Search Results

Search found 9217 results on 369 pages for 'cross apply'.

Page 35/369 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

  • MySQL cross table regular expression match

    - by Josef Sábl
    I have a web application and I am working on engine that analyzes referals. Now I have table with pageviews along with referes that looks something like this: pv_id referer ------------------------------------------------------------ 5531854534 http://www.google.com/search?ie=UTF-8... 8161876343 http://google.cn/search?search=human+rights 8468434831 http://search.yahoo.com/search;_... The second table contains sources definitions like: source regex ------------------------------------------------------------ Google ^https?:\/\/[^\/]*google\.([a-z]{2,4})(\/.*|)$ Yahoo ^https?:\/\/[^\/]*yahoo\.com(\/.*|)$ What I want is third table created by joinin these two: pv_id source ------------------------------------------------------------ 5531854534 Google 8161876343 Google 8468434831 Yahoo How to join these tables with regular expression?

    Read the article

  • Generate 2D cross-section polygon from 3D mesh

    - by nornagon
    I'm writing a game which uses 3D models to draw a scene (top-down orthographic projection), but a 2D physics engine to calculate response to collisions, etc. I have a few 3D assets for which I'd like to be able to automatically generate a hitbox by 'slicing' the 3D mesh with the X-Y plane and creating a polygon from the resultant edges. Google is failing me on this one (and not much helpful material on SO either). Suggestions?

    Read the article

  • Drupal administration theme doesn't apply to Blocks pages (admin/build/block)

    - by hfidgen
    A site I'm creating for a customer in D6 has various images overlaying parts of the main content area. It looks very pretty and they have to be there for the general effect. The problem is, if you use this theme in the administration pages, the images get in the way of everything. My solution was to create a custom admin theme, based on the default one, which has these image areas disabled in the output template files - page.tpl.php The problem is that when you try and edit the blocks page, it uses the default theme and half the blocks admin settings are unclickable behind the images. I KNOW this is by design in Drupal, but it's annoying the hell out of me and is edging towards "bug" rather than "feature" in my mind. It also appears that there is no way of getting around it. You can edit /modules/blocks/block.admin.inc to force Drupal to show the blocks page in the chosen admin theme. BUT whichever changes you then make will not be transferred to the default theme, as Drupal treats each theme separately and each theme can have different block layouts. :x function block_admin_display($theme = NULL) { global $custom_theme; // If non-default theme configuration has been selected, set the custom theme. // $custom_theme = isset($theme) ? $theme : variable_get('theme_default', 'garland'); // Display admin theme $custom_theme = variable_get('admin_theme', '0'); // Fetch and sort blocks $blocks = _block_rehash(); usort($blocks, '_block_compare'); return drupal_get_form('block_admin_display_form', $blocks, $theme); } Can anyone help? the only thing I can think of is to push the $content area well below the areas where the image appear and use blocks only for content display. Thanks!

    Read the article

  • how to apply group by on xslt elements

    - by Amit
    Hello All, I need to group the value based on some attribute and populate it. below mentioned is i/p xml and if you see there are 4 rows for Users and for id 2,4 Division is same i.e. HR while generating actual o/p I need to group by Division ... Any help ??? I/P XML <Users> <User id="2" name="ABC" Division="HR"/> <User id="3" name="xyz" Division="Admin"/> <User id="4" name="LMN" Division="Payroll"/> <User id="5" name="PQR" Division="HR"/> </Users> expected Result: I need to group the values based on Division and populate i.e. <AllUsers> <Division value="HR"> <User> <id>2</id> <name>ABC</name> </User> <User> <id>5</id> <name>PQR</name> </User> </Division> <Division value="ADMIN"> <User> <id>3</id> <name>XYZ</name> </User> </Division> <Division value="Payroll"> <User> <id>4</id> <name>LMN</name> </User> </Division> </AllUsers>

    Read the article

  • Apply PHP regex replace on a multi-line repeated pattern

    - by Hussain
    Let's say I have this input: I can haz a listz0rs! # 42 # 126 I can haz another list plox? # Hello, world! # Welcome! I want to split it so that each set of hash-started lines becomes a list: I can haz a listz0rs! <ul> <li>42</li> <li>126</li> </ul> I can haz another list plox? <ul> <li>Hello, world!</li> <li>Welcome!</li> </ul> If I run the input against the regex "/(?:(?:(?<=^# )(.*)$)+)/m", I get the following result: Array ( [0] => Array ( [0] => 42 ) [1] => Array ( [0] => 126 ) [2] => Array ( [0] => Hello, world! ) [3] => Array ( [0] => Welcome! ) ) This is fine and dandy, but it doesn't distinguish between the two different lists. I need a way to either make the quantifier return a concatenated string of all the occurrences, or, ideally, an array of all the occurrences. Ideally, this should be my output: Array ( [0] => Array ( [0] => 42 [1] => 126 ) [1] => Array ( [0] => Hello, world! [1] => Welcome! ) ) Is there any way of achieving this, and if not, is there a close alternative? Thanks in advance!

    Read the article

  • Ruby on Rails: What are Erubis' disadvantages and why isn't it packaged with Rails by default? How t

    - by williamjones
    I just discovered Erubis, a replacement for the default view renderer for Ruby on Rails. However, from what I can tell from reading about it, it's superior across the board. It is much faster. It has many more options. It can prevent cross site scripting without having to use h. Does this have any disadvantages versus the standard erb renderer? Why isn't this the standard renderer packaged with Rails? Also, the docs for Erubis say to install it just by installing the gem, and then add the following to environment.rb: require 'erubis/helpers/rails_helper' #Erubis::Helpers::RailsHelper.engine_class = Erubis::Eruby # or Erubis::FastEruby Reading the docs, FastEruby seems to be just a faster renderer than Eruby. Why wouldn't it be default and used by everyone? I'm highly interested in using the engine erubis::EscapedEruby which automatically calls h to escape html on fields from the database. Are there any gotchas I should be aware of or does this pretty much solve all cross site scripting?

    Read the article

  • Android Bluetooth Cross Platform Interoperability

    - by Philipp
    Hi, I have a Bluetooth service that I programmed for .Net on a Windows machine and I would like my Android 2.1 phone to connect to it. The server is listening for the same UUID which the Android is using to connect. But the connection is failing. When I try to connect to devices that are not listening for that UUID, I get an exception with the message "Service discovery failed", but when I try to connect to the server that is listening for the right UUID a message box pops up saying: "There was a problem pairing with bluetooth device." And I get an exception with the message "Connection timed out." So it looks like the server and the Android are communicating, but there is some sort of failure during handshaking. I know that the Android requires that the server is paired with the phone and also encrypts the communication channel. Does anyone know which specifications are used to do this? I would love to get my server to respond properly to the connection attempt. Thanks!

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How to apply Containstable 4 two join table?

    - by jaykanth
    product table pid modelnumber 1 a 2 b 3 c ProductTransation pid name description... 1 ball ball 2 bat cricket bat i create fullText for Modelnumber in product table. " for name & Description in productTrasaction table. Now i want to join this table if i search through modelnumber or name result should be pid name modelnumber 1 ball a

    Read the article

  • Is Accessing USB from web application for cross browser cross os possible at all ?

    - by Ved
    Hey Guys, I am wondering if there is anyway we can achieve this. I heard different things about Silverlight 4 , Java Script or Active X control but not seen any demo of code for any of them. Does anyone know any web component that is available or how to write one. We really like capture client's USB drive via Web and read/write data on it. This has to work for ANY Operating system in Any web browser. Thanks UPDATED What about WPF in browser mode...I read that I can host my wpf apps inside browser and sort of like smart client. Here is a great example of doing this via silverlight 4 but author mentions about possibility of accessing USB on MAC via 1) Enable executing AppleScripts. This option will let us have the same amount of control on a mac machine as we do on a windows machine. 2) Add an overload to ComAutomationFactory.CreateObject() that calls the “Tell Application” command under the scenes and gets a AppleScript object. This option would work extremely well for Office automation. For any other operating system feature, you’ll have to code OS access twice.  I did not quite understand it. Has any tried this ?

    Read the article

  • How to apply changes without access to svn server

    - by JoelFan
    We are using svn for development of a large web application, and we do periodic updates to production. The production server does not have access to svn (for security reasons). What is the best way to push the changes since the last production release for a new release? We would like to avoid re-creating the whole site each time, since it is very large.

    Read the article

  • SQL Server: Cross-tabulation, please help

    - by user335160
    I want to achieve the results shown in the attached image. The table structure and data are: Table relationship: Facility Limit -> one to many -> Facility Sub Limit Tables structure and data Facility Limit Id OverallIBLimitId Product Type 1 1 RPA 2 1 CG 3 2 RPA 4 3 CG Facility Sub Limit Id FacilityLimitId Sub-Limit Type Amount Tenor Status Status Date 1 1 RPA at max 2,000,0000.00 2 months Approved January 5, 2011 2 1 Oil 3,000,0000.00 3 yrs Approved January 5, 2011 3 2 CG at minor 4,000,0000.00 1 yr Approved January 5, 2011 4 2 CG at max 5,000,0000.00 6 months Approved January 5, 2011 5 2 Flood Component 1 5,000,0000.00 6 months Approved January 5, 2011 6 2 Flood Component 2 6,000,0000.00 3 yrs Approved January 5, 2011 7 3 RPA at minor 1,000,0000.00 6 months Approved January 5, 2011 8 4 One-Off 1,000,0000.00 6 months Approved January 5, 2011

    Read the article

  • Approaches for cross server content sharing?

    - by Anonymity
    I've currently been tasked with finding a best solution to serving up content on our new site from another one of our other sites. Several approaches suggested to me, that I've looked into include using SharePoint's Lists Web Service to grab the list through javascript - which results in XSS and is not an option. Another suggestion was to build a server side custom web service and use SharePoint Request Forms to get the information - this is something I've only very briefly looked at. It's been suggested that I try permitting the requesting site in the HTTP headers of the serving site since I have access to both. This ultimately resulted in a semi-working solution that had major security holes. (I had to include username/password in the request to appease AD Authentication). This was done by allowing Access-Control-Allow-Origin: * The most direct approach I could think of was to simply build in the webpart in our new environment to have the authors manually update this content the same as they would on the other site. Are any one of the suggestions here more valid than another? Which would be the best approach? Are there other suggestions I may be overlooking? I'm also not sure if WebCrawling or Content Scrapping really holds water here...

    Read the article

  • Potential problems porting to different architectures

    - by Brendan Long
    I'm writing a Linux program that currently compiles and works fine on x86 and x86_64, and now I'm wondering if there's anything special I'll need to do to make it work on other architectures. What I've heard is that for cross platform code I should: Don't assume anything about the size of a pointer, int or size_t Don't make assumptions about byte order (I don't do any bit shifting -- I assume gcc will optimize my power of two multiplication/division for me) Don't use assembly blocks (obvious) Make sure your libraries work (I'm using SQLite, libcurl and Boost, which all seem pretty cross-platform) Is there anything else I need to worry about? I'm not currently targeting any other architectures, but I expect to support ARM at some point, and I figure I might as well make it work on any architecture if I can. Also, regarding my second point about byte order, do I need to do anything special with text input? I read files with getline(), so it seems like that should be done automatically as well.

    Read the article

  • No data when attempting to get JSONP data from cross domain PHP script

    - by Alex
    I am trying to pull latitude and longitude values from another server on a different domain using a singe id string. I am not very familiar with JQuery, but it seems to be the easiest way to go about getting around the same origin problem. I am unable to use iframes and I cannot install PHP on the server running this javascript, which is forcing my hand on this. My queries appear to be going through properly, but I am not getting any results back. I was hoping someone here might have an idea that could help, seeing as I probably wouldn't recognize most obvious errors here. My javascript function is: var surl = "http://...omitted.../pull.php"; var idnum = 5a; //in practice this is defined above alert("BEFORE"); $.ajax({ url: surl, data: {id: idnum}, dataType: "jsonp", jsonp : "callback", jsonp: "jsonpcallback", success: function (rdata) { alert(rdata.lat + ", " + rdata.lon); } }); alert("BETWEEN"); function jsonpcallback(rtndata) { alert("CALLED"); alert(rtndata.lat + ", " + rtndata.lon); } alert("AFTER"); When my javascript is run, the BEFORE, BETWEEN and AFTER alerts are displayed. The CALLED and other jsonpcallback alerts are not shown. Is there another way to tell if the jsoncallback function has been called? Below is the PHP code I have running on the second server. I added the count table to my database just so that I can tell when this script is run. Every time I call the javascript, count has had an extra item inserted and the id number is correct. <?php header("content-type: application/json"); if (isset($_GET['id']) || isset($_POST['id'])){ $db_handle = mysql_connect($server, $username, $password); if (!$db_handle) { die('Could not connect: ' . mysql_error()); } $db_found = mysql_select_db($database, $db_handle); if ($db_found) { if (isset($_POST['id'])){ $SQL = sprintf("SELECT * FROM %s WHERE loc_id='%s'", $loctable, mysql_real_escape_string($_POST['id'])); } if (isset($_GET['id'])){ $SQL = sprintf("SELECT * FROM %s WHERE loc_id='%s'", $loctable, mysql_real_escape_string($_GET['id'])); } $result = mysql_query($SQL, $db_handle); $db_field = mysql_fetch_assoc($result); $rtnjsonobj -> lat = $db_field["lat"]; $rtnjsonobj -> lon = $db_field["lon"]; if (isset($_POST['id'])){ echo $_POST['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; } if (isset($_GET['id'])){ echo $_GET['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; } $SQL = sprintf("INSERT INTO count (bullshit) VALUES ('%s')", $_GET['id']); $result = mysql_query($SQL, $db_handle); $db_field = mysql_fetch_assoc($result); } mysql_close($db_handle); } else { $rtnjsonobj -> lat = 404; $rtnjsonobj -> lon = 404; echo $_GET['jsonpcallback']. '('. json_encode($rtnjsonobj) . ')'; }?> I am not entirely sure if the jsonp returned by this PHP is correct. When I go directly to the PHP script without including any parameters, I do get the following. ({"lat":404,"lon":404}) The callback function is not included, but that much can be expected when it isn't included in the original call. Does anyone have any idea what might be going wrong here? Thanks in advance!

    Read the article

  • how to apply filters in jsf

    - by johnbritto
    Hi I have filter code Page not Found error while any client request for Jsf Page in my Jsf application.I dont Know How to Fix this issue This is My Filter Code: HttpServletRequest req =(HttpServletRequest)request; HttpServletResponse res =(HttpServletResponse)response; HttpSession ses = req.getSession(true); String pageRequested =req.getRequestURL().toString(); if (ses.getAttribute("userDetails")!=null) { fc.doFilter(request,response); }else{ RequestDispatcher dis = request.getRequestDispatcher(LOGIN_PAGE); dis.forward(request,response); } This code inside the DoFilter Method I done all The settings in Web.xml deployment Descriptor

    Read the article

  • How to apply Abstract Factory Pattern ???

    - by Amit
    I am new to Design Pattern and I have a scenario here... and not sure as how to implement the pattern ... We have multiple vendors Philips, Onida... Each vendor (philips, onida...) may have different type of product i.e. Plasma or Normal TV I want specific product of each vendor using Abstract Factory Pattern... Thanks in advance for any help... My implementation so far... public enum TvType { Samsung = 0,LG = 1,Philips = 2, Sony = 3 } public enum Product { Plasma = 0,NormalTV = 1 } concrete class of each vendor.... that returns each product and also the interface that contains ProductInfo i.e. if Vendor is ... then it must have this product....

    Read the article

  • Drupal: how to apply plugins to modal lightbox content

    - by Patrick
    hi, I'm using a lightbox on a page of my website to display my nodes. I'm using some plugins such as an external simpletooltips plugin and the drupal plugin jQuery Media (to load flash video player for some video file-fields). All this stuff stop to work for the content of the lightbox, I guess because the content is not parsed... how can I solve this ? Should I trigger the plugins again ? Thanks

    Read the article

  • What is prefered stratigies for cross browser and multiple styled table in CSS

    - by jitendra
    in default css what should i predefined for <table>, td, th , thead, tbody, tfoot I have to work in a project there are so many tables with different color schemes and different type of alignment like in some table , i will need to horizontally align data of cell to right, sometime left, sometime right. same thing for vertical alignment, top, bottom and middle. some table will have thin border on row , some will have thick (same with column border). Some time i want to give different background color to particular row or column or in multiple row or column. So my question is: What code should i keep in css default for all tables and how to handle table with different style using ID and classes in multiple pages. I want to do every presentational thing with css. How to make ID classes for everything using semantic naming ? Which tags related to table can be useful?

    Read the article

  • Cross domain ajax POST ie7 with jquery

    - by DickieBoy
    been having trouble with this script, ive managed to get it working in ie8, works on chrome fine. initilize: function(){ $('#my_form').submit(function(){ if ($.browser.msie && window.XDomainRequest) { var data = $('#my_form').serialize(); xdr=new XDomainRequest(); function after_xhr_load() { response = $.parseJSON(xdr.responseText); if(response.number =="incorrect format"){ $('#errors').html('error'); } else { $('#errors').html('worked'); } } xdr.onload = after_xhr_load; xdr.open("POST",$('#my_form').attr('action')+".json"); xdr.send(data); } else { $.ajax({ type: "POST", url: $('#my_form').attr('action')+".json", data: $('#my_form').serialize(), dataType: "json", complete: function(data) { if(data.statusText =="OK"){ $('#errors').html('error'); } if(data.statusText =="Created"){ response = $.parseJSON(data.responseText); $('#errors').html('Here is your code:' +response.code); } } }); } return false; }); } I understand that ie7 does not have the XDomainRequest() object. How can I replicate this in ie7. Thanks, in advance

    Read the article

  • How to prepare a codebase for compiling on both Windows and Unix-based systems

    - by Max
    Hi! I am wondering about different solutions to easily compile my cross-platform application for both windows and unix. Right now I am using a makefile on Ubuntu, but before my codebase grows larger I'd like to perform the steps necessary to compile it on Windows, and then continue doing so regularly to see that it still works. I'd preferably not contaminate my SVN codebase repository with multiple "makefile" solutions, such as VC++ solutions and so on, I'd like a more automatic way. I tried using mingw with make for windows, but it seems my secondexpansion awesomeness doesn't work on the Windows version (or something like that). It wouldn't compile, and also complained about _winNT or something like that not being defined. How should I prepare my codebase for cross-platform easy compiling? Things like buildtools, perhaps autogenerate VS file from makefile, or something similar. Some preprocessor magic in a stdinc file perhaps? Thanks!

    Read the article

  • wordexp followed by strcpy = EXC_BAD_ACCESS + sharedlibrary apply-load-rules-all

    - by fyngyrz
    The implication is a memory problem. I have static allocations for these: char akdir[400]; char homedir[400]; This crashes on the first strcpy(): void setuplibfoo() { long ii; double x; wordexp_t result; // This obtains the user's home directory // -------------------------------------- homedir[0]=0; // in case wordexp fails switch (wordexp("~/",&result,0)) { case 0: // Successful. We'll fall into deallocate when done. { strcpy(homedir,result.we_wordv[0]); // <<--- CRASH! strcpy(akdir,homedir); strcat(akdir,"ak-plugins/"); vs_status(akdir); } case WRDE_NOSPACE: // If the error was WRDE_NOSPACE, then { // perhaps part of the result was allocated. wordfree (&result); } default: // all other errors do not require deallocation { break; } } ...additional code clipped.. doesn't get there on crash. This is in a shared library I've written that is linked to my application, also something I've written. In this case, it doesn't get very far, although if it starts, it's fine. ...I've read the wordexp docs several times; they say they allocate new objects, so you just set up that type and call them with the address. The switch error model is right from the wordexp docs: http://www.gnu.org/s/libc/manual/html_mono/libc.html#Wordexp-Example It doesn't always crash. Just sometimes, and just under 10.6. Never under 10.5 I'm building debug mode with XCode 3.1.1, under OSX 10.5.8 it seems to run ok, I've not seen a crash -- under 10.6, it crashes... sometimes. But always with that same exception, and always in the same place. The Google has it that this actually means, somehow, that it's too soon to allocate memory. But all the instances I could find were memory errors on the part of the programmer. Overruns, etc. And I can't find any docs on when it IS safe to allocate memory. Now, the path that expands there is nowhere near 400 characters. it's this (it it completes): /Users/flake/ak-plugins/ and this: /Users/flake/ ...if it doesn't. the strcpy... copies 2nd param to first. Theirs to mine. And it works! under 10.5. :/ So is wordexp broke? Is 10.6 broke? Am I cRaZy? Here's the debugger output: 0x00013446 <+0049> call 0xc98da <dyld_stub_wordexp> 0x0001344b <+0054> test %eax,%eax 0x0001344d <+0056> je 0x13454 <setuplibfoo+63> 0x0001344f <+0058> jmp 0x134da <setuplibfoo+197> 0x00013454 <+0063> mov -0x1c(%ebp),%eax 0x00013457 <+0066> mov (%eax),%eax 0x00013459 <+0068> mov %eax,0x4(%esp) 0x0001345d <+0072> lea 0xb6cc2(%ebx),%eax 0x00013463 <+0078> mov (%eax),%eax 0x00013465 <+0080> mov %eax,(%esp) 0x00013468 <+0083> call 0xc9898 <dyld_stub_strcpy> 0x0001346d <+0088> lea 0xb6cc2(%ebx),%eax <<--CRASH!

    Read the article

  • R problem with apply + rbind

    - by Carl
    I cannot seem to get the following to work directory <- "./" files.15x16 <- c("15x16-70d.out", "15x16-71d.out") data.15x16<-rbind( lapply( as.array(paste(directory, files.15x16, sep="")), FUN=read.csv, sep=" ", header=F) ) What it should be doing is pretty straightforward - I have a directory name, some file names, and actual files of data. I paste the directory and file names together, read the data from the files in, and then rbind them all together into a single chunk of data. Except the result of the lapply has the data in [[]] - i.e., accessing it occurs via a[[1]], a[[2]], etc which rbind doesn't seem to accept. Suggestions?

    Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >