Search Results

Search found 61241 results on 2450 pages for 'empty set'.

Page 350/2450 | < Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >

  • Fluent NHibernate Repository with subclasses

    - by reallyJim
    Having some difficulty understanding the best way to implement subclasses with a generic repository using Fluent NHibernate. I have a base class and two subclasses, say: public abstract class Person { public virtual int PersonId { get; set; } public virtual string FirstName { get; set; } public virtual string LastName { get; set; } } public class Student : Person { public virtual decimal GPA { get; set; } } public class Teacher : Person { public virtual decimal Salary { get; set; } } My Mappings are as follows: public class PersonMap : ClassMap { public PersonMap() { Table("Persons"); Id(x => x.PersonId).GeneratedBy.Identity(); Map(x => x.FirstName); Map(x => x.LastName); } } public class StudentMap : SubclassMap<Student> { public StudentMap() { Table("Students"); KeyColumn("PersonId"); Map(x => x.GPA); } } public class TeacherMap : SubclassMap<Teacher> { public TeacherMap() { Table("Teachers"); KeyColumn("PersonId"); Map(x => x.Salary); } } I use a generic repository to save/retreive/update the entities, and it works great--provided I'm working with Repository--where I already know that I'm working with students or working with teachers. The problem I run into is this: What happens when I have an ID, and need to determine the TYPE of person? If a user comes to my site as PersonId = 23, how do I go about figuring out which type of person it is?

    Read the article

  • Implementing sub fields in a PropertyGrid

    - by evolve
    Alright so my terminology when it comes to C# isn't great, so I'll attempt to explain this with a small example. If you create a class which you are using within a PropertyGrid and you have the following values: class Test { public Point example { get; set; } } This will produce a PropertyGrid which has an expandable object "example" which has fields X and Y in order to create a "Point". I'm attempting to create an object "name" which has fields "firstname" and "lastname", so I have: class Test { public Name example { get; set; } } public struct Name { public string firstname { get; set; } public string lastname { get; set; } } This however isn't working as intended. I think I need to override some method(s) in order to get this working, however since I don't really have the terminology down for PropertyGrids it is difficult for me to find a solution. Any help would be great.

    Read the article

  • AutoScaleMode.Inherit does not inherit

    - by codymanix
    I have a user control contained in a tabpage. The Form has set AutoScaleMode = AutoScaleMode.Font and the UserControl has set AutoScaleMode.Inherit. Now when I enlarge the font size of the form then the font is enlarged in the user control too, but the controls contents are not scaled. If I explicitly set AutoScaleMode.Font on the user control then it works properly. Shouldn't AutoScaleMode.Inherit work that way?

    Read the article

  • Shared Memory and Process Sempahores (IPC)

    - by fsdfa
    This is an extract from Advanced Liniux Programming: Semaphores continue to exist even after all processes using them have terminated. The last process to use a semaphore set must explicitly remove it to ensure that the operating system does not run out of semaphores.To do so, invoke semctl with the semaphore identifier, the number of semaphores in the set, IPC_RMID as the third argument, and any union semun value as the fourth argument (which is ignored).The effective user ID of the calling process must match that of the semaphore’s allocator (or the caller must be root). Unlike shared memory segments, removing a semaphore set causes Linux to deallocate immediately. If a process allocate a shared memory, and many process use it and never set to delete it (with shmctl), if all them terminate, then the shared page continues being available. (We can see this with ipcs). If some process did the shmctl, then when the last process deattached, then the system will deallocate the shared memory. So far so good (I guess, if not, correct me). What I dont understand from that quote I did, is that first it say: "Semaphores continue to exist even after all processes using them have terminated." and then: "Unlike shared memory segments, removing a semaphore set causes Linux to deallocate immediately."

    Read the article

  • What can cause a double page request?

    - by johnnietheblack
    I am currently investigating a double request problem on my site. Not all the time, but sometimes, a requested page will in fact load twice...which is not a problem really until it is on a page with PHP that inserts stuff into my db on request (my tracking script). I have read that an empty src in an image tag, and an empty url() in a css background could potentially cause the page to be requested twice. However, I can't find any problems with those. Is there anything else that could be causing something like this?

    Read the article

  • How to change SRID of geometry column?

    - by Z77
    I have table where the one of columns is geometry column the_geom for polygons with SRID. I added new column in the same table with exactly the same geometry data as in the_geom. This another column has name the_geom4258 because I want here to set up another SRID=4258. So what is the procedure to set up another SRID geometry to be changed (in another coord.system)? Is just enough to apply following query: UPDATE table SET the_geom4258=ST_SetSRID(the_geom4258,4258);

    Read the article

  • Gamepad Control for Processing + Android to Control Arduino Robot

    - by Iker
    I would like to create a Multitouch Gamepad control for Processing and use it to control a remote Arduino Robot. I would like to make the GUI on Processing and compile it for Android. Here is the GUI Gamepad for Processing I have created so far: float easing = 0.09; // start position int posX = 50; int posY = 200; // target position int targetX = 50; int targetY = 200; boolean dragging = false; void setup() { size(500,250); smooth(); } void draw() { background(255); if (!dragging) { // calculate the difference in position, apply easing and add to vx/vy float vx = (targetX - (posX)) * easing; float vy = (targetY - (posY)) * easing; // Add the velocity to the current position: make it move! posX += vx; posY += vy; } if(mousePressed) { dragging = true; posX = mouseX; posY = mouseY; } else { dragging = false; } DrawGamepad(); DrawButtons(); } void DrawGamepad() { //fill(0,155,155); //rect(0, 150, 100, 100, 15); ellipseMode(RADIUS); // Set ellipseMode to RADIUS fill(0,155,155); // Set fill to blue ellipse(50, 200, 50, 50); // Draw white ellipse using RADIUS mode ellipseMode(CENTER); // Set ellipseMode to CENTER fill(255); // Set fill to white// ellipse(posX, posY, 35, 35); // Draw gray ellipse using CENTER mode } void DrawButtons() { fill(0,155,155); // Set fill to blue ellipse(425, 225, 35, 35); ellipse(475, 225, 35, 35); fill(255,0,0); // Set fill to blue ellipse(425, 175, 35, 35); ellipse(475, 175, 35, 35); } I have realized that probably that code will not support Multitouch events on Android so I came up with another code found on this link Can Processing handle multi-touch? So the aim of this project is to create de multitouch gamepad to use to control my Arduino Robot. The gamepad should detect which key was pressed as well as the direction of the Joystick. Any help appreciated.

    Read the article

  • MPMoviePlayerController not setting the bounds for background image

    - by VXtreme
    I am using MPMoviePlayerController for playing the media . I want to set the image at the background of the player.The image is set accordingly but when i set the bounds for the image then the image is not set according to bounds . I have tried following code: UIImageView *imageView=[[UIImageView alloc]initWithImage:[operationControl getCoverImage:stringId]]; imageView.bounds=CGRectMake(0, 100, 200, 200); [moviePlayer.backgroundView addSubview:imageView]; [moviePlayer.backgroundView setBackgroundColor:[UIColor purpleColor]]; moviePlayer.controlStyle = MPMovieControlStyleDefault; moviePlayer.shouldAutoplay = YES; [moviePlayer setScalingMode:MPMovieScalingModeAspectFit]; [self.view addSubview:moviePlayer.view]; [moviePlayer setFullscreen:YES animated:YES];

    Read the article

  • asp:SqlDataSource binded to asp:DropDownList

    - by _simon_
    I have a asp:SqlDataSource and asp:DropDownList components on my page. On normal page it works ok. Now I'd like to put this on new page with url like ...mypage.aspx?transactionID=2. In Page_Load I would like to set Transaction drop down selected index to 2. But it always binds to 1. I assume, that things happen in this order: in Page_Load I set selected index to 2. Then asp:SqlDataSource's select statement executes and binds to DropDownList. That's why selected index of my DropDownList is always 1, no matter what I set it in Page_Load. So, how can I bind asp:SqlDataSource to asp:DropDownList and also set it's selected index parameter to some integer?

    Read the article

  • Vbscript - Object Required for DateLastModified

    - by Kenny Bones
    I don't really know what's wrong right here. I'm trying to create a vbscript that basically checks two Folders for their files and compare the DateLastModified attribute of each and then copies the source files to the destination folder if the DateLastModified of the source file is newer than the existing one. I have this code: Dim strSourceFolder, strDestFolder Dim fso, objFolder, colFiles strSourceFolder = "c:\users\user\desktop\Source\" strDestFolder = "c:\users\user\desktop\Dest\" Set fso = CreateObject("Scripting.FileSystemObject") Set objFolder = fso.GetFolder(strSourceFolder) Set colFiles = objFolder.Files For each objFile in colFiles Dim DateModified DateModified = objFile.DateLastModified ReplaceIfNewer objFile, DateModified, strSourceFolder, strDestFolder Next Sub ReplaceIfNewer (sourceFile, DateModified, SourceFolder, DestFolder) Const OVERWRITE_EXISTING = True Dim fso, objFolder, colFiles, sourceFileName, destFileName Dim DestDateModified, objDestFile Set fso = CreateObject("Scripting.FileSystemObject") sourceFileName = fso.GetFileName(sourceFile) destFileName = DestFolder & sourceFileName if fso.FileExists(destFileName) Then objDestFile = fso.GetFile(destFileName) DestDateModified = objDestFile.DateLastModified msgbox "File last modified: " & DateModified msgbox "New file last modified: " & DestDateModified End if End Sub And I get the error: On line 34, Char 3 "Object required: 'objDestFile' But objDestFile IS created?

    Read the article

  • UIScrollView Does not Scroll

    - by paul simmons
    I have added a long info screen to my iPhone app. The info is a long UIImageView, and it is contained inside a UIScrollView. They are both defined in .xib file. At run-time, initially I set scrollview's position outside window, and when user clicks a button, set its position inside window. This part is OK. But scrollview displays the image but does not scroll. Isn't it enough to place in MainViewContoller.xib, set the contained content, and (at code) set its contentSize equal to the content's size? BTW: I try it at simulator currently.

    Read the article

  • EF 4.0 Code only assocation from abstract to derived

    - by Jeroen
    Using EF 4.0 Code only i want to make an assocation between an abstract and normal class. I have class 'Item', 'ContentBase' and 'Test'. 'ContentBase' is abstract and 'Test' derives from it. 'ContentBase' has a property 'Item' that links to an instance of 'Item'. So that 'Test.Item' or any class that derives from 'ContentBase' has an 'Item' navigation property. In my DB every record for Test has a matching record for Item. public class Item { public int Id { get; set;} } public abstract class ContentBase { public int ContentId { get; set;} public int Id { get; set;} public Item Item { get; set;} } public class Test : ContentBase { public string Name { get; set;} } now some init code public void SomeInitFunction() { var itemConfig = new EntityConfiguration<Item>(); itemConfig.HasKey(p => p.Id); itemConfig.Property(p => p.Id).IsIdentity(); this.ContextBuilder.Configurations.Add(itemConfig); var testConfig = new EntityConfiguration<Test>(); testConfig.HasKey(p => p.ContentId); testConfig.Property(p => p.ContentId).IsIdentity(); // the problem testConfig.Relationship(p => p.Item).HasConstraint((p, q) => p.Id == q.Id); this.ContextBuilder.Configurations.Add(testConfig); } This gives an error: A key is registered for the derived type 'Test'. Keys must be registered for the root type 'ContentBase'. anyway i try i get an error. What am i a doing wrong?

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Pass Linq Expression to a function

    - by Kushan Hasithe Fernando
    I want to pass a property list of a class to a function. with in the function based on property list I'm going to generate a query. As exactly same functionality in Linq Select method. Here I'm gonna implement this for Ingress Database. As an example, in front end I wanna run a select as this, My Entity Class is like this public class Customer { [System.Data.Linq.Mapping.ColumnAttribute(Name="Id",IsPrimaryKey=true)] public string Id { get; set; } [System.Data.Linq.Mapping.ColumnAttribute(Name = "Name")] public string Name { get; set; } [System.Data.Linq.Mapping.ColumnAttribute(Name = "Address")] public string Address { get; set; } [System.Data.Linq.Mapping.ColumnAttribute(Name = "Email")] public string Email { get; set; } [System.Data.Linq.Mapping.ColumnAttribute(Name = "Mobile")] public string Mobile { get; set; } } I wanna call a Select function like this, var result = dataAccessService.Select<Customer>(C=>C.Name,C.Address); then,using result I can get the Name and Address properties' values. I think my Select function should looks like this, ( *I think this should done using Linq Expression. But im not sure what are the input parameter and return type. * ) Class DataAccessService { // I'm not sure about this return type and input types, generic types. public TResult Select<TSource,TResult>(Expression<Func<TSource,TResult>> selector) { // Here using the property list, // I can get the ColumnAttribute name value and I can generate a select query. } } This is a attempt to create a functionality like in Linq. But im not an expert in Linq Expressions. There is a project call DbLinq from MIT, but its a big project and still i couldn't grab anything helpful from that. Can someone please help me to start this, or can someone link me some useful resources to read about this.

    Read the article

  • Stored Procedure Does Not Fire Last Command

    - by jp2code
    On our SQL Server (Version 10.0.1600), I have a stored procedure that I wrote. It is not throwing any errors, and it is returning the correct values after making the insert in the database. However, the last command spSendEventNotificationEmail (which sends out email notifications) is not being run. I can run the spSendEventNotificationEmail script manually using the same data, and the notifications show up, so I know it works. Is there something wrong with how I call it in my stored procedure? [dbo].[spUpdateRequest](@packetID int, @statusID int output, @empID int, @mtf nVarChar(50)) AS BEGIN -- SET NOCOUNT ON added to prevent extra result sets from -- interfering with SELECT statements. SET NOCOUNT ON; DECLARE @id int SET @id=-1 -- Insert statements for procedure here SELECT A.ID, PacketID, StatusID INTO #act FROM Action A JOIN Request R ON (R.ID=A.RequestID) WHERE (PacketID=@packetID) AND (StatusID=@statusID) IF ((SELECT COUNT(ID) FROM #act)=0) BEGIN -- this statusID has not been entered. Continue SELECT ID, MTF INTO #req FROM Request WHERE PacketID=@packetID WHILE (0 < (SELECT COUNT(ID) FROM #req)) BEGIN SELECT TOP 1 @id=ID FROM #req INSERT INTO Action (RequestID, StatusID, EmpID, DateStamp) VALUES (@id, @statusID, @empID, GETDATE()) IF ((@mtf IS NOT NULL) AND (0 < LEN(RTRIM(@mtf)))) BEGIN UPDATE Request SET MTF=@mtf WHERE ID=@id END DELETE #req WHERE ID=@id END DROP TABLE #req SELECT @id=@@IDENTITY, @statusID=StatusID FROM Action SELECT TOP 1 @statusID=ID FROM Status WHERE (@statusID<ID) AND (-1 < Sequence) EXEC spSendEventNotificationEmail @packetID, @statusID, 'http:\\cpweb:8100\NextStep.aspx' END ELSE BEGIN SET @statusID = -1 END DROP TABLE #act END Idea of how the data tables are connected:

    Read the article

  • Trying to import SQL file in a xampp server returns error

    - by Victor_J_Martin
    I have done a ER diagram in Mysql Workbench, and I am trying load in my server with phpMyAdmin, but it returns me the next error: Error SQL Query: -- ----------------------------------------------------- -- Table `BDA`.`UG` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`UG` ( `numero_ug` INT NOT NULL, `nombre` VARCHAR(45) NOT NULL, `segunda_firma_autorizada` VARCHAR(45) NOT NULL, `fecha_creacion` DATE NOT NULL, `nombre_depto` VARCHAR(140) NOT NULL, `dni` INT NOT NULL, `anho_contable` INT NOT NULL, PRIMARY KEY (`numero_ug`), INDEX `nombre_depto_idx` (`nombre_depto` ASC), INDEX `dni_idx` (`dni` ASC), INDEX `anho_contable_idx` (`anho_contable` ASC), CONSTRAINT `nombre_depto` FOREIGN KEY (`nombre_depto`) REFERENCES `BDA`.`Departamento` (`nombre_depto`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `dni` FOREIGN KEY (`dni`) REFERENCES `BDA`.`Trabajador` (`dni`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `anho_contable` FOREIGN KEY (`anho_contable`) REFERENCES `BDA`.`Capitulo_Contable` (`anho_contable`) [...] MySQL said: Documentation #1022 - Can't write; duplicate key in table 'ug' I export the result of the diagram from Mysql Workbench to a SQL file, and this file is what I'm trying to upload. This is the file. I can not find the duplicate key. SET @OLD_UNIQUE_CHECKS=@@UNIQUE_CHECKS, UNIQUE_CHECKS=0; SET @OLD_FOREIGN_KEY_CHECKS=@@FOREIGN_KEY_CHECKS, FOREIGN_KEY_CHECKS=0; SET @OLD_SQL_MODE=@@SQL_MODE, SQL_MODE='TRADITIONAL,ALLOW_INVALID_DATES'; CREATE SCHEMA IF NOT EXISTS `BDA` DEFAULT CHARACTER SET utf8 COLLATE utf8_general_ci ; USE `BDA` ; -- ----------------------------------------------------- -- Table `BDA`.`Departamento` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Departamento` ( `nombre_depto` VARCHAR(140) NOT NULL, `area_depto` VARCHAR(140) NOT NULL, PRIMARY KEY (`nombre_depto`)) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Trabajador` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Trabajador` ( `dni` INT NOT NULL, `direccion` VARCHAR(140) NOT NULL, `nombre` VARCHAR(45) NOT NULL, `apellidos` VARCHAR(140) NOT NULL, `fecha_nacimiento` DATE NOT NULL, `fecha_contrato` DATE NOT NULL, `titulacion` VARCHAR(140) NULL, `nombre_depto` VARCHAR(45) NOT NULL, PRIMARY KEY (`dni`), INDEX `nombre_depto_idx` (`nombre_depto` ASC), CONSTRAINT `nombre_depto` FOREIGN KEY (`nombre_depto`) REFERENCES `BDA`.`Departamento` (`nombre_depto`) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Capitulo_Contable` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Capitulo_Contable` ( `anho_contable` INT NOT NULL, `numero_ug` INT NOT NULL, `debe` DOUBLE NOT NULL, `haber` DOUBLE NOT NULL, PRIMARY KEY (`anho_contable`), INDEX `numero_ug_idx` (`numero_ug` ASC), CONSTRAINT `numero_ug` FOREIGN KEY (`numero_ug`) REFERENCES `BDA`.`UG` (`numero_ug`) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`UG` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`UG` ( `numero_ug` INT NOT NULL, `nombre` VARCHAR(45) NOT NULL, `segunda_firma_autorizada` VARCHAR(45) NOT NULL, `fecha_creacion` DATE NOT NULL, `nombre_depto` VARCHAR(140) NOT NULL, `dni` INT NOT NULL, `anho_contable` INT NOT NULL, PRIMARY KEY (`numero_ug`), INDEX `nombre_depto_idx` (`nombre_depto` ASC), INDEX `dni_idx` (`dni` ASC), INDEX `anho_contable_idx` (`anho_contable` ASC), CONSTRAINT `nombre_depto` FOREIGN KEY (`nombre_depto`) REFERENCES `BDA`.`Departamento` (`nombre_depto`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `dni` FOREIGN KEY (`dni`) REFERENCES `BDA`.`Trabajador` (`dni`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `anho_contable` FOREIGN KEY (`anho_contable`) REFERENCES `BDA`.`Capitulo_Contable` (`anho_contable`) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Cliente` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Cliente` ( `cif_cliente` INT NOT NULL, `nombre_cliente` VARCHAR(140) NOT NULL, PRIMARY KEY (`cif_cliente`)) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Ingreso` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Ingreso` ( `id` INT NOT NULL, `concepto` VARCHAR(45) NOT NULL, `importe` DOUBLE NOT NULL, `fecha` DATE NOT NULL, `cif_cliente` INT NOT NULL, `numero_ug` INT NOT NULL, PRIMARY KEY (`id`), INDEX `cif_cliente_idx` (`cif_cliente` ASC), INDEX `numero_ug_idx` (`numero_ug` ASC), CONSTRAINT `cif_cliente` FOREIGN KEY (`cif_cliente`) REFERENCES `BDA`.`Cliente` (`cif_cliente`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `numero_ug` FOREIGN KEY (`numero_ug`) REFERENCES `BDA`.`UG` (`numero_ug`) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Proveedor` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Proveedor` ( `cif_proveedor` INT NOT NULL, `nombre_proveedor` VARCHAR(140) NOT NULL, PRIMARY KEY (`cif_proveedor`)) ENGINE = InnoDB; -- ----------------------------------------------------- -- Table `BDA`.`Gasto` -- ----------------------------------------------------- CREATE TABLE IF NOT EXISTS `BDA`.`Gasto` ( `id` INT NOT NULL, `concepto` VARCHAR(45) NOT NULL, `importe` DOUBLE NOT NULL, `fecha` DATE NOT NULL, `factura` INT NOT NULL, `cif_proveedor` INT NOT NULL, `numero_ug` INT NOT NULL, PRIMARY KEY (`id`), INDEX `cif_proveedor_idx` (`cif_proveedor` ASC), INDEX `numero_ug_idx` (`numero_ug` ASC), CONSTRAINT `cif_proveedor` FOREIGN KEY (`cif_proveedor`) REFERENCES `BDA`.`Proveedor` (`cif_proveedor`) ON DELETE NO ACTION ON UPDATE NO ACTION, CONSTRAINT `numero_ug` FOREIGN KEY (`numero_ug`) REFERENCES `BDA`.`UG` (`numero_ug`) ON DELETE NO ACTION ON UPDATE NO ACTION) ENGINE = InnoDB; SET SQL_MODE=@OLD_SQL_MODE; SET FOREIGN_KEY_CHECKS=@OLD_FOREIGN_KEY_CHECKS; SET UNIQUE_CHECKS=@OLD_UNIQUE_CHECKS; Thanks for your advices.

    Read the article

  • Exposing a service to external systems - How should I design the contract?

    - by Larsi
    Hi! I know this question is been asked before here but still I'm not sure what to select. My service will be called from many 3 party system in the enterprise. I'm almost sure the information the service will collect (MyBigClassWithAllInfo) will change during the products lifetime. Is it still a good idea to expose objects? This is basically what my two alternatives: [ServiceContract] public interface ICollectStuffService { [OperationContract] SetDataResponseMsg SetData(SetDataRequestMsg dataRequestMsg); } // Alternative 1: Put all data inside a xml file [DataContract] public class SetDataRequestMsg { [DataMember] public string Body { get; set; } [DataMember] public string OtherPropertiesThatMightBeHandy { get; set; } // ?? } // Alternative 2: Expose the objects [DataContract] public class SetDataRequestMsg { [DataMember] public Header Header { get; set; } [DataMember] public MyBigClassWithAllInfo ExposedObject { get; set; } } public class SetDataResponseMsg { [DataMember] public ServiceError Error { get; set; } } The xml file would look like this: <?xml version="1.0" encoding="utf-8"?> <Message>   <Header>     <InfoAboutTheSender>...</InfoAboutTheSender>   </Header>   <StuffToCollectWithAllTheInfo>   <stuff1>...</stuff1> </StuffToCollectWithAllTheInfo> </Message> Any thought on how this service should be implemented? Thanks Larsi

    Read the article

  • Rails more statements with ; doesnt work... :s

    - by user305270
    I have this code, but i cant make it work: images = Image.find_by_sql('PREPARE stmt FROM \' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6\'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit;') I got this error: Mysql::Error: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near 'SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit' at line 1: PREPARE stmt FROM ' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit; but if i use a sql app, like this, it works: PREPARE stmt FROM ' SELECT * FROM images AS i WHERE i.on_id = 1 AND i.on_type = "profile" ORDER BY i.updated_at LIMIT ?, 6'; SET @lower_limit := ((5 DIV 6) * 6); EXECUTE stmt USING @lower_limit;

    Read the article

  • Combining two UPDATE Commands - Performance ?

    - by Johannes
    If I want to update two rows in a MySQL table, using the following two command: UPDATE table SET Col = Value1 WHERE ID = ID1 UPDATE table SET Col = Value2 WHERE ID = ID2` I usually combine them into one command, so that I do not to have to contact the MySQL server twice from my C client: UPDATE table SET Col = IF( ID = ID1 , Value1 , Value2) WHERE ID=ID1 OR ID=ID2 Is this really a performance gain? Background Information: I am using a custom made fully C written high-performance heavily loaded webserver.

    Read the article

  • how to add special class for labels and errors on zend form elements?

    - by user1400
    hello how we could add a special class for labels and errors for a zend-form-element for example html output code before add classes <dt id="username-label"><label for="username" class="required">user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul class="errors"><li>Value is required and can't be empty</li></ul></dd> and code after we add classes <dt id="username-label"><label for="username" **class="req-username"**>user name:</label></dt> <dd id="username-element"> <input type="text" name="username" id="username" value="" class="input" /> <ul **class="err-username"**><li>Value is required and can't be empty</li></ul></dd> thanks

    Read the article

  • Internet Explorer 8 EmulateIE7 Mode not working

    - by Ryu
    I've set up IIS6 to send the following headers Custom Header Name: X-UA-Compatible Custom Header Value: IE=EmulateIE7 that supposed to force IE 8 into IE 7 Compatibility mode. You can read more about it on MSDN . I have noticed by looking in the Developer toolbar that if I have a DTD defined the document mode correctly gets set to IE 7, but the browser mode is IE 8. If the page doesn't have a DTD the document mode gets set to Quirks and Browser Mode once again IE 8. Am I doing something wrong. How do I force IE 8 to set IE 7 Browser mode. Thanks

    Read the article

  • Nhibernate Migration from 1.0.2.0 to 2.1.2 and many-to-one save problems

    - by Meska
    Hi, we have an old, big asp.net application with nhibernate, which we are extending and upgrading some parts of it. NHibernate that was used was pretty old ( 1.0.2.0), so we decided to upgrade to ( 2.1.2) for the new features. HBM files are generated through custom template with MyGeneration. Everything went quite smoothly, except for one thing. Lets say we have to objects Blog and Post. Blog can have many posts, so Post will have many-to-one relationship. Due to the way that this application operates, relationship is done not through primary keys, but through Blog.Reference column. Sample mapings and .cs files: <?xml version="1.0" encoding="utf-8" ?> <id name="Id" column="Id" type="Guid"> <generator class="assigned"/> </id> <property column="Reference" type="Int32" name="Reference" not-null="true" /> <property column="Name" type="String" name="Name" length="250" /> </class> <?xml version="1.0" encoding="utf-8" ?> <id name="Id" column="Id" type="Guid"> <generator class="assigned"/> </id> <property column="Reference" type="Int32" name="Reference" not-null="true" /> <property column="Name" type="String" name="Name" length="250" /> <many-to-one name="Blog" column="BlogId" class="SampleNamespace.BlogEntity,SampleNamespace" property-ref="Reference" /> </class> And class files class BlogEntity { public Guid Id { get; set; } public int Reference { get; set; } public string Name { get; set; } } class PostEntity { public Guid Id { get; set; } public int Reference { get; set; } public string Name { get; set; } public BlogEntity Blog { get; set; } } Now lets say that i have a Blog with Id 1D270C7B-090D-47E2-8CC5-A3D145838D9C and with Reference 1 In old nhibernate such thing was possible: //this Blog already exists in database BlogEntity blog = new BlogEntity(); blog.Id = Guid.Empty; blog.Reference = 1; //Reference is unique, so we can distinguish Blog by this field blog.Name = "My blog"; //this is new Post, that we are trying to insert PostEntity post = new PostEntity(); post.Id = Guid.NewGuid(); post.Name = "New post"; post.Reference = 1234; post.Blog = blog; session.Save(post); However, in new version, i get an exception that cannot insert NULL into Post.BlogId. As i understand, in old version, for nhibernate it was enough to have Blog.Reference field, and it could retrieve entity by that field, and attach it to PostEntity, and when saving PostEntity, everything would work correctly. And as i understand, new NHibernate tries only to retrieve by Blog.Id. How to solve this? I cannot change DB design, nor can i assign an Id to BlogEntity, as objects are out of my control (they come prefilled as generic "ojbects" like this from external source)

    Read the article

  • Subversion commit failed on Mac OS X with error "no such table: rep_cache"

    - by arun
    I created a subversion repository, imported an empty structure, checked out the repo, added a file to the working copy and tried commiting the working copy with the following commands: svnadmin create mysvn svn import -m "initial empty structure" test/ file:///tmp/mysvn svn co file:///tmp/mysvn mywc svn ci -m "test" The commit failed with the following error: Transmitting file data .svn: Commit failed (details follow): svn: While preparing '/tmp/mywc' for commit svn: no such table: rep_cache I am running Mac OS X 10.6.3 and subversion 1.6.5. Did I miss any steps or Mac specific commands? Thanks for your help.

    Read the article

  • NHibernate / Fluent - Mapping multiple objects to single lookup table

    - by Al
    Hi all I am struggling a little in getting my mapping right. What I have is a single self joined table of look up values of certain types. Each lookup can have a parent, which can be of a different type. For simplicities sake lets take the Country and State example. So the lookup table would look like this: Lookups Id Key Value LookupType ParentId - self joining to Id base class public class Lookup : BaseEntity { public Lookup() {} public Lookup(string key, string value) { Key = key; Value = value; } public virtual Lookup Parent { get; set; } [DomainSignature] [NotNullNotEmpty] public virtual LookupType LookupType { get; set; } [NotNullNotEmpty] public virtual string Key { get; set; } [NotNullNotEmpty] public virtual string Value { get; set; } } The lookup map public class LookupMap : IAutoMappingOverride<DBLookup> { public void Override(AutoMapping<Lookup> map) { map.Table("Lookups"); map.References(x => x.Parent, "ParentId").ForeignKey("Id"); map.DiscriminateSubClassesOnColumn<string>("LookupType").CustomType(typeof(LookupType)); } } BASE SubClass map for subclasses public class BaseLookupMap : SubclassMap where T : DBLookup { protected BaseLookupMap() { } protected BaseLookupMap(LookupType lookupType) { DiscriminatorValue(lookupType); Table("Lookups"); } } Example subclass map public class StateMap : BaseLookupMap<State> { protected StateMap() : base(LookupType.State) { } } Now I've almost got my mappings set, however the mapping is still expecting a table-per-class setup, so is expecting a 'State' table to exist with a reference to the states Id in the Lookup table. I hope this makes sense. This doesn't seem like an uncommon approach when wanting to keep lookup-type values configurable. Thanks in advance. Al

    Read the article

  • GtkLabel reset and GtkTextView max length

    - by stdio
    I've a NULL gtklabel. Upon the occurrence of an event, I set a text in this label (with gtk_label_set_text). How can I reset the gtklabel after the event (reset to NULL)? How can I set the max length (characters) of a GtkTextView? What's the easiest way to set the distance from the margin of a widget in a GtkTable?

    Read the article

< Previous Page | 346 347 348 349 350 351 352 353 354 355 356 357  | Next Page >