Search Results

Search found 4517 results on 181 pages for 'mvvm light'.

Page 35/181 | < Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >

  • Pattern for sharing data between views (MVP or MVVM)

    - by Dovix
    What is a good pattern for sharing data between related views?. I have an application where 1 form contains many small views, each views behaves independently from each other more or less (they communicate/interact via an event bus). Every so often I need to pass the same objects to the child views. Sometimes I need this same object to be passed to a child view and then the child passes it onto another child itself contains. What is a good approach to sharing this data between all the views contained within the parent form (view) ? I have looked into CAB and their approach and every "view" has a "root work item" this work item has dictionary that contains a shared "state" between the views that are contained. Is this the best approach? just a shared dictionary all the views under a root view can access? My current approach right now is to have a function on the view that allows one to set the object for that view. Something like view.SetCustomer(Customer c); then if the view contains a child view it knows to set it on the child view ala: this.childview1.SetCustomer(c); The application is written in C# 3.5, for winforms using MVP with structure map as a IoC/DI provider.

    Read the article

  • Null Reference Exception on MVVM pattern

    - by Mohit Deshpande
    System.NullReferenceException Object reference not set to an instance of an object. at Microsoft.Windows.Design.DocumentModel.Trees.MarkupDocumentTreeManager.<FindMarkupNodePath>d__0.MoveNext() at System.Linq.Enumerable.FirstOrDefault[TSource](IEnumerable1 source) at MS.Internal.Services.DocumentInformationServiceImpl.get_Root() at MS.Internal.Designer.VSDesigner.Load() at MS.Internal.Designer.VSIsolatedDesigner.VSIsolatedView.Load() at MS.Internal.Designer.VSIsolatedDesigner.VSIsolatedDesignerFactory.Load(IsolatedView view) at MS.Internal.Host.Isolation.IsolatedDesigner.BootstrapProxy.LoadDesigner(IsolatedDesignerFactory factory, IsolatedView view) at MS.Internal.Host.Isolation.IsolatedDesigner.BootstrapProxy.LoadDesigner(IsolatedDesignerFactory factory, IsolatedView view) at MS.Internal.Host.Isolation.IsolatedDesigner.Load() at MS.Internal.Designer.DesignerPane.LoadDesignerView() I keep getting this exception and then intellisense stops working in a XAML text editor. Any ideas why?

    Read the article

  • how to profile silverlight mvvm application with a lot of custom controls

    - by tomo
    There is a quite big LOB silverlight application and we wrote a lot of custom controls which are rather heavy in drawing. All data is loaded by RIA service, processed and bound (using INofityPropertyChanged interface) to the view. The problem is that first drawing takes a lot time. Following calls to the service (server) and redrawing is quite fast. I used Equatec profiler to track the problem. I saw that processing takes a couple of miliseconds only so my idea is that the drawing by SL engine is slow. I'm wondering if it is possible to profile somehow processes inside SL to check which drawing operations are taking too much time. Are there any guidelines how to implement faster drawing of complex custom controls?

    Read the article

  • MVVM and Ribbon Command

    - by user312372
    I am trying to change the source property of the frame in Page1.xaml when the SampleCommand is excecuted. How do I acheive this in the View Model? Page1.xaml: <r:RibbonTab.Groups> <r:RibbonGroup GroupSizeDefinitions="{StaticResource RibbonLayout}"> <r:RibbonGroup.Command> <r:RibbonCommand LabelTitle="RibbonButton"/> </r:RibbonGroup.Command> <r:RibbonButton x:Name="RibbonButton1" Command="{Binding Path=SampleCommand}"/> </r:RibbonGroup> </r:RibbonTab.Groups> </r:RibbonTab> </r:Ribbon> <Border Name="PageBorder" Grid.Row="0" Grid.Column="1"> <Frame Name="pageFrame" Source="FirstPage.xaml" /> </Border> </DockPanel> c# Page1ViewModel.cs: RelayCommand _sampleCommand; public ICommand SampleCommand { get { // create command ?? return _sampleCommand } page1.xaml.cs : Page1ViewModel pageViewModel; this.DataContext = pageViewModel; // when pageloads

    Read the article

  • Help getting MVVM ViewModel to bind to the View

    - by cw
    Okay guys, I'm new to this model and Silverlight in general. I have the following code (changed object names, so syntax/spelling errors ignore). public class ViewModel { ViewModelSource m_vSource; public ViewModel(IViewModelSource source) { m_vSource= source; m_vSource.ItemArrived += new Action<Item>(m_vSource_ItemArrived); } void m_vSource_ItemArrived(Item obj) { Title = obj.Title; Subitems = obj.items; Description = obj.Description; } public void GetFeed(string serviceUrl) { m_vFeedSource.GetFeed(serviceUrl); } public string Title { get; set; } public IEnumerable<Subitems> Subitems { get; set; } public string Description { get; set; } } Here is the code I have in my page's codebehind. ViewModel m_vViewModel; public MainPage() { InitializeComponent(); m_vViewModel = new ViewModel(new ViewModelSource()); this.Loaded += new RoutedEventHandler(MainPage_Loaded); this.DataContext = m_vViewModel; } void MainPage_Loaded(object sender, RoutedEventArgs e) { m_vViewModel.GetItems("http://www.myserviceurl.com"); } Finally, here is a sample of what my xaml looks like. <!--TitleGrid is the name of the application and page title--> <Grid x:Name="TitleGrid" Grid.Row="0"> <TextBlock Text="My Super Title" x:Name="textBlockPageTitle" Style="{StaticResource PhoneTextPageTitle1Style}"/> <TextBlock Text="{Binding Path=Title}" x:Name="textBlockListTitle" Style="{StaticResource PhoneTextPageTitle2Style}"/> </Grid> I know I'm missing something, but I'm just not knowledgable enough which is why I'm asking you guys :) Is there anything I'm doing wrong here? Thanks!

    Read the article

  • Implementing auto-save in WPF / MVVM / NHibernate

    - by Echiban
    My client likes programs like Microsoft OneNote where changes are saved automatically, and he can choose to discard when he explicitly wants to do so. I will have to implement some undo functionality, but I'll figure that out some other time. With NHibernate, I suppose I can call ISession.Update on every single property / binding change, but I can see real pain with this approach down the road. I am not a fan of timers, but maybe a 5 second timer that starts on property / binding change and at timer end use BackgroundWorker thread to save to db. What do you think?

    Read the article

  • Public class DiscoLight help

    - by luvthug
    Hi All, If some one can point me in the right direction for this code for my assigment I would really appreciate it. I have pasted the whole code that I need to complete but I need help with the following method public void changeColour(Circle aCircle) which is meant to allow to change the colour of the circle randomly, if 0 comes the light of the circle sgould change to red, 1 for green and 2 for purple. public class DiscoLight { /* instance variables */ private Circle light; // simulates a circular disco light in the Shapes window private Random randomNumberGenerator; /** * Default constructor for objects of class DiscoLight */ public DiscoLight() { super(); this.randomNumberGenerator = new Random(); } /** * Returns a randomly generated int between 0 (inclusive) * and number (exclusive). For example if number is 6, * the method will return one of 0, 1, 2, 3, 4, or 5. */ public int getRandomInt(int number) { return this.randomNumberGenerator.nextInt(number); } /** * student to write code and comment here for setLight(Circle) for Q4(i) */ public void setLight(Circle aCircle) { this.light = aCircle; } /** * student to write code and comment here for getLight() for Q4(i) */ public Circle getLight() { return this.light; } /** * Sets the argument to have a diameter of 50, an xPos * of 122, a yPos of 162 and the colour GREEN. * The method then sets the receiver's instance variable * light, to the argument aCircle. */ public void addLight(Circle aCircle) { //Student to write code here, Q4(ii) this.light = aCircle; this.light.setDiameter(50); this.light.setXPos(122); this.light.setYPos(162); this.light.setColour(OUColour.GREEN); } /** * Randomly sets the colour of the instance variable * light to red, green, or purple. */ public void changeColour(Circle aCircle) { //student to write code here, Q4(iii) if (getRandomInt() == 0) { this.light.setColour(OUColour.RED); } if (this.getRandomInt().equals(1)) { this.light.setColour(OUColour.GREEN); } else if (this.getRandomInt().equals(2)) { this.light.setColour(OUColour.PURPLE); } } /** * Grows the diameter of the circle referenced by the * receiver's instance variable light, to the argument size. * The diameter is incremented in steps of 2, * the xPos and yPos are decremented in steps of 1 until the * diameter reaches the value given by size. * Between each step there is a random colour change. The message * delay(anInt) is used to slow down the graphical interface, as required. */ public void grow(int size) { //student to write code here, Q4(iv) } /** * Shrinks the diameter of the circle referenced by the * receiver's instance variable light, to the argument size. * The diameter is decremented in steps of 2, * the xPos and yPos are incremented in steps of 1 until the * diameter reaches the value given by size. * Between each step there is a random colour change. The message * delay(anInt) is used to slow down the graphical interface, as required. */ public void shrink(int size) { //student to write code here, Q4(v) } /** * Expands the diameter of the light by the amount given by * sizeIncrease (changing colour as it grows). * * The method then contracts the light until it reaches its * original size (changing colour as it shrinks). */ public void lightCycle(int sizeIncrease) { //student to write code here, Q4(vi) } /** * Prompts the user for number of growing and shrinking * cycles. Then prompts the user for the number of units * by which to increase the diameter of light. * Method then performs the requested growing and * shrinking cycles. */ public void runLight() { //student to write code here, Q4(vii) } /** * Causes execution to pause by time number of milliseconds */ private void delay(int time) { try { Thread.sleep(time); } catch (Exception e) { System.out.println(e); } } }

    Read the article

  • Binding between Usercontrol with listbox and parent control (MVVM)

    - by walkor
    I have a UserControl which contains a listbox and few buttons. <UserControl x:Class="ItemControls.ListBoxControl" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006"> <Grid> <ListBox:ExtendedListBox SelectionMode="Single" ItemsSource="{Binding LBItems}" Height="184"> <ListBox.ItemTemplate> <DataTemplate> <CheckBox Content="{Binding}"/> </DataTemplate> </ListBox.ItemTemplate> </ListBox> <Button Command="RemoveCommand"/> </Grid> </UserControl> And the code behind: public static readonly DependencyProperty RemoveCommandProperty = DependencyProperty.Register("RemoveCommand", typeof(ICommand), typeof(ListBoxControl), null); public ICommand RemoveCommand { get { return (ICommand)GetValue(RemoveCommandProperty); } set { SetValue(RemoveCommandProperty, value); } } public static readonly DependencyProperty LBItemsProperty = DependencyProperty.Register("LBItems", typeof(IEnumerable), typeof(ListBoxControl), null); public IEnumerable LBItems { get { return (IEnumerable)GetValue(LBItemsProperty); } set { SetValue(LBItemsProperty, value); } } I'm using this control in the view like this: <ItemControls:ListBoxControl Height="240" Width="350" LBItems="{Binding Items, Converter={StaticResource ItemsConverter}, Mode=TwoWay}" RemoveCommand="{Binding RemoveCommand}"/> The command works fine, though the listbox binding doesn't. My question is - WHY?

    Read the article

  • Concrete examples of state sharing between multiple viewmodels (WPF MVVM)

    - by JohnMetta
    I have a WPF/Entity Framework (4.0) project with many objects. I'd like to build the application so that that I can have object selection state shared across viewmodels. For Example: We have Cars, Drivers, Passengers, and Cargo classes. We also have UserControls for CarList, DriverList, etc. and editor windows for CarEditor, DriverEditor, etc. Furthermore, we have viewmodels for all of these (CarListViewModel, DriverListViewModel, CargoEditorViewModel, etc). This all composes a dockable interface where the user can have multiple object lists, editors, and viewers open. What I want is a concrete code example of how to wireup multiple viewmodels so that selecting a car in the CarList will cause that car to go live in the CarEditorView, but also be selected in any other view for which the context is valid (such as a DriverByCarView- or just DriverList if there is a filter predicate). There are a number of suggestions and discussions based on this question. The two methods that seem to dominate are: 3018307: Discusses state sharing by mentioning a messaging subsystem 1159035: Discusses state sharing by using an enclosing viewmodel Is one of these approaches better than the other? Does anyone have a concrete example of either/both of these methods in the form of a write-up or small code project? I'm still learning WPF, so pointers to entry points for reading API fundamentals are appreciated, but looking at code examples is where I usually go. Thanks In case anyone is interested, here are some other similar discussions: 3816961: Discusses returning multiple viewmodels depending on object type (i.e. a collection of arbitrary types adhering to a specific interface) 1928130: Discusses whether it is a good idea to aggregate viewmodels as properties of other viewmodels (e.g. a MainWindow viewmodel composed of panel viewmodels) 1120061: Essentially discusses whether to have use a viewmodel-per-model strategy or a viewmodel-per-view-element strategy. 4244222: Discusses whether or not to nest the viewmodels when using a nested object hierarchy. 4429708: Discusses sharing collections between viewmodels directly, but doesn't go into detail. List item: Discusses managing multiple selections within a single viewmodel.

    Read the article

  • Sample code and slides for my TechDays10 (Belgium) talks

    - by Laurent Bugnion
    The source code for my MVVM talk titled “Understanding the MVVM Pattern” given at TechDays 2010 in Antwerpen, Belgium, is available online. It is actually the same code than the MIX10 one, but I added the Windows Phone 7 MVVM Light application (available in the folder titled “Mix10.MvvmDemo2-End”. Note: before unpacking the zip file, you should right click on it, and select properties / Unblock. I also published the slides for my two talks: Understanding the MVVM Pattern A day in the life of a WPF/SL integrator As far as I know, the videos will be online soon, stay tuned and I will announce when it is the case. Get Started page for the MVVM Light Toolkit: http://www.galasoft.ch/mvvm/getstarted   Laurent Bugnion (GalaSoft) Subscribe | Twitter | Facebook | Flickr | LinkedIn

    Read the article

  • Oredev 2012: Summary and source code

    - by Laurent Bugnion
    This week, I had the pleasure to be invited to talk at Oredev, a really cool conference taking place in Malmo, Sweden. The whole event is awesome, including a very special dinner on Monday including sauna and swimming in a 6 degrees cold Baltic sea, and a reception with dinner at the town hall, including the mayor himself. Considering Malmo is a town of 300'000 inhabitants, it is a pretty nice occasion and the historical building itself is really worth seeing. For those interested, I placed my pictures on my Flickr account. I had a workshop on Tuesday morning about Windows 8 development with XAML/C#, and then a session on Wednesday about MVVM in Windows Phone 8 and Windows 8, of course using MVVM Light. I was very nervous because I reworked some of my demos as recently as this morning, in the wake of the Build conference last week and the release of both the Windows Phone SDK and MVVM Light V4.1. Everything went well however, and if I judge by the people I talked t after the talk, and Twitter, everything went pretty well. Before my talk on Tuesday, I had the pleasure to see a talk by Iris Classon (@irisclasson) on the challenges of being a "n00b" and a woman in software development. I especially appreciated her research and conclusions on the lack of women I our industry, a topic that is dear to my heart (because I want the best possible future for my two daughters, and also because I really enjoy working with women on projects, and getting a different insight on the art of software development. I really want to thank the excellent organization committee for their hard work and their fantastic welcome to Malmo. In particular Emily Holweck did a wonderful job and was super helpful throughout the preparation and the conference itself. I made a few pictures during my stay, all with the new Nokia Lumia 920, and hope you will enjoy them too. The source code and the slides… The source code is available for download from Skydrive. You will find the following: Windows 8 workshop slides. MVVM Applied slides Source code package with Win8Demo: The demo I built during the 4 hours workshop, with some light MVVM, web services (JSON), GridView, Design time data (Blend / Visual Studio designer), Bing maps integration, location sensor, Search pane integration. SemanticZoomSample: a sample I put together to demonstrate the SemanticZoom control, with two GridViews and of course full design time data for Blend work. Due to time constraints, I was not able to show this demo during the workshop, but I publish it anyway, hoping it will be useful to someone. PictureUploader: The demo I built during my 50 minutes session about MVVM Applied in Windows Phone 8 and Windows 8. Code sharing, design time data, MVVM Light are used in Windows Phone 8 and Windows 8 apps. And in video… You can also see the video of my MVVM talk thanks to the good services of the Oredev team! MVVM Applied in Windows Phone and Windows 8 from Øredev Conference on Vimeo.   Laurent Bugnion (GalaSoft) Subscribe | Twitter | Facebook | Flickr | LinkedIn

    Read the article

  • Find Search Replace from landmark to landmark - including everything in between

    - by Erick Tronboll
    Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

    Read the article

  • Menu bars are a basic light gray after installing graphics card driver. [closed]

    - by Jonathan
    Possible Duplicate: Desktop forgets theme? Hi, I've just installed Ubuntu 10.10 64-bit. It came up saying I could install 2 proprietary drivers, one for my WiFi adapter (which works perfectly) and one for my graphics card - a Sapphire AIT Radeon HD 5770 1024MB GDDR5 PCI-Express Graphics Card. The driver is called ATI/AMD proprietary FGLRX graphics driver. Before installing this driver I was unable to have Extra Visual Effects in Appearances. However after installing (and restarting) the menu bars are now in a basic light gray mode, rather than the sleek Ubuntu black. - Although Extra Visual Effects does now work. I've tried rebooting, and I've had a look around in ATI "Catalyst Control Center" but nothing has worked so far. Does anybody know what this windows mode is, how to change it back to normal and why it's doing it in the first place? Below is a screenshot of my computer: (This is also the first time I've installed Ubuntu on my computer, and am keen for it to work.)

    Read the article

  • how to access anti aliasing method of a font with CSS

    - by Daniel Ramirez-Escudero
    I've had this problem in a lot of different webs. You have a font which has different anti-aliasing options, the designer uses the same font with different anti-aliasing options on different parts of the text on the web. So there is a difference between some elements. In this case I have sharp, crisp, strong and smooth. I've used a font generator to get the code to access it via @font-face. Even so, I also have the original .otf if important to know. Is there a method to access this? I upload a picture of what I mean and my actual code: ![@font-face { font-family: 'light'; src: url('../_fnt/light/gothamrnd-light.eot'); src: url('../_fnt/light/gothamrnd-light.eot?#iefix') format('embedded-opentype'), url('../_fnt/light/gothamrnd-light.woff') format('woff'), url('../_fnt/light/gothamrnd-light.ttf') format('truetype'), url('../_fnt/light/gothamrnd-light.svg#../_fnt/light/gothamrnd-light') format('svg'); font-weight: normal; font-style: normal; }]![enter image description here][1]

    Read the article

  • how to center align a light box and hide a scrollbar.

    - by Mayur
    Hi All, I m web designer and getting problem in adjustment of light box. light box is not center aligned at any resolution. it should be center aligned at any resolution. and i used a black overlay for transparency in background but it shows scrollbars in light box so its not look good .... plz tell how could i center align a lightbox and hide a scrollbar .......... Thanks Mayur

    Read the article

  • #mvvmlight V4 update for Win8 RTM

    - by Laurent Bugnion
    With Windows 8 RTM out of the doors (at least for some of us), it was also time to create an update to MVVM Light. I selected the V4 RTM to do this (V4.0.23).This RTM version was released a few weeks ago with no much bells and whistles because I was just too busy to write much about it. Now after some vacation, I will resume blogging on all my favorite topics including of course MVVM Light. Upgrade Upgrading the installations should not require an ununistall, so try to simply run the MSI downloaded from the Download section at http://mvvmlight.codeplex.com/. Should you encounter any issue, try to uninstall the old version first following the steps at http://galasoft.ch/mvvm/cleaning/. Upgrading current apps from Win8 RP to Win8 RTM I didn’t recompile the assemblies of MVVM Light, so if you had a version running with V4.0.23 on Windows 8 RP, you should be able to use the same DLLs on Windows 8 RTM. If you were using earlier versions however, I would recommend doing an upgrade. I noticed a warning regarding the signing certificate. It is due to the PFX key which appears to be outdated after the upgrade to Windows 8 RTM. I solved this warning by replacing the old PFX key with a new one I copied from a new project. The warning did not cause the build to fail though. About MVVM Light V4 RTM The RTM is finalizing quite a lot of issues. The change log is available at http://galasoft.ch/mvvm/installing/changes/. There are some issues that are either still open or that popped up since then, and I am working on V4.1 to be released in the next few weeks. In addition to that, I have plans to support Windows Phone 8 (when it comes) and have a nice list of ideas for V5 with a few new components. Thanks again for your continuous support of MVVM Light! Laurent   Laurent Bugnion (GalaSoft) Subscribe | Twitter | Facebook | Flickr | LinkedIn

    Read the article

  • Why does my monitor have a black screen but the power light is blinking green?

    - by Chris Vesper
    I have a ViewSonic VA912b 19" display I use as a secondary monitor. When I turn it on, the power light is green for a few seconds, and then switches to blinking green. The display stays black. Windows thinks the monitor is on, as it shows up in the control panel as a second monitor. If I unplug the DVI cable, it displays a "No Signal" message and the power light goes to amber, which means it went to sleep.

    Read the article

  • Content light website and Google - Tell google it's a listings site (as opposed shop, reviews or restaurants)

    - by Doug Firr
    I have a listings style website. Due to the nature of this (listings) the site is content light. Each page is typically less that 50 words but there are many pages. The site in question has had a ton of media coverage and so has some great inbound links from places like Wired, Fast Company, Canada Broadcasting Corporation and many many other bloggers, media websites and recycle related niche authors (It's a recycling site). But Google really ignores it. Traffic from search is very very low - less than 5% of all traffic. I know that using markup you can tell Google whether your site is a restaurant, article, review, shop, local business and a few other categories (https://www.google.com/webmasters/markup-helper/u/0/). Is there a way to tell Google that my site is a listings site? I suspect, but do not know for sure, that part of the problem is that Google simply does not know what my site is? It's a crowdmap where people post curbalerts. The information is useful to people but it is presented in a short, concise way - a pin on a map, a picture and a short description. Adding anything further is not necessary for the site's intended purpose. 1st question - how best to tell the search engines what y site is - listings and not some spammy website? Any recommendations in improving our site's Search presence? You can take a look here if interested: http://tinyurl.com/lxg4hn7

    Read the article

  • Oracle bleibt auch 2011 Spitzenreiter im Bereich Datenbanken

    - by Anne Manke
    Mit der Veröffentlichung der aktuellen Ausgabe "Market Share: All Software Markets, Worldwide 2011" bestätigt das weltweit führende Marktanalyseunternehmen Gartner Oracle's Marktführerschaft im Bereich der Relationellen Datenbank Management Systeme (RDBMS). Oracle konnte innerhalb des letzten Jahres seinen Abstand zu seinen Marktbegleitern im Bereich der RDBMS mit einem stabilen Wachstum von 18% sogar ausbauen: der Marktanteil stieg im Jahr 2010 von 48,2% auf 48,8% im Jahr 2011. Damit ist der Abstand zu Oracle's stärkstem Verfolger IBM auf 28,6%.   Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} Revenue 2010 ($USM) Revenue 2011 ($USM) Growth 2010 Growth 2011 Share 2010 Share 2011 Oracle 9,990.5 11,787.0 10.9% 18.0% 48.2% 48.8% IBM 4,300.4 4,870.4 5.4% 13.3% 20.7% 20.2% Microsoft 3,641.2 4,098.9 10.1% 12.6% 17.6% 17.0% SAP/Sybase 744.4 1,101.1 12.8% 47.9% 3.6% 4.6% Teradata 754.7 882.3 16.9% 16.9% 3.6% 3.7% Source: Gartner’s “Market Share: All Software Markets, Worldwide 2011,” March 29, 2012, By Colleen Graham, Joanne Correia, David Coyle, Fabrizio Biscotti, Matthew Cheung, Ruggero Contu, Yanna Dharmasthira, Tom Eid, Chad Eschinger, Bianca Granetto, Hai Hong Swinehart, Sharon Mertz, Chris Pang, Asheesh Raina, Dan Sommer, Bhavish Sood, Marianne D'Aquila, Laurie Wurster and Jie Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4 /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Table Normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-qformat:yes; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin-top:0cm; mso-para-margin-right:0cm; mso-para-margin-bottom:12.0pt; mso-para-margin-left:0cm; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-fareast-font-family:"Times New Roman"; mso-fareast-theme-font:minor-fareast; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2 {mso-style-name:"Light List - Accent 2"; mso-tstyle-rowband-size:1; mso-tstyle-colband-size:1; mso-style-priority:61; mso-style-unhide:no; border:solid #C0504D 1.0pt; mso-border-themecolor:accent2; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:11.0pt; font-family:"Calibri","sans-serif"; mso-ascii-font-family:Calibri; mso-ascii-theme-font:minor-latin; mso-hansi-font-family:Calibri; mso-hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi;} table.MsoTableLightListAccent2FirstRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-shading:#C0504D; mso-tstyle-shading-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; color:white; mso-themecolor:background1; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:2.25pt double #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2; mso-para-margin-top:0cm; mso-para-margin-bottom:0cm; mso-para-margin-bottom:.0001pt; line-height:normal; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2FirstCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:first-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2LastCol {mso-style-name:"Light List - Accent 2"; mso-table-condition:last-column; mso-style-priority:61; mso-style-unhide:no; mso-ansi-font-weight:bold; mso-bidi-font-weight:bold;} table.MsoTableLightListAccent2OddColumn {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-column; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;} table.MsoTableLightListAccent2OddRow {mso-style-name:"Light List - Accent 2"; mso-table-condition:odd-row; mso-style-priority:61; mso-style-unhide:no; mso-tstyle-border-top:1.0pt solid #C0504D; mso-tstyle-border-top-themecolor:accent2; mso-tstyle-border-left:1.0pt solid #C0504D; mso-tstyle-border-left-themecolor:accent2; mso-tstyle-border-bottom:1.0pt solid #C0504D; mso-tstyle-border-bottom-themecolor:accent2; mso-tstyle-border-right:1.0pt solid #C0504D; mso-tstyle-border-right-themecolor:accent2;}

    Read the article

  • Video capture Performance

    - by volting
    I have noticed high CPU utilization in a number of applications (except mplayer) which read from the embedded webcam on my laptop. Bizarrely CPU utilization varies proportionately to the level of illumination present. I know that that high CPU usage has nothing to do with rendering the video, as I have written a simple app using the OpenCV library to simply grab frames from the webcam, and cpu usage is still high. I think that mplayer might be using my GPU (and the other apps aren't), but since its not an issue with rendering, I dont think this explains anything. Cheese Low light --- ~12% CPU Bright Light ---- ~63% CPU Camorama Low light --- ~7% CPU Bright Light ---- ~30% CPU Opencv C++ library, (display in a single highgui window) Low light --- ~13% CPU Bright Light ---- ~40% CPU (same test on windows 7, 4-9%) Mplayer No problem, 1-2% regardless of light levels Note: If all I want't to do is capture a feed from my webcam I would use mplayer and forget about it, but I'm developing an application which uses the OpenCV to capture a video feed among other things, performance is important.

    Read the article

  • Fixing the #mvvmlight code snippets in Visual Studio 11

    - by Laurent Bugnion
    If you installed the latest MVVM Light version for Windows 8, you may encounter an issue where code snippets are not displayed correctly in the Intellisense popup. I am working on a fix, but for now here is how you can solve the issue manually. The code snippets MVVM Light, when installed correctly, will install a set of code snippets that are very useful to allow you to type less code. As I use to say, code is where bugs are, so you want to type as little of that as possible ;) With code snippets, you can easily auto-insert segments of code and easily replace the keywords where needed. For instance, every coder who uses MVVM as his favorite UI pattern for XAML based development is used to the INotifyPropertyChanged implementation, and how boring it can be to type these “observable properties”. Obviously a good fix would be something like an “Observable” attribute, but that is not supported in the language or the framework for the moment. Another fix involves “IL weaving”, which is a post-build operation modifying the generate IL code and inserting the “RaisePropertyChanged” instruction. I admire the invention of those who developed that, but it feels a bit too much like magic to me. I prefer more “down to earth” solutions, and thus I use the code snippets. Fixing the issue Normally, you should see the code snippets in Intellisense when you position your cursor in a C# file and type mvvm. All MVVM Light snippets start with these 4 letters. Normal MVVM Light code snippets However, in Windows 8 CP, there is an issue that prevents them to appear correctly, so you won’t see them in the Intellisense windows. To restore that, follow the steps: In Visual Studio 11, open the menu Tools, Code Snippets Manager. In the combobox, select Visual C#. Press Add… Navigate to C:\Program Files (x86)\Laurent Bugnion (GalaSoft)\Mvvm Light Toolkit\SnippetsWin8 and select the CSharp folder. Press Select Folder. Press OK to close the Code Snippets Manager. Now if you type mvvm in a C# file, you should see the snippets in your Intellisense window. Cheers Laurent   Laurent Bugnion (GalaSoft) Subscribe | Twitter | Facebook | Flickr | LinkedIn

    Read the article

  • How to do directional per fragment lighting in world space?

    - by user
    I am attempting to create a GLSL shader for simple, per-fragment directional light. So far, after following many tutorials, I have continually ran into the issue: my light is specified in world coordinates, however, the shader treats the light's position as being in eye space, thus, the light direction changes when I move the camera. My question is, how to I transform a directional light position such as (50, 50, 50, 0) into eye space, or, would doing things this way be the incorrect approach to the problem?

    Read the article

  • How to call method written in C# class library from Silver light application(xaml.cs file) ?

    - by Shyju
    Can a xaml.cs file call the method in a c# class library ? I am trying to add a Silver light control to my Existing ASP.NET project where i used to add reference to my BL Project and acces methods of BL from My UI pages of ASP.NET Web application.Now i have added one Silver light project to my solution.How can i use the already existing BL method which is in a C# class library ? When tried to add reference, it is saying that "You can only add project reference to other silver light projects in the solution". Should i give up ? Is there any way to get rid of this ?

    Read the article

  • Silverlight beyond the basics

    - by Braulio Díez Botella
    Once I have learned the basics of Silverlight, I realized that there was still a lot to learn, architecture, patterns & practices, data access technologies… BUT… there’s plenty of material out there and few available time. I have compiled a set of articles/web casts / posts I found pretty useful for me, and defined a “learning roadmap”.   About the learning road map:    About the links: Basics MVVM Pattern: MSDN Magazine Basics RIA Services: RIA Services Intro RIA Services and Visual Studio 2010 MVVM + PRISM: MVVM + PRISM  MEF: MSDN Magazine RIA Services + MVVM: Mix10 RIA Services + MVVM + MEF: Shawn Wildermuth Series (1) Shawn Wildermuth Series (2) Shawn Wildermuth Series (3) Shawn Wildermuth Series (4) Some of them are based on Beta version of the products, but the core concepts are there and quite well explained. Please if you have other superb references add it on the comments section, hope to build a “version 2” of this post including or your feeback, thanks.

    Read the article

< Previous Page | 31 32 33 34 35 36 37 38 39 40 41 42  | Next Page >