Search Results

Search found 19953 results on 799 pages for 'post get'.

Page 351/799 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • get fbml comments to automatically show form

    - by Cek
    I'm writing facebook app in fbml (not in iframe). I added comments with <fb:comments ...> and it appears to work. However, to add a comment, user has to click Add a comment... link to see the textarea and post button. I am wondering is there a way to automatically show the form? I want it to really look like here: developers.facebook.com/docs/reference/plugins/comments (with or without the like button)

    Read the article

  • Is DevTeach worth the cost?

    - by Mafuba
    Wondering if people who have attended DevTeach could comment on the value of the conference (e.g. well-organized, good sessions, good material, etc.). This post seems to indicate that it is not worth the money.

    Read the article

  • Using preg_replace to replace all occurrences in php

    - by Greg-J
    Regex is absolutely my weak point and this one has me completely stumped. I am building a fairly basic search functionality and I need to be able to alter my user input based on the following pattern: Subject: %22first set%22 %22second set%22-drupal -wordpress Desired output: +"first set" +"second set" -drupal -wordpress I wish I could be more help as I normally like to at least post the solution I have so far, but on this one I'm at a loss. Any help is appreciated. Thank you.

    Read the article

  • Disqus: change captions after success with jQuery

    - by andufo
    Hi, Disqus automatically places defined captions upon request. For example: Add new Comment I've tried to change its value with jquery on ready(): $('#dsq-new-post h3').text('Paticipa con tu cuenta favorita'); No success :( ... how can i know when disqus script is finished parsing the data so i can change the caption value of h3?

    Read the article

  • How do I optimize this query?

    - by InnateDev
    SELECT DISTINCT wposts.* FROM wp_2_posts wposts, wp_2_postmeta wpostmeta, wp_2_postmeta wpostmeta1, wp_2_term_taxonomy, wp_2_terms, wp_2_term_relationships WHERE wposts.ID = wpostmeta.post_id AND wp_2_terms.term_id = '8' AND wp_2_term_taxonomy.term_id = wp_2_terms.term_id AND wp_2_term_taxonomy.term_taxonomy_id = wp_2_term_relationships.term_taxonomy_id AND wp_2_term_relationships.object_id = wposts.ID AND wpostmeta.meta_key = 'validity' AND wpostmeta.meta_value > '".$logic_date."' AND wpostmeta1.meta_key != 'permanent' AND wposts.post_status = 'publish' AND wposts.post_type = 'post' ORDER BY wposts.post_date DESC

    Read the article

  • symbols in command line argument.. python, bash

    - by Idlecool
    Hi, I am writing a python script on Linux for twitter post using API, Is it possible to pass symbols like "(" ")" etc in clear text without apostrophes.... % ./twitterupdate this is me #works fine % ./twitterupdate this is bad :(( #this leaves a error on bash. Is the only alternative is to enclose the text into -- "" ?? like.. % ./twitterupdate "this is bad :((" #this will reduce the ease of use for the script Is there any workaround?

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

  • Tuples vs. Anonymous Types vs. Expando object. (in regards to LINQ queries)

    - by punkouter
    I am a beginner who finally started understanding anonymous types. (see old post http://stackoverflow.com/questions/3010147/what-is-the-return-type-for-a-anonymous-linq-query-select-what-is-the-best-way-t) So in LINQ queries you form the type of return value you want within the linq query right? It seems the way to do this is anonymous type right? Can someone explain to me if and when I could use a Tuple/Expando object instead? They all seem very simliar?

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • Question about ITextUndoHistory returned from TryGetHistory

    - by nick.ueda
    Everytime the IWpfTextView's TextBuffer changes I am trying to get the history's redostack and undostack and simply checking the count. When doing this I am encountering a "Method not supported exception" when trying to access the two stacks. Am I retrieving the history incorrectly or does VS not want me seeing/editing the contents of the stacks? I can post the code if necessary... Thanks, Nick

    Read the article

  • html5 uploader + jquery drag & drop: how to store file data with FormData?

    - by lauthiamkok
    I am making a html5 drag and drop uploader with jquery, below is my code so far, the problem is that I get an empty array without any data. Is this line incorrect to store the file data - fd.append('file', $thisfile);? $('#div').on( 'dragover', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'dragenter', function(e) { e.preventDefault(); e.stopPropagation(); } ); $('#div').on( 'drop', function(e){ if(e.originalEvent.dataTransfer){ if(e.originalEvent.dataTransfer.files.length) { e.preventDefault(); e.stopPropagation(); // The file list. var fileList = e.originalEvent.dataTransfer.files; //console.log(fileList); // Loop the ajax post. for (var i = 0; i < fileList.length; i++) { var $thisfile = fileList[i]; console.log($thisfile); // HTML5 form data object. var fd = new FormData(); //console.log(fd); fd.append('file', $thisfile); /* var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }) */ $.ajax({ url: "upload.php", type: "POST", data: fd, processData: false, contentType: false, success: function(response) { // .. do something }, error: function(jqXHR, textStatus, errorMessage) { console.log(errorMessage); // Optional } }); } /*UPLOAD FILES HERE*/ upload(e.originalEvent.dataTransfer.files); } } } ); function upload(files){ console.log('Upload '+files.length+' File(s).'); }; then if I use another method is that to make the file data into an array inside the jquery code, var file = {name: fileList[i].name, type: fileList[i].type, size:fileList[i].size}; $.each(file, function(key, value) { fd.append('file['+key+']', value); }); but where is the tmp_name data inside e.originalEvent.dataTransfer.files[i]? php, print_r($_POST); $uploaddir = './uploads/'; $file = $uploaddir . basename($_POST['file']['name']); if (move_uploaded_file($_POST['file']['tmp_name'], $file)) { echo "success"; } else { echo "error"; } as you can see that tmp_name is needed to upload the file via php... html, <div id="div">Drop here</div>

    Read the article

  • Variable disappears when I log in

    - by John
    Hello, I have profile page where the profile is retrieved via GET. The index file has this: $profile = $_GET['profile']; When I log in on the profile page, the $profile variable disappears. Here is the form action on the login function: <form name="login-form" id="login-form" method="post" action="./index.php"> (The $profile variable is separate of the login username.) How could I make the page retain the $profile variable? Thanks in advance, John

    Read the article

  • jQuery mobile ajax login form authentication

    - by Jakub Zak
    I know i already asked simillar question, but now when I work with jQuery Mobile I can't figure it out. So I have this form: <div data-role="page" data-theme="a" id="login_page"> <div data-role="header" data-position="fixed"> <h1>****</h1> </div> <div data-role="content"> <form id="login_form" method="POST" data-ajax="false"> <label for="basic">Username:</label> <input type="text" name="name" id="username" value=""/> <label for="basic">Password:</label> <input type="password" name="password" id="password" value=""/> <input type="submit" value="Login" id="login" name="login"/> </form> </div> <div data-role="footer" data-position="fixed"> <div data-role="navbar"></div> </div> </div> And I need to submit Username and Password to php script, where php replies and send "success" or "failed". Here is php: <?php session_start(); $username = $_POST["name"]; $password = $_POST["password"]; include('mysql_connection.php'); mysql_select_db("jzperson_imesUsers", $con); $res1 = mysql_query("SELECT * FROM temp_login WHERE username='$username' AND password='$password'"); $count=mysql_num_rows($res1); if($count==1){ echo "success"; }else{ echo "failed"; } ?> And to do all this I want to use this script: $(document).ready(function() { $("form").submit(function(){ $.mobile.showPageLoadingMsg(); $.ajax({ url: "http://imes.jzpersonal.com/login_control.php", type: "POST", dataType: "jsonp", jsonp: "jsoncallback", data: $("form#login_form").serialize(), success: function( response ){ $.mobile.changePage( "http://imes.jzpersonal.com/user_panel.html"); } }); return false; }); }); But I can't make it work, I know I must have mistakes in there, I just can't find them, or better way to do it. Thank you in advance for any help.

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • How to change the request IP in HttpWebRequest?

    - by holiveira
    I'm developing a website that will connect to a credit card processing gateway webservice. For security purposes this webservice accepts requests only from IP addresses that were previously informed to them. Since I'm developing locally, my IP changes almost every day. Is there a way for me to change the IP address of a HttpWebRequest so that I can test the Webservice calls locally? This webservice is accessed through a https address and the methods must be sent via POST.

    Read the article

  • iis 7.0 Internal 500 Error

    - by bill
    Hi All, i am tearing my hair out. I have read every post on the internet and cannot for the life of me figure out HOW to force IIS 7.0 on 2008 to display detailed errors. I have published a .net 4.0 app. i am at a complete loss. thanks!

    Read the article

  • how to write a script that logs into an application and checks a page

    - by josh
    Is it possible to write a script that will login to an application using uname/pwd? the username/password are not passed in through POST (they dont come in the URL) Basic steps I am looking for are: Visit url enter uname/pwd click a button click a link get the raw html to make sure it does not have 500 error Is that possible to do in any language? Please point me to some examples as well

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >