Search Results

Search found 19953 results on 799 pages for 'post get'.

Page 351/799 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • Linq Expression Trees in Compact Framework.

    - by Michal Drozdowicz
    The lack of expression trees in Compact Framework has bugged me for some time now, but I haven't really looked for a solution. Today, I've found a blog post about an alternative System.Linq.Expressions built on top of Mono System.Core and used e.g. by db4o (you can find it here). My question is - have you used this library and if so, what were your experiences with it (especially regarding performance)?

    Read the article

  • Ajax doesn't work on remote server .

    - by Nuha
    Hello . when I Implemented chatting Function , I use Ajax to send messages between file to another . so , it is working well on local host . but , when I upload it in to remote server it doesn't work. can U tell me ,why ? is an Ajax need Special configuration ? Ajax code : function Ajax_Send(GP,URL,PARAMETERS,RESPONSEFUNCTION){? var xmlhttp? try{xmlhttp=new ActiveXObject("Msxml2.XMLHTTP")}? catch(e){? try{xmlhttp=new ActiveXObject("Microsoft.XMLHTTP")}? catch(e){? try{xmlhttp=new XMLHttpRequest()}? catch(e){? alert("Your Browser Does Not Support AJAX")}}}? ? err=""? if (GP==undefined) err="GP "? if (URL==undefined) err +="URL "? if (PARAMETERS==undefined) err+="PARAMETERS"? if (err!=""){alert("Missing Identifier(s)\n\n"+err);return false;}? ? xmlhttp.onreadystatechange=function(){? if (xmlhttp.readyState == 4){? if (RESPONSEFUNCTION=="") return false;? eval(RESPONSEFUNCTION(xmlhttp.responseText))? }? }? ? if (GP=="GET"){? URL+="?"+PARAMETERS? xmlhttp.open("GET",URL,true)? xmlhttp.send(null)? }? ? if (GP="POST"){? PARAMETERS=encodeURI(PARAMETERS)? xmlhttp.open("POST",URL,true)? xmlhttp.setRequestHeader("Content-type", "application/x-www-form-urlencoded")? xmlhttp.setRequestHeader("Content-length",PARAMETERS.length)? xmlhttp.setRequestHeader("Connection", "close")? xmlhttp.send(PARAMETERS)? }? }

    Read the article

  • Error with my Android Application httpGet

    - by Coombes
    Basically I'm getting a strange issue with my Android application, it's supposed to grab a JSON Array and print out some values, the class looks like this: ShowComedianActivity.class package com.example.connecttest; public class ShowComedianActivity extends Activity{ TextView name; TextView add; TextView email; TextView tel; String id; // Progress Dialog private ProgressDialog pDialog; //JSON Parser class JSONParser jsonParser = new JSONParser(); // Single Comedian url private static final String url_comedian_details = "http://86.9.71.17/connect/get_comedian_details.php"; // JSON Node names private static final String TAG_SUCCESS = "success"; private static final String TAG_COMEDIAN = "comedian"; private static final String TAG_ID = "id"; private static final String TAG_NAME = "name"; private static final String TAG_ADDRESS = "address"; private static final String TAG_EMAIL = "email"; private static final String TAG_TEL = "tel"; public void onCreate(Bundle savedInstanceState){ super.onCreate(savedInstanceState); setContentView(R.layout.show_comedian); // Getting Comedian Details from intent Intent i = getIntent(); // Getting id from intent id = i.getStringExtra(TAG_ID); new GetComedianDetails().execute(); } class GetComedianDetails extends AsyncTask<String, String, String>{ protected void onPreExecute(){ super.onPreExecute(); pDialog = new ProgressDialog(ShowComedianActivity.this); pDialog.setMessage("Fetching Comedian details. Please wait..."); pDialog.setIndeterminate(false); pDialog.setCancelable(true); pDialog.show(); } @Override protected String doInBackground(String... params) { runOnUiThread(new Runnable(){ public void run(){ int success; try{ //Building parameters List<NameValuePair> params = new ArrayList<NameValuePair>(); params.add(new BasicNameValuePair("id",id)); // Getting comedian details via HTTP request // Uses a GET request JSONObject json = jsonParser.makeHttpRequest(url_comedian_details, "GET", params); // Check Log for json response Log.d("Single Comedian details", json.toString()); //JSON Success tag success = json.getInt(TAG_SUCCESS); if(success == 1){ // Succesfully received product details JSONArray comedianObj = json.getJSONArray(TAG_COMEDIAN); //JSON Array // get first comedian object from JSON Array JSONObject comedian = comedianObj.getJSONObject(0); // comedian with id found name = (TextView) findViewById(R.id.name); add = (TextView) findViewById(R.id.add); email = (TextView) findViewById(R.id.email); tel = (TextView) findViewById(R.id.tel); // Set text to details name.setText(comedian.getString(TAG_NAME)); add.setText(comedian.getString(TAG_ADDRESS)); email.setText(comedian.getString(TAG_EMAIL)); tel.setText(comedian.getString(TAG_TEL)); } } catch (JSONException e){ e.printStackTrace(); } } }); return null; } } } And my JSON Parser class looks like: package com.example.connecttest; public class JSONParser { static InputStream is = null; static JSONObject jObj = null; static String json = ""; // constructor public JSONParser() { } // function get json from url // by making HTTP POST or GET method public JSONObject makeHttpRequest(String url, String method, List<NameValuePair> params) { // Making HTTP request try { // check for request method if(method == "POST"){ // request method is POST // defaultHttpClient DefaultHttpClient httpClient = new DefaultHttpClient(); HttpPost httpPost = new HttpPost(url); httpPost.setEntity(new UrlEncodedFormEntity(params)); HttpResponse httpResponse = httpClient.execute(httpPost); HttpEntity httpEntity = httpResponse.getEntity(); is = httpEntity.getContent(); }else if(method == "GET"){ // request method is GET DefaultHttpClient httpClient = new DefaultHttpClient(); String paramString = URLEncodedUtils.format(params, "utf-8"); url += "?" + paramString; HttpGet httpGet = new HttpGet(url); HttpResponse httpResponse = httpClient.execute(httpGet); HttpEntity httpEntity = httpResponse.getEntity(); is = httpEntity.getContent(); } } catch (UnsupportedEncodingException e) { e.printStackTrace(); } catch (ClientProtocolException e) { e.printStackTrace(); } catch (IOException e) { e.printStackTrace(); } try { BufferedReader reader = new BufferedReader(new InputStreamReader( is, "iso-8859-1"), 8); StringBuilder sb = new StringBuilder(); String line = null; while ((line = reader.readLine()) != null) { sb.append(line + "\n"); } is.close(); json = sb.toString(); } catch (Exception e) { Log.e("Buffer Error", "Error converting result " + e.toString()); } // try parse the string to a JSON object try { jObj = new JSONObject(json); } catch (JSONException e) { Log.e("JSON Parser", "Error parsing data " + e.toString()); } // return JSON String return jObj; } } Now when I run a debug it's querying the correct address with ?id=1 on the end of the URL, and when I navigate to that url I get the following JSON Array: {"success":1,"comedian":[{"id":"1","name":"Michael Coombes","address":"5 Trevethenick Road","email":"[email protected]","tel":"xxxxxxxxxxxx"}]} However my app just crashes, the log-cat report looks like this: 03-22 02:05:02.140: E/Trace(3776): error opening trace file: No such file or directory (2) 03-22 02:05:04.590: E/AndroidRuntime(3776): FATAL EXCEPTION: main 03-22 02:05:04.590: E/AndroidRuntime(3776): android.os.NetworkOnMainThreadException 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.StrictMode$AndroidBlockGuardPolicy.onNetwork(StrictMode.java:1117) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.BlockGuardOs.connect(BlockGuardOs.java:84) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.IoBridge.connectErrno(IoBridge.java:127) 03-22 02:05:04.590: E/AndroidRuntime(3776): at libcore.io.IoBridge.connect(IoBridge.java:112) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:192) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.PlainSocketImpl.connect(PlainSocketImpl.java:459) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.net.Socket.connect(Socket.java:842) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.conn.scheme.PlainSocketFactory.connectSocket(PlainSocketFactory.java:119) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.DefaultClientConnectionOperator.openConnection(DefaultClientConnectionOperator.java:144) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.AbstractPoolEntry.open(AbstractPoolEntry.java:164) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.conn.AbstractPooledConnAdapter.open(AbstractPooledConnAdapter.java:119) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.DefaultRequestDirector.execute(DefaultRequestDirector.java:360) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:555) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:487) 03-22 02:05:04.590: E/AndroidRuntime(3776): at org.apache.http.impl.client.AbstractHttpClient.execute(AbstractHttpClient.java:465) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.example.connecttest.JSONParser.makeHttpRequest(JSONParser.java:62) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.example.connecttest.ShowComedianActivity$GetComedianDetails$1.run(ShowComedianActivity.java:89) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Handler.handleCallback(Handler.java:615) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Handler.dispatchMessage(Handler.java:92) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.os.Looper.loop(Looper.java:137) 03-22 02:05:04.590: E/AndroidRuntime(3776): at android.app.ActivityThread.main(ActivityThread.java:4745) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.lang.reflect.Method.invokeNative(Native Method) 03-22 02:05:04.590: E/AndroidRuntime(3776): at java.lang.reflect.Method.invoke(Method.java:511) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.android.internal.os.ZygoteInit$MethodAndArgsCaller.run(ZygoteInit.java:786) 03-22 02:05:04.590: E/AndroidRuntime(3776): at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:553) 03-22 02:05:04.590: E/AndroidRuntime(3776): at dalvik.system.NativeStart.main(Native Method) From this I'm guessing the error is in the jsonParser.makeHttpRequest however I can't for the life of me figure out what's going wrong and was hoping someone brighter than I could illuminate me.

    Read the article

  • How do I optimize this query?

    - by InnateDev
    SELECT DISTINCT wposts.* FROM wp_2_posts wposts, wp_2_postmeta wpostmeta, wp_2_postmeta wpostmeta1, wp_2_term_taxonomy, wp_2_terms, wp_2_term_relationships WHERE wposts.ID = wpostmeta.post_id AND wp_2_terms.term_id = '8' AND wp_2_term_taxonomy.term_id = wp_2_terms.term_id AND wp_2_term_taxonomy.term_taxonomy_id = wp_2_term_relationships.term_taxonomy_id AND wp_2_term_relationships.object_id = wposts.ID AND wpostmeta.meta_key = 'validity' AND wpostmeta.meta_value > '".$logic_date."' AND wpostmeta1.meta_key != 'permanent' AND wposts.post_status = 'publish' AND wposts.post_type = 'post' ORDER BY wposts.post_date DESC

    Read the article

  • Tuples vs. Anonymous Types vs. Expando object. (in regards to LINQ queries)

    - by punkouter
    I am a beginner who finally started understanding anonymous types. (see old post http://stackoverflow.com/questions/3010147/what-is-the-return-type-for-a-anonymous-linq-query-select-what-is-the-best-way-t) So in LINQ queries you form the type of return value you want within the linq query right? It seems the way to do this is anonymous type right? Can someone explain to me if and when I could use a Tuple/Expando object instead? They all seem very simliar?

    Read the article

  • Nesting forms in CakePHP

    - by Erik
    I am wondering if there's a way in CakePHP to nest multiple models in a form? What I'm trying to accomplish is to make a form for creating Posts that will also contain fields for adding Images (separate model) that will automatically be connected to the created post. Something similar to Ruby on Rails ** accept_nested_attributes_for**.

    Read the article

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • Variable disappears when I log in

    - by John
    Hello, I have profile page where the profile is retrieved via GET. The index file has this: $profile = $_GET['profile']; When I log in on the profile page, the $profile variable disappears. Here is the form action on the login function: <form name="login-form" id="login-form" method="post" action="./index.php"> (The $profile variable is separate of the login username.) How could I make the page retain the $profile variable? Thanks in advance, John

    Read the article

  • How to change the request IP in HttpWebRequest?

    - by holiveira
    I'm developing a website that will connect to a credit card processing gateway webservice. For security purposes this webservice accepts requests only from IP addresses that were previously informed to them. Since I'm developing locally, my IP changes almost every day. Is there a way for me to change the IP address of a HttpWebRequest so that I can test the Webservice calls locally? This webservice is accessed through a https address and the methods must be sent via POST.

    Read the article

  • Using preg_replace to replace all occurrences in php

    - by Greg-J
    Regex is absolutely my weak point and this one has me completely stumped. I am building a fairly basic search functionality and I need to be able to alter my user input based on the following pattern: Subject: %22first set%22 %22second set%22-drupal -wordpress Desired output: +"first set" +"second set" -drupal -wordpress I wish I could be more help as I normally like to at least post the solution I have so far, but on this one I'm at a loss. Any help is appreciated. Thank you.

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • html5 uploader + jquery drag & drop: how to store file data with FormData?

    - by lauthiamkok
    I am making a html5 drag and drop uploader with jquery, below is my code so far, the problem is that I get an empty array without any data. Is this line incorrect to store the file data - fd.append('file', $thisfile);? $('#div').on( 'dragover', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'dragenter', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'drop', function(e){ if(e.originalEvent.dataTransfer){ if(e.originalEvent.dataTransfer.files.length) { e.preventDefault(); e.stopPropagation(); // The file list. var fileList = e.originalEvent.dataTransfer.files; //console.log(fileList); // Loop the ajax post. for (var i = 0; i < fileList.length; i++) { var $thisfile = fileList[i]; console.log($thisfile); // HTML5 form data object. var fd = new FormData(); //console.log(fd); fd.append('file', $thisfile); /* var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }) */ $.ajax({ url: "upload.php", type: "POST", data: fd, processData: false, contentType: false, success: function(response) { // .. do something }, error: function(jqXHR, textStatus, errorMessage) { console.log(errorMessage); // Optional } }); } /*UPLOAD FILES HERE*/ upload(e.originalEvent.dataTransfer.files); } } } ); function upload(files){ console.log('Upload '+files.length+' File(s).'); }; then if I use another method is that to make the file data into an array inside the jquery code, var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }); but where is the tmp_name data inside e.originalEvent.dataTransfer.files[i]? php, print_r($_POST); $uploaddir = './uploads/'; $file = $uploaddir . basename($_POST['file']['name']); if (move_uploaded_file($_POST['file']['tmp_name'], $file)) { echo "success"; } else { echo "error"; } as you can see that tmp_name is needed to upload the file via php... html, <div id="div">Drop here</div>

    Read the article

  • how to write a script that logs into an application and checks a page

    - by josh
    Is it possible to write a script that will login to an application using uname/pwd? the username/password are not passed in through POST (they dont come in the URL) Basic steps I am looking for are: Visit url enter uname/pwd click a button click a link get the raw html to make sure it does not have 500 error Is that possible to do in any language? Please point me to some examples as well

    Read the article

  • Need help helping in converting jquery, ajax, json and asp.net

    - by Haja Mohaideen
    I am tying out this tutorial, http://www.ezzylearning.com/tutorial.aspx?tid=5869127. It works perfectly. What I am now trying to do is to host the aspx contents as html file. This html file is hosted on my wampserver which is on my laptop. The asp.net code hosted on my test server. When I try to access, I get the following error, Resource interpreted as Script but transferred with MIME type text/html: "http://201.x.x.x/testAjax/Default.aspx/AddProductToCart?callback=jQuery17103264484549872577_1346923699990&{%20pID:%20%226765%22,%20qty:%20%22100%22,%20lblType:%20%2220%22%20}&_=1346923704482". jquery.min.js:4 Uncaught SyntaxError: Unexpected token < I am not sure how to solve this problem. index.html code $(function () { $('#btnAddToCart').click(function () { var result = $.ajax({ type: "POST", url: "http://202.161.45.124/testAjax/Default.aspx/AddProductToCart", crossDomain: true, data: '{ pID: "6765", qty: "100", lblType: "20" }', contentType: "application/json; charset=utf-8", dataType: "jsonp", success: succeeded, failure: function (msg) { alert(msg); }, error: function (xhr, err) { alert(err); } }); }); }); function succeeded(msg) { alert(msg.d); } function btnAddToCart_onclick() { } </script> </head> <body> <form name="form1" method="post"> <div> <input type="button" id="btnAddToCart" onclick="return btnAddToCart_onclick()" value="Button" /> </div> </form> aspx.vb Imports System.Web.Services Imports System.Web.Script.Services <ScriptService()> Public Class WebForm1 Inherits Page Protected Sub Page_Load(ByVal sender As Object, ByVal e As System.EventArgs) Handles Me.Load Session("test") = "" End Sub <WebMethod()> <ScriptMethod(UseHttpGet:=False, ResponseFormat:=ResponseFormat.Json)> Public Shared Function AddProductToCart(pID As String, qty As String, lblType As String) As String Dim selectedProduct As String = String.Format("+ {0} - {1} - {2}", pID, qty, lblType) HttpContext.Current.Session("test") += selectedProduct Return HttpContext.Current.Session("test").ToString() End Function End Class

    Read the article

  • iis 7.0 Internal 500 Error

    - by bill
    Hi All, i am tearing my hair out. I have read every post on the internet and cannot for the life of me figure out HOW to force IIS 7.0 on 2008 to display detailed errors. I have published a .net 4.0 app. i am at a complete loss. thanks!

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

  • Question about ITextUndoHistory returned from TryGetHistory

    - by nick.ueda
    Everytime the IWpfTextView's TextBuffer changes I am trying to get the history's redostack and undostack and simply checking the count. When doing this I am encountering a "Method not supported exception" when trying to access the two stacks. Am I retrieving the history incorrectly or does VS not want me seeing/editing the contents of the stacks? I can post the code if necessary... Thanks, Nick

    Read the article

  • How to get to apple iphone discussion forums?

    - by wolverine
    I logged into my account and is reaching this page. http://developer.apple.com/devforums/ After that when i click login and give the details, it redirects to the same page. Where can I see the discussions and post questions? I know its a simple question but dont know what I am missing here.

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >