Search Results

Search found 9494 results on 380 pages for 'least squares'.

Page 348/380 | < Previous Page | 344 345 346 347 348 349 350 351 352 353 354 355  | Next Page >

  • Jetty: Stopping programatically causes "1 threads could not be stopped"

    - by Ondra Žižka
    Hi, I have an embedded Jetty 6.1.26 instance. I want to shut it down by HTTP GET sent to /shutdown. So I created a JettyShutdownServlet: @Override protected void doGet(HttpServletRequest req, HttpServletResponse resp) throws ServletException, IOException { resp.setStatus(202, "Shutting down."); resp.setContentType("text/plain"); ServletOutputStream os = resp.getOutputStream(); os.println("Shutting down."); os.close(); resp.flushBuffer(); // Stop the server. try { log.info("Shutting down the server..."); server.stop(); } catch (Exception ex) { log.error("Error when stopping Jetty server: "+ex.getMessage(), ex); } However, when I send the request, Jetty does not stop - a thread keeps hanging in org.mortbay.thread.QueuedThreadPool on the line with this.wait(): // We are idle // wait for a dispatched job synchronized (this) { if (_job==null) this.wait(getMaxIdleTimeMs()); job=_job; _job=null; } ... 2011-01-10 20:14:20,375 INFO org.mortbay.log jetty-6.1.26 2011-01-10 20:14:34,756 INFO org.mortbay.log Started [email protected]:17283 2011-01-10 20:25:40,006 INFO org.jboss.qa.mavenhoe.MavenHoeApp Shutting down the server... 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown [email protected]:17283 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.servlet.Context@1672bbb{/,null} 2011-01-10 20:25:40,006 INFO org.mortbay.log Graceful shutdown org.mortbay.jetty.webapp.WebAppContext@18d30fb{/jsp,file:/home/ondra/work/Mavenhoe/trunk/target/classes/org/jboss/qa/mavenhoe/web/jsp} 2011-01-10 20:25:43,007 INFO org.mortbay.log Stopped [email protected]:17283 2011-01-10 20:25:43,009 WARN org.mortbay.log 1 threads could not be stopped 2011-01-10 20:26:43,010 INFO org.mortbay.log Shutdown hook executing 2011-01-10 20:26:43,011 INFO org.mortbay.log Shutdown hook complete It blocks for exactly one minute, then shuts down. I've added the Graceful shutdown, which should allow me to shut the server down from a servlet; However, it does not work as you can see from the log. I've solved it this way: Server server = new Server( PORT ); server.setGracefulShutdown( 3000 ); server.setStopAtShutdown(true); ... server.start(); if( server.getThreadPool() instanceof QueuedThreadPool ){ ((QueuedThreadPool) server.getThreadPool()).setMaxIdleTimeMs( 2000 ); } setMaxIdleTimeMs() needs to be called after the start(), becase the threadPool is created in start(). However, the threads are already created and waiting, so it only applies after all threads are used at least once. I don't know what else to do except some awfulness like interrupting all threads or System.exit(). Any ideas? Is there a good way? Thanks, Ondra

    Read the article

  • Need a fast programming language that can drive two printers

    - by Pete
    I have a rather unusual application that isn't working the way I need, and I hope someone here will have some suggestions or at least a direction to investigate. We have a museum exhibit that has a computer at the entrance driving two small receipt printers. There are two buttons on a console, wired to the left and right buttons of a disemboweled mouse. The two printers and associated buttons are for girls and boys, each button does a random selection from a database of names and prints a small ticket on the appropriate printer with a graphic image, a few words about the exhibit and the randomly chosen name. Conceptually all is well, but it hangs quite often. I got the project at the last minute, because the original designer got bogged down and couldn't deliver, so the exhibit's author asked me the day before opening, whether I could write something that would work. I did it in Word, since I am an experienced VBA programmer. Several other avenues I attempted first all lead to dead ends - one couldn't do graphics, another couldn't handle two printers, yet another couldn't change fonts and so on. The problem is that it simply isn't fast enough - Word can only drive one printer at a time and changing the active printer takes a long time. Not by office standards, where a second or two of delay before a printer starts working on your document is not an issue, but here I need more or less instant response. If kids press a button and nothing happens, they press it over and over until something does happen, resulting in maybe half a dozen commands being sent before the printer starts reacting. Sometimes it jams the program completely, since boys and girls will be pressing the two buttons simultaneously and Word locks up, and even when it doesn't jam, the printers then spit out a stream of tickets, making a mess. The kids start squabbling over which ticket is whose, pulling them out of the printers, snarling the paper tape, jamming the printer and generally making a mess of the whole affair, often necessitating the exhibit caretakers having to restart the computer and clear torn bits of paper out the printers. What I need is some sort of fast programming language that can drive two printers *-simultaneously-*, not the MSOffice claptrap of having to switch the active printer, that can react to both left and right mouse button click events, can print a small graphic image and can print in different font sizes and styles and. I don't need many, but it's not all in one typeface. Can anyone suggest what I might use for this? I don't even know if it's possible at all under Windows, whether the "single active printer" garbage is an Office artifact, or a Windows restriction. My little Commodore-64 twenty-five years ago had two printers attached to it and drove both simultaneously with no difficulties - it doesn't seem to me it should be such an impossible requirement today.

    Read the article

  • Persistent (purely functional) Red-Black trees on disk performance

    - by Waneck
    I'm studying the best data structures to implement a simple open-source object temporal database, and currently I'm very fond of using Persistent Red-Black trees to do it. My main reasons for using persistent data structures is first of all to minimize the use of locks, so the database can be as parallel as possible. Also it will be easier to implement ACID transactions and even being able to abstract the database to work in parallel on a cluster of some kind. The great thing of this approach is that it makes possible implementing temporal databases almost for free. And this is something quite nice to have, specially for web and for data analysis (e.g. trends). All of this is very cool, but I'm a little suspicious about the overall performance of using a persistent data structure on disk. Even though there are some very fast disks available today, and all writes can be done asynchronously, so a response is always immediate, I don't want to build all application under a false premise, only to realize it isn't really a good way to do it. Here's my line of thought: - Since all writes are done asynchronously, and using a persistent data structure will enable not to invalidate the previous - and currently valid - structure, the write time isn't really a bottleneck. - There are some literature on structures like this that are exactly for disk usage. But it seems to me that these techniques will add more read overhead to achieve faster writes. But I think that exactly the opposite is preferable. Also many of these techniques really do end up with a multi-versioned trees, but they aren't strictly immutable, which is something very crucial to justify the persistent overhead. - I know there still will have to be some kind of locking when appending values to the database, and I also know there should be a good garbage collecting logic if not all versions are to be maintained (otherwise the file size will surely rise dramatically). Also a delta compression system could be thought about. - Of all search trees structures, I really think Red-Blacks are the most close to what I need, since they offer the least number of rotations. But there are some possible pitfalls along the way: - Asynchronous writes -could- affect applications that need the data in real time. But I don't think that is the case with web applications, most of the time. Also when real-time data is needed, another solutions could be devised, like a check-in/check-out system of specific data that will need to be worked on a more real-time manner. - Also they could lead to some commit conflicts, though I fail to think of a good example of when it could happen. Also commit conflicts can occur in normal RDBMS, if two threads are working with the same data, right? - The overhead of having an immutable interface like this will grow exponentially and everything is doomed to fail soon, so this all is a bad idea. Any thoughts? Thanks! edit: There seems to be a misunderstanding of what a persistent data structure is: http://en.wikipedia.org/wiki/Persistent_data_structure

    Read the article

  • markdown to HTML with customised WMD editor

    - by spirytus
    For my application I customized slightly the way WMD behaves so when user enters empty lines, these are reflected in HTML output as <br />'s. Now I came to a point when I should store it somewhere at backend and so after going thru SO posts for a while I'm not sure what is the best way to do it. I have few options and if you could point out which their pros/cons that would be much appreciated. send to server and store as markdown rather than HTML. To me obvious advantage would be keeping exactly same formatting as user originally entered. But then how can I convert it back to HTML for display to a client? It seems very troublesome to convert it on client side as even if it would be possible what would happen if JS would be disabled? If I wanted to do it on the server, then standard server side implementations of markup to HTML might be resource expensive. Would that be an issue in your opinion? Even if it wouldn't be the case then as I mentioned my WMD implementation is customised and those server side solutions wouldn't probably do the right conversion to markdown anyway and there always would be a risk that something would convert wrong. Send to server as converted HTML. Same as above.. conversion on client side would be difficult, server side same with possibility of getting it wrong. send original markdown and converted HTML and store both. No performance issues related to converting markdown to HTML on client side, nor on server side. Users would have always same markdown they originally entered and same HTML they originally saw in preview (possibly sanitized in php though). It would have to take twice that much storage space though and that is my biggest worry. I tend to lean towards 3rd solution as it seems simplest, but there is a worry of doubled storage space needed for this solution. Please bear in mind that my implementation of WMD is slightly modified and also I'm going with PHP/MySql server side implementation. So apart from 3 options I listed above, are there any other possible solutions to my problem? Did I miss anything important that would make one of the options above better then the rest? And what other pros/cons would apply to each solution I listed? Also how is it implemented on SO? I read somwhere that they using option 3, and so if its good enough for SO would be good enough for me :) but not sure if its true anyway, so how is it done? Also please forgive me, but at least for once I got to say that StackOverflow IS THE BEST DAMN RESOURCE ON THE WEB and I truly appreciate all the people trying to help others here! The site and users here are simply amazing!

    Read the article

  • how to design this relation in a DB schema

    - by raticulin
    I have a table Car in my db, one of the columns is purchaseDate. I want to be able to tag every car with a number of Policies (limited to 10 policies). Each policy has a time to life (ttl, a duration of time, like '5 years', '10 months' etc), that is, for how long since the car's purchaseDate the policy can be applied. I need to perform the following actions: when inserting a Car, it will be set with a number of Policies (at least one is set) sometimes a Car will be updated to add/remove a Policy searches must be done taking into account date/policies, for example: 'select all cars that are not covered by any policy as of today' My current design is (pol0..pol9 are the policies): CREATE TABLE Car ( id int NOT NULL IDENTITY(1,1), purchaseDate datetime NOT NULL, //more stuff... pol0 smallint default NULL, pol1 smallint default NULL, pol2 smallint default NULL, pol3 smallint default NULL, pol4 smallint default NULL, pol5 smallint default NULL, pol6 smallint default NULL, pol7 smallint default NULL, pol8 smallint default NULL, pol9 smallint default NULL, PRIMARY KEY (id) ) CREATE TABLE Policy ( id smallint NOT NULL, name varchar(50) collate Latin1_General_BIN NOT NULL, ttl varchar(100) collate Latin1_General_BIN NOT NULL, PRIMARY KEY (id) ) The problem I am facing is that the sql to perform the query above is a nightmare to write. As I don't know in which column each policy can be, so I have to check all columns for every policy etc etc. So I am wondering wether it is worth changing this. My questions are: The smallint as Policy id was chosen instead of an 'int IDENTITY' in order to save some space as there are going to be millions of Car records. It just adds complexity when creating a Policy as we must handle the id etc. Was it worth doing this? I am thinking that maybe there is a much better design? Obviously we could move the policy/car relation to its own table CarPolicy, benefits would be: no limit on 10 policies per car adding/removing etc much easier when only the default policy is applied (when no others are applied one called Default policy is applied), we could signal that by not having any entry in CarPolicy, now this is just done inserting the Default policy id in one of the columns. The cons are that we would need to change the DB, ORM classes etc. What would you recommend? Maybe there is another smart way to implement this that we are not aware without using the CarPolicy table?

    Read the article

  • Linq query challenge - can this be done?

    - by vdh_ant
    My table structure is as follows: Person 1-M PesonAddress Person 1-M PesonPhone Person 1-M PesonEmail Person 1-M Contract Contract M-M Program Contract M-1 Organization At the end of this query I need a populated object graph where each person has their: PesonAddress's PesonPhone's PesonEmail's PesonPhone's Contract's - and this has its respective Program's Now I had the following query and I thought that it was working great, but it has a couple of problems: from people in ctx.People.Include("PersonAddress") .Include("PersonLandline") .Include("PersonMobile") .Include("PersonEmail") .Include("Contract") .Include("Contract.Program") where people.Contract.Any( contract => (param.OrganizationId == contract.OrganizationId) && contract.Program.Any( contractProgram => (param.ProgramId == contractProgram.ProgramId))) select people; The problem is that it filters the person to the criteria but not the Contracts or the Contract's Programs. It brings back all Contracts that each person has not just the ones that have an OrganizationId of x and the same goes for each of those Contract's Programs respectively. What I want is only the people that have at least one contract with an OrgId of x with and where that contract has a Program with the Id of y... and for the object graph that is returned to have only the contracts that match and programs within that contract that match. I kinda understand why its not working, but I don't know how to change it so it is working... This is my attempt thus far: from people in ctx.People.Include("PersonAddress") .Include("PersonLandline") .Include("PersonMobile") .Include("PersonEmail") .Include("Contract") .Include("Contract.Program") let currentContracts = from contract in people.Contract where (param.OrganizationId == contract.OrganizationId) select contract let currentContractPrograms = from contractProgram in currentContracts let temp = from x in contractProgram.Program where (param.ProgramId == contractProgram.ProgramId) select x where temp.Any() select temp where currentContracts.Any() && currentContractPrograms.Any() select new Person { PersonId = people.PersonId, FirstName = people.FirstName, ..., ...., MiddleName = people.MiddleName, Surname = people.Surname, ..., ...., Gender = people.Gender, DateOfBirth = people.DateOfBirth, ..., ...., Contract = currentContracts, ... }; //This doesn't work But this has several problems (where the Person type is an EF object): I am left to do the mapping by myself, which in this case there is quite a lot to map When ever I try to map a list to a property (i.e. Scholarship = currentScholarships) it says I can't because IEnumerable is trying to be cast to EntityCollection Include doesn't work Hence how do I get this to work. Keeping in mind that I am trying to do this as a compiled query so I think that means anonymous types are out.

    Read the article

  • apply style to range of text with javascript in uiwebview

    - by drawnonward
    I am displaying some simple styled text as html in a UIWebView on iPhone. It is basically a series of paragraphs with the occasional strong or emphasized phrase. At runtime I need to apply styles to ranges of text. There are a few similar scenarios, one of which is highlighting search results. If the user has searched for "something" I would like to change the background color behind occurrences of the word, then later restore the original background. Is it possible to apply styles to ranges of text using javascript? A key part of this is also being able to unset the styles. There seem to be two likely paths to follow. One would be modifying some html in Objective-C and passing it through javascript as the new innerHTML of some container. The other would be to use javascript to directly manipulate DOM nodes. I could manipulate html, but that sounds tedious in Objective-C so I would rather manipulate the DOM if that is a reasonable approach. I am not that familiar with javascript and DOM so I do not know if it is a reasonable approach. I wrote some routines to translate between text ranges and node ranges with offsets. So if I start with text range 100-200 and that starts in one paragraph and ends in a third, I can get the text nodes and the offsets within the nodes that represent the given text range. I just need a way to split a text node at an offset in the text. Currently I just apply styles to the paragraphs containing the text range. A few notes: straight javascript please, no external frameworks like jquery. the changes never need to be written to disk. the changes should be undoable or at least removable. the styles to apply already exist in a css file. it needs to work in iPhone 3.0 and forward. all the source files are shipped with the app. please be verbose. Thanks for any suggestions.

    Read the article

  • How to cache queries in EJB and return result efficient (performance POV)

    - by Maxym
    I use JBoss EJB 3.0 implementation (JBoss 4.2.3 server) At the beginning I created native query all the time using construction like Query query = entityManager.createNativeQuery("select * from _table_"); Of couse it is not that efficient, I performed some tests and found out that it really takes a lot of time... Then I found a better way to deal with it, to use annotation to define native queries: @NamedNativeQuery( name = "fetchData", value = "select * from _table_", resultClass=Entity.class ) and then just use it Query query = entityManager.createNamedQuery("fetchData"); the performance of code line above is two times better than where I started from, but still not that good as I expected... then I found that I can switch to Hibernate annotation for NamedNativeQuery (anyway, JBoss's implementation of EJB is based on Hibernate), and add one more thing: @NamedNativeQuery( name = "fetchData2", value = "select * from _table_", resultClass=Entity.class, readOnly=true) readOnly - marks whether the results are fetched in read-only mode or not. It sounds good, because at least in this case of mine I don't need to update data, I wanna just fetch it for report. When I started server to measure performance I noticed that query without readOnly=true (by default it is false) returns result with each iteration better and better, and at the same time another one (fetchData2) works like "stable" and with time difference between them is shorter and shorter, and after 5 iterations speed of both was almost the same... The questions are: 1) is there any other way to speed query using up? Seems that named queries should be prepared once, but I can't say it... In fact if to create query once and then just use it it would be better from performance point of view, but it is problematic to cache this object, because after creating query I can set parameters (when I use ":variable" in query), and it changes query object (isn't it?). well, is here any way to cache them? Or named query is the best option I can use? 2) any other approaches how to make results retrieveng faster. I mean, for instance I don't need those Entities to be attached, I won't update them, all I need is just fetch collection of data. Maybe readOnly is the only available way, so I can't speed it up, but who knows :) P.S. I don't ask about DB performance, all I need now is how not to create query all the time, so use it efficient, and to "allow" EJB to do less job with the same result concerning data returning.

    Read the article

  • Selenium: How to use stored value in a javascript comparison

    - by dstrube
    I've searched around for the answer to this and found lots of much more complicated questions, but none that gave me insight enough to figure this one out. What I'm doing: 1- open a page with a number that will probably be large 2- get the X Path to where that number is and store it to a variable 3- do a javascript to compare the above stored variable to see if it is bigger than 10, if so, set a new varaible to true; else false (because that is the default value) 4- verify the variable in #3 is true Sounds simple enough, no? Where it goes wrong: At step 3, comparing the variable from step #2 to 10 isn't allowed, at least not the way I'm writing it. Why? Details: <tr> <td>open</td> <td>http://www.google.com/search?hl=en&q=selenium+verifyEval</td> <td></td> </tr> <tr> <td>store</td> <td>/html/body/div[5]/div/p/b[3]</td> <td>resultCount</td> </tr> <tr> <td>storeEval</td> <td>var isMoreThan10 = new Boolean(); isMoreThan10 = (resultCount &gt; 10);</td> <td>isMoreThan10</td> </tr> <tr> <td>verifyExpression</td> <td>${isMoreThan10}</td> <td>true</td> </tr> I just thought of one possible workaround: Exapnd the javascript code to get the value there & assign it to a variable there so I'll be more likely to be able to use that variable in the javascript. Not sure exactly how that would be done- anyone wanna help with that? But surely there is be a better way, isn't there? I must be able to assign a value to a variable in Selenium, then in the next line use that variable in a javascript, right?

    Read the article

  • How to get the top keys from a hash by value

    - by Kirs Kringle
    I have a hash that I sorted by values greatest to least. How would I go about getting the top 5? There was a post on here that talked about getting only one value. What is the easiest way to get a key with the highest value from a hash in Perl? I understand that so would lets say getting those values add them to an array and delete the element in the hash and then do the process again? Seems like there should be an easier way to do this then that though. My hash is called %words. use strict; use warnings; use Tk; #Learn to install here: http://factscruncher.blogspot.com/2012/01/easy-way-to-install-tk- on-strawberry.html #Reading in the text file my $file0 = Tk::MainWindow->new->Tk::getOpenFile; open( my $filehandle0, '<', $file0 ) || die "Could not open $file0\n"; my @words; while ( my $line = <$filehandle0> ) { chomp $line; my @word = split( /\s+/, lc($line)); push( @words, @word ); } for (@words) { s/[\,|\.|\!|\?|\:|\;|\"]//g; } #Counting words that repeat; put in hash my %words_count; $words_count{$_}++ for @words; #Reading in the stopwords file my $file1 = "stoplist.txt"; open( my $filehandle1, '<', $file1 ) or die "Could not open $file1\n"; my @stopwords; while ( my $line = <$filehandle1> ) { chomp $line; my @linearray = split( " ", $line ); push( @stopwords, @linearray ); } for my $w ( my @stopwords ) { s/\b\Q$w\E\B//ig; } #Comparing the array to Hash and deleteing stopwords my %words = %words_count; for my $stopwords ( @stopwords ) { delete $words{ $stopwords }; } #Sorting Hash Table my @keys = sort { $words{$b} <=> $words{$a} or "\L$a" cmp "\L$b" } keys %words; #Starting Statistical Work my $value_count = 0; my $key_count = 0; #Printing Hash Table $key_count = keys %words; foreach my $key (@keys) { $value_count = $words{$key} + $value_count; printf "%-20s %6d\n", $key, $words{$key}; } my $value_average = $value_count / $key_count; #my @topwords; #foreach my $key (@keys){ #if($words{$key} > $value_average){ # @topwords = keys %words; # } #} print "\n", "The number of values: ", $value_count, "\n"; print "The number of elements: ", $key_count, "\n"; print "The Average: ", $value_average, "\n\n";

    Read the article

  • Do You Really Know Your Programming Languages?

    - by Kristopher Johnson
    I am often amazed at how little some of my colleagues know or care about their craft. Something that constantly frustrates me is that people don't want to learn any more than they need to about the programming languages they use every day. Many programmers seem content to learn some pidgin sub-dialect, and stick with that. If they see a keyword or construct that they aren't familiar with, they'll complain that the code is "tricky." What would you think of a civil engineer who shied away from calculus because it had "all those tricky math symbols?" I'm not suggesting that we all need to become "language lawyers." But if you make your living as a programmer, and claim to be a competent user of language X, then I think at a minimum you should know the following: Do you know the keywords of the language and what they do? What are the valid syntactic forms? How are memory, files, and other operating system resources managed? Where is the official language specification and library reference for the language? The last one is the one that really gets me. Many programmers seem to have no idea that there is a "specification" or "standard" for any particular language. I still talk to people who think that Microsoft invented C++, and that if a program doesn't compile under VC6, it's not a valid C++ program. Programmers these days have it easy when it comes to obtaining specs. Newer languages like C#, Java, Python, Ruby, etc. all have their documentation available for free from the vendors' web sites. Older languages and platforms often have standards controlled by standards bodies that demand payment for specs, but even that shouldn't be a deterrent: the C++ standard is available from ISO for $30 (and why am I the only person I know who has a copy?). Programming is hard enough even when you do know the language. If you don't, I don't see how you have a chance. What do the rest of you think? Am I right, or should we all be content with the typical level of programming language expertise? Update: Several great comments here. Thanks. A couple of people hit on something that I didn't think about: What really irks me is not the lack of knowledge, but the lack of curiosity and willingness to learn. It seems some people don't have any time to hone their craft, but they have plenty of time to write lots of bad code. And I don't expect people to be able to recite a list of keywords or EBNF expressions, but I do expect that when they see some code, they should have some inkling of what it does. Few people have complete knowledge of every dark corner of their language or platform, but everyone should at least know enough that when they see something unfamiliar, they will know how to get whatever additional information they need to understand it.

    Read the article

  • Patterns: Local Singleton vs. Global Singleton?

    - by Mike Rosenblum
    There is a pattern that I use from time to time, but I'm not quite sure what it is called. I was hoping that the SO community could help me out. The pattern is pretty simple, and consists of two parts: A singleton factory, which creates objects based on the arguments passed to the factory method. Objects created by the factory. So far this is just a standard "singleton" pattern or "factory pattern". The issue that I'm asking about, however, is that the singleton factory in this case maintains a set of references to every object that it ever creates, held within a dictionary. These references can sometimes be strong references and sometimes weak references, but it can always reference any object that it has ever created. When receiving a request for a "new" object, the factory first searches the dictionary to see if an object with the required arguments already exits. If it does, it returns that object, if not, it returns a new object and also stores a reference to the new object within the dictionary. This pattern prevents having duplicative objects representing the same underlying "thing". This is useful where the created objects are relatively expensive. It can also be useful where these objects perform event handling or messaging - having one object per item being represented can prevent multiple messages/events for a single underlying source. There are probably other reasons to use this pattern, but this is where I've found this useful. My question is: what to call this? In a sense, each object is a singleton, at least with respect to the data it contains. Each is unique. But there are multiple instances of this class, however, so it's not at all a true singleton. In my own personal terminology, I tend to call the factory method a "global singleton". I then call the created objects "local singletons". I sometimes also say that the created objects have "reference equality", meaning that if two variables reference the same data (the same underlying item) then the reference they each hold must be to the same exact object, hence "reference equality". But these are my own invented terms, and I am not sure that they are good ones. Is there standard terminology for this concept? And if not, could some naming suggestions be made? Thanks in advance...

    Read the article

  • Design patterns and interview question

    - by user160758
    When I was learning to code, I read up on the design patterns like a good boy. Long after this, I started to actually understand them. Design discussions such as those on this site constantly try to make the rules more and more general, which is good. But there is a line, over which it becomes over-analysis starts to feed off itself and as such I think begins to obfuscate the original point - for example the "What's Alternative to Singleton" post and the links contained therein. http://stackoverflow.com/questions/1300655/whats-alternative-to-singleton I say this having been asked in both interviews I’ve had over the last 2 weeks what a singleton is and what criticisms I have of it. I have used it a few times for items such as user data (simple key-value eg. last file opened by this user) and logging (very common i'm sure). I've never ever used it just to have what is essentially global application data, as this is clearly stupid. In the first interview, I reply that I have no criticisms of it. He seemed disappointed by this but as the job wasn’t really for me, I forgot about it. In the next one, I was asked again and, as I wanted this job, I thought about it on the spot and made some objections, similar to those contained in the post linked to above (I suggested use of a factory or dependency injection instead). He seemed happy with this. But my problem is that I have used the singleton without ever using it in this kind of stupid way, which I had to describe on the spot. Using it for global data and the like isn’t something I did then realised was stupid, or read was stupid so didn’t do, it was just something I knew was stupid from the start. Essentially I’m supposed to be able to think of ways of how to misuse a pattern in the interview? Which class of programmers can best answer this question? The best ones? The medium ones? I'm not sure.... And these were both bright guys. I read more than enough to get better at my job but had never actually bothered to seek out criticisms of the most simple of the design patterns like this one. Do people think such questions are valid and that I ought to know the objections off by heart? Or that it is reasonable to be able to work out what other people who are missing the point would do on the fly? Or do you think I’m at least partially right that the question is too unsubtle and that the questions ought to be better thought out in order to make sure only good candidates can answer. PS. Please don’t think I’m saying that I’m just so clever that I know everything automatically - I’ve learnt the hard way like everyone else. But avoiding global data is hardly revolutionary.

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • writing a Simplest XML DeSerialization class for the simplest xml file. How to avoid the nesting? de

    - by Enggr
    Hi, I want to deserialize an xml file which has to be just in this form <Basket> <Fruit>Apple</Fruit> <Fruit>Orange</Fruit> <Fruit>Grapes</Fruit> </Basket> Out of the examples I read on internet the least possible format I could find was the following <Basket> <FruitArray> <Fruit>Apple</Fruit> </FruitArray> <FruitArray> <Fruit>Orange</Fruit> </FruitArray> <FruitArray> <Fruit>Grapes</Fruit> </FruitArray> </Basket> and that has the following deserialization class for converting it into a class object. using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace XMLSerialization_Basket { [System.Xml.Serialization.XmlRootAttribute("Basket", Namespace = "BasketNamespace", IsNullable = false)] public class Basket { /// <remarks/> [System.Xml.Serialization.XmlElementAttribute("FruitArray")] public FruitArray[] objFruitArray; } /// <remarks/> [System.Xml.Serialization.XmlTypeAttribute(Namespace = "BasketNamespace")] public class FruitArray { /// <remarks/> private string _Fruit; public string Fruit { get { return _Fruit; } set { _Fruit = value; } } } } Can I add something like the following directly under top class private string _Fruit; public string Fruit { get { return _Fruit; } set { _Fruit = value; } } and avoid the array nesting? my goal is to deserialize an xml of following format <Basket> <Fruit>Apple</Fruit> <Fruit>Orange</Fruit> <Fruit>Grapes</Fruit> </Basket>

    Read the article

  • Throwing cats out of windows

    - by AndrewF
    Imagine you're in a tall building with a cat. The cat can survive a fall out of a low story window, but will die if thrown from a high floor. How can you figure out the longest drop that the cat can survive, using the least number of attempts? Obviously, if you only have one cat, then you can only search linearly. First throw the cat from the first floor. If it survives, throw it from the second. Eventually, after being thrown from floor f, the cat will die. You then know that floor f-1 was the maximal safe floor. But what if you have more than one cat? You can now try some sort of logarithmic search. Let's say that the build has 100 floors and you have two identical cats. If you throw the first cat out of the 50th floor and it dies, then you only have to search 50 floors linearly. You can do even better if you choose a lower floor for your first attempt. Let's say that you choose to tackle the problem 20 floors at a time and that the first fatal floor is #50. In that case, your first cat will survive flights from floors 20 and 40 before dying from floor 60. You just have to check floors 41 through 49 individually. That's a total of 12 attempts, which is much better than the 50 you would need had you attempted to use binary elimination. In general, what's the best strategy and it's worst-case complexity for an n-storied building with 2 cats? What about for n floors and m cats? Assume that all cats are equivalent: they will all survive or die from a fall from a given window. Also, every attempt is independent: if a cat survives a fall, it is completely unharmed. This isn't homework, although I may have solved it for school assignment once. It's just a whimsical problem that popped into my head today and I don't remember the solution. Bonus points if anyone knows the name of this problem or of the solution algorithm.

    Read the article

  • Rails learn's confusion

    - by Steve
    This is a beginner's rails learning confusion. When I learn rails, from time to time, I feel frustrated on rails' principle "Convention over Configuration". Rails uses heavily on conventions. A lot of them are just naming conventions. If I forget a convention, I will either use the wrong naming and get unexpected result or get things magically done but don't understand how. Sometimes, I think of configuration. At least configuration lists everything clearly and nothing is in fog. In rails, there seems a hidden, dark contract between you and the machine. If you follow the contract, you communicate well. But a beginner usually forgets items listed on the contract and this usually leads to confusion. That's why when I first pick up rails, I feel like it is somehow difficult to learn. Besides, there are many other things that could be new to a learner, such as using git, using plugins from community, using RESTful routing style, using RSpec. All these are new and come together in learning ruby and rails. This definitely adds up difficulties for a beginner. In contrast, if you learn php, it wouldn't be that bad. You can forget many things and focus on learning php itself. You don't need to learn database handling if you know SQL already(in rails, you need to learn a whole new concept migration), you don't have to learn a new decent unit test(in rails, usually they teach RSpec along the way because rails is agile and you should learn test-driven development in the early learning stage), you don't have to learn a new version control(in rails, you will be taught about git anyway), you don't have to use complicated plugins(in rails, they usually use third-party plugins in textbook examples! what the hell? why not teach how to do a simplified similar thing in rails?), you don't have to worry RESTful style. All in all, when I learn php, I learn it quick and soon I start to write things myself. Learning php is similar to learning C/java. It tastes like those traditional languages. When I learn rails, it is more difficult. And I need to learn ruby as well (I believe many of you learn ruby just because of rails). Does anyone have the similar feeling as I have? How do you overcome it and start to master rails? Hints will be welcomed. Thank you.

    Read the article

  • How do I do distributed UML development (à la FOSS)?

    - by James A. Rosen
    I have a UML project (built in IBM's Rational System Architect/Modeler, so stored in their XML format) that has grown quite large. Additionally, it now contains several pieces that other groups would like to re-use. I come from a software development (especially FOSS) background, and am trying to understand how to use that as an analogy here. The problem I am grappling with is similar to the Fragile Base Class problem. Let me start with how it works in an object-oriented (say, Java or Ruby) FOSS ecosystem: Group 1 publishes some "core" package, say "net/smtp version 1.0" Group 2 includes Group 1's net/smtp 1.0 package in the vendor library of their software project At some point, Group 1 creates a new 2.0 branch of net/smtp that breaks backwards compatibility (say, it removes an old class or method, or moves a class from one package to another). They tell users of the 1.0 version that it will be deprecated in one year. Group 2, when they have the time, updates to net/smtp 2.0. When they drop in the new package, their compiler (or test suite, for Ruby) tells them about the incompatibility. They do have to make some manual changes, but all of the changes are in the code, in plain text, a medium with which they are quite familiar. Plus, they can often use their IDE's (or text editor's) "global-search-and-replace" function once they figure out what the fixes are. When we try to apply this model to UML in RSA, we run into some problems. RSA supports some fairly powerful refactorings, but they seem to only work if you have write access to all of the pieces. If I rename a class in one package, RSA can rename the references, but only at the same time. It's very difficult to look at the underlying source (the XML) and figure out what's broken. To fix such a problem in the RSA editor itself means tons of clicking on things -- there is no good equivalent of "global-search-and-replace," at least not after an incomplete refactor. They real sticking point seems to be that RSA assumes that you want to do all your editing using their GUI, but that makes certain operations prohibitively difficult. Does anyone have examples of open-source UML projects that have overcome this problem? What strategies do they use for communicating changes?

    Read the article

  • Rails send mail with GMail

    - by Danny McClelland
    Hi Everyone, I am on rails 2.3.5 and have the latest Ruby installed and my application is running well, except, GMail emails. I am trying to setup my gmail imap connection which has worked previously but now doesnt want to know. This is my code: # Be sure to restart your server when you modify this file # Uncomment below to force Rails into production mode when # you don't control web/app server and can't set it the proper way # ENV['RAILS_ENV'] ||= 'production' # Specifies gem version of Rails to use when vendor/rails is not present RAILS_GEM_VERSION = '2.3.5' unless defined? RAILS_GEM_VERSION # Bootstrap the Rails environment, frameworks, and default configuration require File.join(File.dirname(__FILE__), 'boot') Rails::Initializer.run do |config| # Gems config.gem "capistrano-ext", :lib => "capistrano" config.gem "configatron" # Make Time.zone default to the specified zone, and make Active Record store time values # in the database in UTC, and return them converted to the specified local zone. config.time_zone = "London" # The internationalization framework can be changed to have another default locale (standard is :en) or more load paths. # All files from config/locales/*.rb,yml are added automatically. # config.i18n.load_path << Dir[File.join(RAILS_ROOT, 'my', 'locales', '*.{rb,yml}')] #config.i18n.default_locale = :de # Your secret key for verifying cookie session data integrity. # If you change this key, all old sessions will become invalid! # Make sure the secret is at least 30 characters and all random, # no regular words or you'll be exposed to dictionary attacks. config.action_controller.session = { :session_key => '_base_session', :secret => '7389ea9180b15f1495a5e73a69a893311f859ccff1ffd0fa2d7ea25fdf1fa324f280e6ba06e3e5ba612e71298d8fbe7f15fd7da2929c45a9c87fe226d2f77347' } config.active_record.observers = :user_observer end ActiveSupport::CoreExtensions::Date::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') ActiveSupport::CoreExtensions::Time::Conversions::DATE_FORMATS.merge!(:default => '%d/%m/%Y') require "will_paginate" ActionMailer::Base.delivery_method = :smtp ActionMailer::Base.smtp_settings = { :enable_starttls_auto => true, :address => "smtp.gmail.com", :port => 587, :domain => "XXXXXXXX.XXX", :authentication => :plain, :user_name => "XXXXXXXXXX.XXXXXXXXXX.XXX", :password => "XXXXX" } But the above just results in an SMTP auth error in the production log. I have read varied reports of this not working in Rails 2.2.2 but nothing for 2.3.5, anyone got any ideas? Thanks, Danny

    Read the article

  • how to send parameters to a web Services via SOAP?

    - by Alejandra Meraz
    Before I start: I'm programming for Iphone, using objective C. I have already implemented a call to a web service function using NSURLRequest and NSURLConnection and SOAP. The function then returns a XML with the info I need. The code is as follows: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body>\n" "<function xmlns=\"http://tempuri.org/\" />\n" "</soap:Body>\n" "</soap:Envelope>\n"]; NSURL *url = [NSURL URLWithString:@"http://myHost.com/myWebService/service.asmx"]; //the url to the WSDL NsMutableURLRequest theRequest = [[NSMutableURLRequest alloc] initWithURL:url]; NSString *msgLength = [NSString stringWithFormat:@"%d",[soapMessage length]]; [theRequest addValue:@"text/xml; charset=utf-8" forHTTPHeaderField:@"Content-Type"]; [theRequest addValue:msgLength forHTTPHeaderField:@"Content-Lenght"]; [theRequest setHTTPMethod:@"POST"]; [theRequest addValue:@"myhost.com" forHTTPHeaderField:@"Host"]; [theRequest addValue:@"http://tempuri.org/function" forHTTPHeaderField:@"SOAPAction"]; [theRequest setHTTPBody:[soapMessage dataUsingEncoding:NSUTF8StringEncoding]]; theConnection = [[NSURLConnection alloc] initWithRequest:theRequest delegate:self]; I basically copy and modified the soap request the web service gave as an example. i also implemented the methods didRecieveResponse didRecieveAuthenticationChallenge didRecievedData didFailWithError connectionDidFinishLoading. And it works perfectly. Now I need to send 2 parameters to the function: "location" and "module". I tried modifying the soapMessage like this: NSString *soapMessage = [NSString stringWithFormat: @"<?xml version=\"1.0\" encoding=\"utf-8\"?>\n" "<soap:Envelope xmlns:xsi=\"http://www.w3.org/2001/XMLSchema-instance\" xmlns:xsd=\"http://www.w3.org/2001/XMLSchema\" xmlns:soap=\"http://schemas.xmlsoap.org/soap/envelope/\">\n" "<soap:Body xmlns=\"http://tempuri.org/\" />\n" "<m:GetMonitorList>\n" "<m:location>USA</m:location>\n" "<m:module>DEVELOPMENT</m:module>\n" "</m:GetMonitorList>\n" "</soap:Body>\n" "</soap:Envelope>\n"]; But is not working...any thoughts how should I modify it? Extra info: it seems to be working... kind of. But the webservice return nothing. During the connection, the method didReceiveResponse execute once and the didFinishLoading method executes as well. But not even once the method didReceiveData. I wonder if, even though there is no USA locations, it will still send at least something? is there a way to know which are the parameters the function is waiting for? I don't have access to the source of the webservice but i can access the WSDL.

    Read the article

  • Ideas on implementing threads and cross process communication. - C

    - by Jamie Keeling
    Hello all! I have an application consisting of two windows, one communicates to the other and sends it a struct constaining two integers (In this case two rolls of a dice). I will be using events for the following circumstances: Process a sends data to process b, process b displays data Process a closes, in turn closing process b Process b closes a, in turn closing process a I have noticed that if the second process is constantly waiting for the first process to send data then the program will be just sat waiting, which is where the idea of implementing threads on each process occured. I have already implemented a thread on the first process which currently creates the data to send to the second process and makes it available to the second process. The problem i'm having is that I don't exactly have a lot of experience with threads and events so I'm not sure of the best way to actually implement what I want to do. Following is a small snippet of what I have so far in the producer application; Rolling the dice and sending the data: case IDM_FILE_ROLLDICE: { hDiceRoll = CreateThread( NULL, // lpThreadAttributes (default) 0, // dwStackSize (default) ThreadFunc(hMainWindow), // lpStartAddress NULL, // lpParameter 0, // dwCreationFlags &hDiceID // lpThreadId (returned by function) ); } break; The data being sent to the other process: DWORD WINAPI ThreadFunc(LPVOID passedHandle) { HANDLE hMainHandle = *((HANDLE*)passedHandle); WCHAR buffer[256]; LPCTSTR pBuf; LPVOID lpMsgBuf; LPVOID lpDisplayBuf; struct diceData storage; HANDLE hMapFile; DWORD dw; //Roll dice and store results in variable storage = RollDice(); hMapFile = CreateFileMapping( (HANDLE)0xFFFFFFFF, // use paging file NULL, // default security PAGE_READWRITE, // read/write access 0, // maximum object size (high-order DWORD) BUF_SIZE, // maximum object size (low-order DWORD) szName); // name of mapping object if (hMapFile == NULL) { dw = GetLastError(); MessageBox(hMainHandle,L"Could not create file mapping object",L"Error",MB_OK); return 1; } pBuf = (LPTSTR) MapViewOfFile(hMapFile, // handle to map object FILE_MAP_ALL_ACCESS, // read/write permission 0, 0, BUF_SIZE); if (pBuf == NULL) { MessageBox(hMainHandle,L"Could not map view of file",L"Error",MB_OK); CloseHandle(hMapFile); return 1; } CopyMemory((PVOID)pBuf, &storage, (_tcslen(szMsg) * sizeof(TCHAR))); //_getch(); MessageBox(hMainHandle,L"Completed!",L"Success",MB_OK); UnmapViewOfFile(pBuf); return 0; } I'd like to think I am at least on the right lines, although for some reason when the application finishes creating the thread it hits the return DefWindowProc(hMainWindow, message, wParam, lParam); it crashes saying there's no more source code for the current location. I know there are certain ways to implement things but as I've mentioned I'm not sure if i'm doing this the right way, has anybody else tried to do the same thing? Thanks!

    Read the article

  • How does Sentry aggregate errors?

    - by Hugo Rodger-Brown
    I am using Sentry (in a django project), and I'd like to know how I can get the errors to aggregate properly. I am logging certain user actions as errors, so there is no underlying system exception, and am using the culprit attribute to set a friendly error name. The message is templated, and contains a common message ("User 'x' was unable to perform action because 'y'"), but is never exactly the same (different users, different conditions). Sentry clearly uses some set of attributes under the hood to determine whether to aggregate errors as the same exception, but despite having looked through the code, I can't work out how. Can anyone short-cut my having to dig further into the code and tell me what properties I need to set in order to manage aggregation as I would like? [UPDATE 1: event grouping] This line appears in sentry.models.Group: class Group(MessageBase): """ Aggregated message which summarizes a set of Events. """ ... class Meta: unique_together = (('project', 'logger', 'culprit', 'checksum'),) ... Which makes sense - project, logger and culprit I am setting at the moment - the problem is checksum. I will investigate further, however 'checksum' suggests that binary equivalence, which is never going to work - it must be possible to group instances of the same exception, with differenct attributes? [UPDATE 2: event checksums] The event checksum comes from the sentry.manager.get_checksum_from_event method: def get_checksum_from_event(event): for interface in event.interfaces.itervalues(): result = interface.get_hash() if result: hash = hashlib.md5() for r in result: hash.update(to_string(r)) return hash.hexdigest() return hashlib.md5(to_string(event.message)).hexdigest() Next stop - where do the event interfaces come from? [UPDATE 3: event interfaces] I have worked out that interfaces refer to the standard mechanism for describing data passed into sentry events, and that I am using the standard sentry.interfaces.Message and sentry.interfaces.User interfaces. Both of these will contain different data depending on the exception instance - and so a checksum will never match. Is there any way that I can exclude these from the checksum calculation? (Or at least the User interface value, as that has to be different - the Message interface value I could standardise.) [UPDATE 4: solution] Here are the two get_hash functions for the Message and User interfaces respectively: # sentry.interfaces.Message def get_hash(self): return [self.message] # sentry.interfaces.User def get_hash(self): return [] Looking at these two, only the Message.get_hash interface will return a value that is picked up by the get_checksum_for_event method, and so this is the one that will be returned (hashed etc.) The net effect of this is that the the checksum is evaluated on the message alone - which in theory means that I can standardise the message and keep the user definition unique. I've answered my own question here, but hopefully my investigation is of use to others having the same problem. (As an aside, I've also submitted a pull request against the Sentry documentation as part of this ;-)) (Note to anyone using / extending Sentry with custom interfaces - if you want to avoid your interface being use to group exceptions, return an empty list.)

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to assign WPF resources to other resource tags

    - by Tom
    This is quite obscure, I may just be missing something extremely simple. Scenario 1 Lets say I create a gradient brush, like this in my <Window.Resources> section: <LinearGradientBrush x:Key="GridRowSelectedBackBrushGradient" StartPoint="0,0" EndPoint="0,1"> <GradientStop Color="#404040" Offset="0.0" /> <GradientStop Color="#404040" Offset="0.5" /> <GradientStop Color="#000000" Offset="0.6" /> <GradientStop Color="#000000" Offset="1.0" /> </LinearGradientBrush> Then much later on, I want to override the HighlightBrushKey for a DataGrid. I have basically done it like this (horrible); <LinearGradientBrush x:Key="{x:Static SystemColors.HighlightBrushKey}" GradientStops="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=GradientStops}" StartPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=StartPoint}" EndPoint="{Binding Source={StaticResource GridRowSelectedBackBrushGradient}, Path=EndPoint}" /> This is obviously not the most slick way of referencing a resource. I also came up with the following problem, which is almost identical. Scenario 2 Say I created two colors in my <Window.Resources> markup, like so: <SolidColorBrush x:Key="DataGridRowBackgroundBrush" Color="#EAF2FB" /> <SolidColorBrush x:Key="DataGridRowBackgroundAltBrush" Color="#FFFFFF" /> Then later on, I want to supply them in an Array, which feeds the ConverterParameter on a Binding so I can supply the custom Converter with my static resource instances: <Setter Property="Background"> <Setter.Value> <Binding RelativeSource="{RelativeSource Mode=Self}" Converter="{StaticResource BackgroundBrushConverter}"> <Binding.ConverterParameter> <x:Array Type="{x:Type Brush}"> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundBrush}, Path=Color}" /> <SolidColorBrush Color="{Binding Source={StaticResource DataGridRowBackgroundAltBrush}, Path=Color}" /> </x:Array> </Binding.ConverterParameter> </Binding> </Setter.Value> </Setter> What I've done is attempt to rereference an existing resource, but in my efforts I've actually recreated the resource, and bound the properties so they match. Again, this is not ideal. Because I've now hit this problem at least twice, is there a better way? Thanks, Tom

    Read the article

  • Running OpenMPI on Windows XP

    - by iamweird
    Hi there. I'm trying to build a simple cluster based on Windows XP. I compiled OpenMPI-1.4.2 successfully, and tools like mpicc and ompi_info work too, but I can't get my mpirun working properly. The only output I can see is Z:\orterun --hostfile z:\hosts.txt -np 2 hostname [host0:04728] Failed to initialize COM library. Error code = -2147417850 [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\mca\ess\hnp\ess_hnp_module.c at line 218 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_plm_init failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\openmpi-1.4.2 \orte\runtime\orte_init.c at line 132 -------------------------------------------------------------------------- It looks like orte_init failed for some reason; your parallel process is likely to abort. There are many reasons that a parallel process can fail during orte_init; some of which are due to configuration or environment problems. This failure appears to be an internal failure; here's some additional information (which may only be relevant to an Open MPI developer): orte_ess_set_name failed -- Returned value Error (-1) instead of ORTE_SUCCESS -------------------------------------------------------------------------- [host0:04728] [[8946,0],0] ORTE_ERROR_LOG: Error in file ..\..\..\..\openmpi -1.4.2\orte\tools\orterun\orterun.c at line 543 Where z:\hosts.txt appears as follows: host0 host1 Z: is a shared network drive available to both host0 and host1. What my problem is and how do I fix it? Upd: Ok, this problem seems to be fixed. It seems to me that WideCap driver and/or software components causes this error to appear. A "clean" machine runs local task successfully. Anyway, I still cannot run a task within at least 2 machines, I'm getting following message: Z:\mpirun --hostfile z:\hosts.txt -np 2 hostname connecting to host1 username:cluster password:******** Save Credential?(Y/N) y [host0:04728] This feature hasn't been implemented yet. [host0:04728] Could not connect to namespace cimv2 on node host1. Error code =-2147024891 -------------------------------------------------------------------------- mpirun was unable to start the specified application as it encountered an error. More information may be available above. -------------------------------------------------------------------------- I googled a little and did all the things as described here: http://www.open-mpi.org/community/lists/users/2010/03/12355.php but I'm still getting the same error. Can anyone help me? Upd2: Error code -2147024891 might be WMI error WBEM_E_INVALID_PARAMETER (0x80041008) which occures when one of the parameters passed to the WMI call is not correct. Does this mean that the problem is in OpenMPI source code itself? Or maybe it's because of wrong/outdated wincred.h and credui.lib I used while building OpenMPI from the source code?

    Read the article

< Previous Page | 344 345 346 347 348 349 350 351 352 353 354 355  | Next Page >