might be a different foo.txt in both of these directories, in which case I would want to either load one and ignore the other according to some order that I've sorted the directories by (perhaps manually, perhaps by date of creation), or else load them both and combine the results somehow. The latter (combining the results of both/all foo.txt files) is circumstantial and beyond the scope of this question, but something I want to be able to do in the future. I'm using SDL and boost::filesystem. I want to keep my list of dependencies as small as possible, and as cross-platform as possible. I'm guessing that my best bet would be to get a list of every directory (within the data/ folder), sort/filter this list, then when I go to load foo.txt, I search for it in each potential directory? This sounds like it would be very inefficient, if I have dozens of potential directories to search through every time. What's the best way to go about accomplishing this? Bonus: What if I want some of the directories to be archives? ie. considering both data/foo/ and data/bar.zip to both be valid, and pull foobar.txt from either one without caring.

    Read the article

  • Approach for caching data from data logger

    - by filip-fku
    Greetings, I've been working on a C#.NET app that interacts with a data logger. The user can query and obtain logs for a specified time period, and view plots of the data. Typically a new data log is created every minute and stores a measurement for a few parameters. To get meaningful information out of the logger, a reasonable number of logs need to be acquired - data for at least a few days. The hardware interface is a UART to USB module on the device, which restricts transfers to a maximum of about 30 logs/second. This becomes quite slow when reading in the data acquired over a number of days/weeks. What I would like to do is improve the perceived performance for the user. I realize that with the hardware speed limitation the user will have to wait for the full download cycle at least the first time they acquire a larger set of data. My goal is to cache all data seen by the app, so that it can be obtained faster if ever requested again. The approach I have been considering is to use a light database, like SqlServerCe, that can store the data logs as they are received. I am then hoping to first search the cache prior to querying a device for logs. The cache would be updated with any logs obtained by the request that were not already cached. Finally my question - would you consider this to be a good approach? Are there any better alternatives you can think of? I've tried to search SO and Google for reinforcement of the idea, but I mostly run into discussions of web request/content caching. Thanks for any feedback!

    Read the article

  • Help with a loop to return UIImage from possible matches

    - by Canada Dev
    I am parsing a list of locations and would like to return a UIImage with a flag based on these locations. I have a string with the location. This can be many different locations and I would like to search this string for possible matches in an NSArray, and when there's a match, it should find the appropriate filename in an NSDictionary. Here's an example of the NSDictionary and NSArray: NSDictionary *dict = [NSDictionary dictionaryWithObjectsAndKeys: @"franceFlag", @"france", @"greeceFlag", @"greece", @"spainFlag", @"spain", @"norwayFlag", @"norway", nil]; NSArray *array = [NSArray arrayWithObjects: @"france" @"greece" @"spain" @"portugal" @"ireland" @"norway", nil]; Obviously I'll have a lot more countries and flags in both. Here's what I have got to so far: -(UIImage *)flagFromOrigin:(NSString *)locationString { NSRange range; for (NSString *arrayString in countryArray) { range = [locationString rangeOfString:arrayString]; if (range.location != NSNotFound) { return [UIImage imageWithContentsOfFile:[[NSBundle mainBundle] pathForResource:[dictionary objectForKey: arrayString] ofType:@"png"]]; } } return nil; } Now, the above doesn't actually work. I am missing something (and perhaps not even doing it right in the first place) The issue is, the locationString could have several locations in the same country, described something like this "Barcelona, Spain", "Madrid, Spain", "North Spain", etc., but I just want to retrieve "Spain" in this case. (Also, notice caps for each country). Basically, I want to search the locationString I pass into the method for a possible match with one of the countries listed in the NSArray. If/When one is found, it should continue into the NSDictionary and grab the appropriate flag based on the correct matched string from the array. I believe the best way would then to take the string from the array, as this would be a stripped-out version of the location. Any help to point me in the right direction for the last bit is greatly appreciated.

    Read the article

  • Which cms or script for social network wiki?

    - by Jason
    Hi, I am building a social network. I need a cms that will allow users to contribute content. Each content item will need to have a google map, list of features, ratings, comments, etc. And the content must be editable by other users with revision control. Also, each user should have a profile with their bookmarked content items, contributed items, comments, etc. It's very important that I can create a template for the wiki/content entries so that each item looks uniform. (and as a kick in the teeth, I would like to be able to search for wiki items using a radial search or map) Joomla was my first choice, as I've used it for many projects, but the wiki functionality is not there. I was also setting up a grou.ps site, but the wiki is so-so - not feature rich and it really doesn't have the option I need. Additionally, I know someone out there will mention Drupal. I may consider it if I can see it put to use without and overabundance of custom programming (I don't mind initial coding, but drupal requires constant coding & recoding - with this site, I dont' have that time commitment) I thought about using mediawiki with buddypress, but i'm not sure if that's the way to go. Thoughts?

    Read the article

  • Escape characters in MySQL, in Ruby

    - by Swards
    I have a couple escaped characters in user-entered fields that I can't figure out. I know they are the "smart" single and double quotes, but I don't know how to search for them in mysql. The characters in ruby, when output from Ruby look like \222, \223, \224 etc irb> "\222".length => 1 So - do you know how to search for these in mysql? When I look in mysql, they look like '?'. I'd like to find all records that have this character in the text field. I tried mysql> select id from table where field LIKE '%\222%' but that did not work. Some more information - after doing a mysqldump, this is how one of the characters is represented - '\\xE2\\x80\\x99'. It's the smart single quote. Ultimately, I'm building an RTF file and the characters are coming out completely wrong, so I'm trying to replace them with 'dumb' quotes for now. I was able to do a gsub(/\222\, "'"). Thanks.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Indexing table with duplicates MySQL/MSSQL with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In MSSQL you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • Hosting an Access DB

    - by Mitciv
    Hey, So I'm inexperienced in hosting DB's and I've always had the luxury of someone else getting the db setup. I was going to help a friend out with getting a webpage setup, I've got experience in Asp.Net MVC so I'm going with that. They want to setup a search page to query a db and display the results. My question I have is in getting the DB setup and hosted. They currently just have the Access DB on a local computer. There is basically only one table that would need to be queried for the search. What is the best approach to getting this table/db accessible? They would like to keep the main copy of the db on the local machine, so copying the entire db over to the hosted site would be time consuming, could the lone table needed be solely copied to the host? Should I try to convince them to make changes on the hosted db and just make copies of that for their local machines? Any suggestions are welcome, Again I'm a total noob when it comes to hosting databases. Thanks

    Read the article

  • object not getting released in iphone

    - by mohsinpathan
    NSString *strSql = @"select tblrecentsearch_id,xmlrequest,company,postcode,city,kilometer,date from tblrecentsearch"; returnValue = sqlite3_prepare_v2(database, [strSql UTF8String], -1, &selectStatement, NULL); if(returnValue == SQLITE_OK) { arrRecentSearch=[[NSMutableArray alloc] init]; while(sqlite3_step(selectStatement)==SQLITE_ROW) { Search *ObjSearch = [[Search alloc]init]; ObjSearch.intRecentSearchId = sqlite3_column_int(selectStatement, 0); ObjSearch.xmlRequest = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 1) encoding:NSUTF8StringEncoding]; ObjSearch.strCompnay=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 2) encoding:NSUTF8StringEncoding]; ObjSearch.strPostCode=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 3) encoding:NSUTF8StringEncoding]; ObjSearch.strPlace = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 4) encoding:NSUTF8StringEncoding]; ObjSearch.strKilometer = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 5) encoding:NSUTF8StringEncoding]; ObjSearch.strDate = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 6) encoding:NSUTF8StringEncoding]; [arrRecentSearch addObject:ObjSearch]; [ObjSearch release]; } } sqlite3_finalize(selectStatement); I want release arrRecentSearch but it will return from function . How can i realese this array. Please help me.I am fetching data from databse.

    Read the article

  • object not getting released in iphone

    - by Jaimin
    i m writing this code in my code to store the data in database.. Search *objSearchDetail = [[Search alloc] init]; objSearchDetail = [xmlResponseDetail objectAtIndex:i]; sql = "INSERT INTO tblsearchdetail(tblrecentsearch_id,name,address,email,url,street,postcode,city,telephone,mobile) VALUES(?,?,?,?,?,?,?,?,?,?)"; returnValue = sqlite3_prepare_v2(database, sql, -1, &insertStatement, NULL); if(returnValue == SQLITE_OK){ sqlite3_bind_int(insertStatement, 1, intLastRecentSearchId); sqlite3_bind_text(insertStatement, 2, [objSearchDetail.strName UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 3, [objSearchDetail.strAddress UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 4, [objSearchDetail.strEmail UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 5, [objSearchDetail.strUrl UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 6, [objSearchDetail.strStreet UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 7, [objSearchDetail.strPostCode UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 8, [objSearchDetail.strPlace UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 9, [objSearchDetail.strTelephone UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 10, [objSearchDetail.strMobile UTF8String], -1,SQLITE_TRANSIENT); if(sqlite3_step(insertStatement)==SQLITE_DONE) { //Data; } } NSLog(@"count %d",[objSearchDetail retainCount]); [objSearchDetail release]; now the nslog shows refrence count as 2 so even if i release the refrence count will still be one and the object will not be destroyed.. plz help me....

    Read the article

  • Indexing table with duplicates MySQL/SQL Server with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In SQL Server you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

  • How to make checkboxes have the same submit behavior as other inputs?

    - by Tim Santeford
    I have a search form where several checkboxes are checked by default. When the form submits, as a GET, the url will only contain the list of checkboxes that were left checked. http://www.example.com/page/?checkbox1=yes&checkbox2=yes It is difficult with this scenario to determine the difference between when a user first arrives at this search page and when they submit the form with all checkboxes unchecked because the querystrings look the same. To combat this problem I have started injecting a hidden field before the checkbox with the same name and a 'no' value. When the checkbox is unchecked the browser will send the hidden field's no value and when the checkbox is set then the browser is overriding the hidden field with the checkbox's 'yes' value. <input type="hidden" name="checkbox1" value="no" /> <input type="checkbox" name="checkbox1" value="yes" /> when the user submits the form with all checkboxes unchecked I get this querystring: http://www.example.com/page/?checkbox1=no&checkbox2=no This seems to work on ff, chrome, ie5.5+ so I'am I safe in using this method or is there a better way to make checkboxes submit like inputs and selects?

    Read the article

  • Error: '$viewMap[...]' is null or not an object

    - by DK
    My jQuery/Javascript knowledge is limited I'm afraid. I have a "how did you hear about us" dropdown on a form. However, I get the following Javascript error on change: Error: '$viewMap[...]' is null or not an object My dropdown looks like this: <select onchange="setSourceID(this.value)" name="sourceID" id="sourceID" class="required"> <option value="" selected="selected">Please choose&#8230;</option> <option value="National Paper">National Paper</option> <option value="Magazine">Magazine</option> <option value="Regional Paper">Regional Paper</option> <option value="9682">Internet Search</option> <option value="9684">Recommendation</option> <option value="9683">Other</option> </select> <!-- some additional dropdowns below that appear based on what's selected above --> <select onchange="setSourceID(this.value)" name="referrerName[]" id="referrer1" class="smartField"> <option value="" selected="selected">Please choose&#8230;</option> <option value="The Times">The Times</option> etc... </select> and so on... My Javascript looks like this: $(document).ready(function() { $('.smartField').hide(); $.viewMap = { '' : $([]), 'National Paper' : $('#referrer1'), 'Magazine' : $('#referrer2'), 'Regional Paper' : $('#referrer3') //'Internet Search' : $('#referrer4'), //'Recommendation' : $('#referrer5'), //'Other' : $('#referrer6') }; $("#sourceID").bind(($.browser.msie ? "click" : "change"), function () { $.each($.viewMap, function() { this.hide(); }); // hide all $.viewMap[$(this).val()].show(); // show current }); }); Does anybody have any idea where I'm going wrong? Any help very much appreciated.

    Read the article

  • case insenstive string replace that correctly works with ligatures like "ß" <=> "ss"

    - by usr
    I have build a litte asp.net form that searches for something and displays the results. I want to highlight the search string within the search results. Example: Query: "p" Results: a<b>p</b>ple, banana, <b>p</b>lum The code that I have goes like this: public static string HighlightSubstring(string text, string substring) { var index = text.IndexOf(substring, StringComparison.CurrentCultureIgnoreCase); if(index == -1) return HttpUtility.HtmlEncode(text); string p0, p1, p2; text.SplitAt(index, index + substring.Length, out p0, out p1, out p2); return HttpUtility.HtmlEncode(p0) + "<b>" + HttpUtility.HtmlEncode(p1) + "</b>" + HttpUtility.HtmlEncode(p2); } I mostly works but try it for example with HighlightSubstring("ß", "ss"). This crashes because in Germany "ß" and "ss" are considered to be equal by the IndexOf method, but they have different length! Now that would be ok if there was a way to find out how long the match in "text" is. Remember that this length can be != substring.Length. So how do I find out the length of the match that IndexOf produces in the presence of ligatures and exotic language characters (ligatures in this case)?

    Read the article

  • Computer Science taxonomy

    - by Bakhtiyor
    I am developing web application where users have collection of tags. I need to create a suggestion list for users based on the similarity of their tags. For example, when a user logs in to the system, system gets his tags and search these tags in the DB of users and showing users who have similar tags. For instance if User 1 has following tags [Linux, Apache, MySQL, PHP] and User 2 has [Windows, IIS, PHP, MySQL] it says that User 2 matchs User 1 with a weight of 50%, because he has 2 similar tags(PHP and MySQL). But imagine the situation where User 1 has [ASP, IIS, MS Access] and User 2 has [PHP, Apache, MySQL]. In this situation my system doesn't suggest User 2 as a "friend" to User 1 or vice versa. But we now that these two users has similarity on the the field of work, both works on Web Technology (or Web Programming, etc). So, that is why I need kind of taxonomy of computer science (right now, but probably I would need taxonomy of other fields also, like medicine, physics, mathematics, etc.) where these concepts are categorized and so that when I search for similarity of ASP and PHP, for example, it can say that they have similarity and belong into one group(or category). I hope I described my problem clearly, but if something wrong explained would be happy for your corrections. Thanks

    Read the article

  • lists searches in SYB or uniplate haskell

    - by Chris
    I have been using uniplate and SYB and I am trying to transform a list For instance type Tree = [DataA] data DataA = DataA1 [DataB] | DataA2 String | DataA3 String [DataA] deriving Show data DataB = DataB1 [DataA] | DataB2 String | DataB3 String [DataB] deriving Show For instance, I would like to traverse my tree and append a value to all [DataB] So my first thought was to do this: changeDataB:: Tree -> Tree changeDataB = everywhere(mkT changeDataB') chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> or if I was using uniplate changeDataB:: Tree -> Tree changeDataB = transformBi changeDataB' chanegDataB'::[DataB] -> [DataB] changeDataB' <add changes here> The problem is that I only want to search on the full list. Doing either of these searches will cause a search on the full list and all of the sub-lists (including the empty list) The other problem is that a value in [DataB] may generate a [DataB], so I don't know if this is the same kind of solution as not searching chars in a string. I could pattern match on DataA1 and DataB3, but in my real application there are a bunch of [DataB]. Pattern matching on the parents would be extensive. The other thought that I had was to create a data DataBs = [DataB] and use that to transform on. That seems kind of lame, there must be a better solution.

    Read the article

  • Speed/expensive of SQLite query vs. List.contains() for "in-set" icon on list rows

    - by kpdvx
    An application I'm developing requires that the app main a local list of things, let's say books, in a local "library." Users can access their local library of books and search for books using a remote web service. The app will be aware of other users of the app through this web service, and users can browse other users' lists of books in their library. Each book is identified by a unique bookId (represented as an int). When viewing books returned through a search result or when viewing another user's book library, the individual list row cells need to visually represent if the book is in the user's local library or not. A user can have at most 5,000 books in the library, stored in SQLite on the device (and synchronized with the remote web service). My question is, to determine if the book shown in the list row is in the user's library, would it be better to directly ask SQLite (via SELECT COUNT(*)...) or to maintain, in-memory, a List or int[] array of some sort containing the unique bookIds. So, on each row display do I query SQLite or check if the List or int[] array contains the unique bookId? Because the user can have at most 5,000 books, each bookId occupies 4 bytes so at most this would use ~ 20kB. In thinking about this, and in typing this out, it seems obvious to me that it would be far better for performance if I maintained a list or int[] array of in-library bookIds vs. querying SQLite (the only caveat to maintaining an int[] array is that if books are added or removed I'll need to grow or shrink the array by hand, so with this option I'll most likely use an ArrayList or Vector, though I'm not sure of the additional memory overhead of using Integer objects as opposed to primitives). Opinions, thoughts, suggestions?

    Read the article

  • Concept: Information Into Memory Location.

    - by Richeve S. Bebedor
    I am having troubles conceptualizing an algorithm to be used to transform any information or data into a specific appropriate and reasonable memory location in any data structure that I will be devising. To give you an idea, I have a JPanel object instance and I created another Container type object instance of any subtype (note this is in Java because I love this language), then I collected those instances into a data structure not specifically just for those instances but also applicable to any type of object. Now my procedure for fetching those data again is to extract the object specific features similar in category to all object in that data structure and transform it into a integer data memory location (specifically as much as possible) or any type of data that will pertain to this transformation. And I can already access that memory location without further sorting or applications of O(n) time complex algorithms (which I think preferable but I wanted to do my own way XD). The data structure is of any type either binary tree, linked list, arrays or sets (and the like XD). What is important is I don't need to have successive comparing and analysis of data just to locate information in big structures. To give you a technical idea, I have to an array DS that contains JLabel object instance with a specific name "HelloWorld". But array DS contains other types of object (in multitude). Now this JLabel object has a location in the array at index [124324] (which is if you do any type of searching algorithm just to arrive at that location is conceivably slow because added to it the data structure used was an array *note please disregard the efficiency of the data structure to be used I just want to explain to you my concept XD). Now I want to equate "HelloWorld" to 124324 by using a conceptually made function applicable to all data types. So that I can do a direct search by doing this DS[extractLocation("HelloWorld")] just to get that JLabel instance. I know this may sound crazy but I want to test my concept of non-sorting feature extracting search algorithm for any data structure wherein my main problem is how to transform information to be stored into memory location of where it was stored.

    Read the article

  • Javascript Regex: Testing string for intelligent query

    - by Shyam
    Hi, I have a string that holds user input. This string can contain various types of data, like: a six digit id a zipcode that contains out of 4 digits and two alphanumeric characters a name (characters only) As I am using this string to search through a database, the query type is determined on the type of search, which i want to handle serverside using JavaScript (yes, I am using JavaScript serverside). Searching on StackOverflow, brought me some interesting information, like the .test-method, which seems perfect for my needs. The test-method returns either true or false based on the evaluation on the string using a regex object. I am using this page as a reference: http://www.javascriptkit.com/jsref/regexp.shtml So I am trying to determine the zipcode, by using the following very noobish regex. var r = /[A-Za-z]{2,2}/ As far I can understand, this should limit the amount of occurrences of alphanumeric characters to a maximum of two. See beneath the output of my JavaScript console. > var r = /[A-Za-z]{2,2}/ > var x = "2233AL" > r.test(x) true > var x = "2233A" > r.test(x) false > var x = "2233ALL" > r.test(x) true /* i want this to be false */ > A little help would be really appreciated!

    Read the article

  • How to make simple dicitonary J2ME

    - by batosai_fk
    Hi, I am beginner in JavaME. I'd like to make simple dicitionary. The source data is placed on "data.txt" file in "res" directory. The structure is like this: #apple=kind of fruit; #spinach=kind of vegetable; The flow is so simple. User enters word that he want to search in a text field, e.g "apple", system take the user input, read the "data.txt", search the matched word in it, take corresponding word, and display it to another textfield/textbox. I've managed to read whole "data.txt" using this code.. private String readDataText() { InputStream is = getClass().getResourceAsStream("data.txt"); try { StringBuffer sb = new StringBuffer(); int chr, i=0; while ((chr = is.read()) != -1) sb.append((char) chr); return sb.toString(); } catch (Exception e) { } return null; } but I still dont know how to split it, find the matched word with the user input and take corresponding word. Hope somebody willing to share his/her knowledge to help me.. Add to batosai_fk's Reputation

    Read the article

< Previous Page | 339 340 341 342 343 344 345 346 347 348 349 350  | Next Page >