Search Results

Search found 19953 results on 799 pages for 'post get'.

Page 351/799 | < Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >

  • form_dropdown in codeigniter

    - by Patrick
    I'm getting a strange behaviour from form_dropdown - basically, when I reload the page after validation, the values are screwed up. this bit generates 3 drop downs with days, months and years: $days = array(0 => 'Day...'); for ($i = 1; $i <= 31; $i++) { $days[] = $i; } $months = array(0 => 'Month...', ); for ($i = 1; $i <= 12; $i++) { $months[] = $i; } $years = array(0 => 'Year...'); for ($i = 2010; $i <= 2012; $i++) { $years[$i] = $i; echo "<pre>"; print_r($years); echo "</pre>";//remove this } $selected_day = (isset($selected_day)) ? $selected_day : 0; $selected_month = (isset($selected_month)) ? $selected_month : 0; $selected_year = (isset($selected_year)) ? $selected_year : 0; echo "<p>"; echo form_label('Select date:', 'day', array('class' => 'left')); echo form_dropdown('day', $days, $selected_day, 'class="combosmall"'); echo form_dropdown('month', $months, $selected_month, 'class="combosmall"'); echo form_dropdown('year', $years, $selected_year, 'class="combosmall"'); echo "</p>"; ...and generates this: <p><label for="day" class="left">Select date:</label><select name="day" class="combosmall"> <option value="0" selected="selected">Day...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> <option value="13">13</option> <option value="14">14</option> <option value="15">15</option> <option value="16">16</option> <option value="17">17</option> <option value="18">18</option> <option value="19">19</option> <option value="20">20</option> <option value="21">21</option> <option value="22">22</option> <option value="23">23</option> <option value="24">24</option> <option value="25">25</option> <option value="26">26</option> <option value="27">27</option> <option value="28">28</option> <option value="29">29</option> <option value="30">30</option> <option value="31">31</option> </select><select name="month" class="combosmall"> <option value="0" selected="selected">Month...</option> <option value="1">1</option> <option value="2">2</option> <option value="3">3</option> <option value="4">4</option> <option value="5">5</option> <option value="6">6</option> <option value="7">7</option> <option value="8">8</option> <option value="9">9</option> <option value="10">10</option> <option value="11">11</option> <option value="12">12</option> </select><select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="2010">2010</option> <option value="2011">2011</option> <option value="2012">2012</option> </select></p> however, when the form is reloaded after validation, the same code above generates this: <!-- days and months... --> <select name="year" class="combosmall"> <option value="0" selected="selected">Year...</option> <option value="1">2010</option> <option value="2">2011</option> <option value="3">2012</option> </select> So basically the value start from 1 instead of 2010. The same happens to days and months but obviously it doesn't make any difference in this particular case as the values would start from 1 anyway. How can I fix this - and why does it happen? edit: validation rules are: $this->load->library('form_validation'); //...rules for other fields.. $this->form_validation->set_rules('day', 'day', 'required|xss_clean'); $this->form_validation->set_rules('month', 'month', 'required|xss_clean'); $this->form_validation->set_rules('year', 'year', 'required|xss_clean'); $this->form_validation->set_error_delimiters('<p class="error">', '</p>'); //define other errors if($this->input->post('day') == 0 || $this->input->post('month') == 0 || $this->input->post('year') == 0) { $data['error'] = "Please check the date of your event."; }

    Read the article

  • Linq Expression Trees in Compact Framework.

    - by Michal Drozdowicz
    The lack of expression trees in Compact Framework has bugged me for some time now, but I haven't really looked for a solution. Today, I've found a blog post about an alternative System.Linq.Expressions built on top of Mono System.Core and used e.g. by db4o (you can find it here). My question is - have you used this library and if so, what were your experiences with it (especially regarding performance)?

    Read the article

  • jQuery: modify hidden form field value before submit

    - by Jason Miesionczek
    I have the following code in a partial view (using Spark): <span id="selectCount">0</span> video(s) selected. <for each="var video in Model"> <div style="padding: 3px; margin:2px" class="video_choice" id="${video.YouTubeID}"> <span id="video_name">${video.Name}</span><br/> <for each="var thumb in video.Thumbnails"> <img src="${thumb}" /> </for> </div> </for> # using(Html.BeginForm("YouTubeVideos","Profile", FormMethod.Post, new { id = "youTubeForm" })) # { <input type="hidden" id="video_names" name="video_names" /> <input type="submit" value="add selected"/> # } <ScriptBlock> $(".video_choice").click(function() { $(this).toggleClass('selected'); var count = $(".selected").length; $("#selectCount").html(count); }); var options = { target: '#videos', beforeSubmit: function(arr, form, opts) { var names = []; $(".selected").each(function() { names[names.length] = $(this).attr('id'); }); var namestring = names.join(","); $("#video_names").attr('value',namestring); //alert(namestring); //arr["video_names"] = namestring; //alert($.param(arr)); //alert($("#video_names").attr('value')); return true; } }; $("#youTubeForm").ajaxForm(options); </ScriptBlock> Essentially i display a series of divs that contain information pulled from the YouTube API. I use jQuery to allow the the user to select which videos they would like to add to their profile. When i submit the form i would like to populate the hidden field with a comma separated list of video ids. Everything works except that when i try to set the value of the field, in the controller on post, the field comes back empty. I am using the jQuery ajax form plugin. What am i doing wrong that is not allowing the value i set in the field to be sent to the server?

    Read the article

  • Search functionality in a lightbox

    - by Salil
    Hi All, I have a page on which there is a link search. onclicking search i open a LIGHTBOX where i get a textfield and Search button. Now i want when i enter keyword in textfield and enter on submit button a result should be shown in a lighbox only. is it possible w/o ajax or i have to use ajax form only. just curious why we used get request instead of post request for Search functionality.

    Read the article

  • get fbml comments to automatically show form

    - by Cek
    I'm writing facebook app in fbml (not in iframe). I added comments with <fb:comments ...> and it appears to work. However, to add a comment, user has to click Add a comment... link to see the textarea and post button. I am wondering is there a way to automatically show the form? I want it to really look like here: developers.facebook.com/docs/reference/plugins/comments (with or without the like button)

    Read the article

  • Coolest C# LINQ/Lambdas trick you've ever pulled?

    - by chakrit
    Saw a post about hidden features in C# but not a lot of people have written linq/lambdas example so... I wonder... What's the coolest (as in the most elegant) use of the C# LINQ and/or Lambdas/anonymous delegates you have ever saw/written? Bonus if it has went into production too!

    Read the article

  • Clearing Page Cache in ASP.NET

    - by GateKiller
    For my blog I am wanting to use the Output Cache to save a cached version of a perticular post for around 10 minutes, and thats fine... <%@OutputCache Duration="600" VaryByParam="*" %> However, if someone posts a comment, I want to clear the cache so that the page is refreshed and the comment can be seen. How do I do this in ASP.Net C#?

    Read the article

  • Is there away to store info, without a database?

    - by Tanner
    HI, I was wondering is there any way to store data, like say I wanted to make a login form and save the usernames and passwords, without using a database or .txt file? Seems like alot of work to set up stuff like that, for something simple, and I was just wondering if there was another way. :) And if any one has some tutorials on how to use a database Access/Sql/Local Database please post.

    Read the article

  • Format form fields for bootstrap using rails+nokogiri

    - by user1116573
    I have the following in an initializer in a rails app that uses Twitter bootstrap so that it removes the div.field_with_errors that rails applies when validation fails on a field but also the initializer adds the help/validation text after the erroneous input field: require 'nokogiri' ActionView::Base.field_error_proc = Proc.new do |html_tag, instance| html = %(<div class="field_with_errors">#{html_tag}</div>).html_safe form_fields = [ 'textarea', 'input', 'select' ] elements = Nokogiri::HTML::DocumentFragment.parse(html_tag).css("label, " + form_fields.join(', ')) elements.each do |e| if e.node_name.eql? 'label' html = %(#{e}).html_safe elsif form_fields.include? e.node_name if instance.error_message.kind_of?(Array) html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message.join(',')}</span>).html_safe else html = %(#{e}<span class="help-inline">&nbsp;#{instance.error_message}</span>).html_safe end end end html end This works fine but I also need to apply the .error class to the surrounding div.control-group for each error. My initializer currently gives the following output: <div class="control-group"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> but I need something adding to my initializer so that it adds the .error class to the div.control-group like so: <div class="control-group error"> <label class="control-label" for="post_message">Message</label> <div class="controls"> <input id="post_message" name="post[message]" required="required" size="30" type="text" value="" /><span class="help-inline">&nbsp;can't be blank</span> </div> </div> The solution will probably need to allow for the fact that each validation error could have more than one label and input that are all within the same div.control-group (eg radio buttons / checkboxes / 2 text fields side by side). I assume it needs some sort of e.at_xpath() to find the div.control-group parent and add the .error class to it but I'm not sure how to do this. Can anyone help? PS This may all be possible using the formtastic or simple_form gems but I'd rather just use my own html if possible. EDIT If I put e['class'] = 'foo' in the if e.node_name.eql? 'label' section then it applies the class to the label so I think I just need to find the parent tag of e and then apply an .error class to it but I can't figure out what the xpath would be to get from label to its div.control-group parent; no combination of dots, slashes or whatever seems to work but xpath isn't my strong point.

    Read the article

  • How to link to specific anchor in table with jquery

    - by LisaH
    I am using this jquery plugin: http://www.jankoatwarpspeed.com/post/2009/07/20/Expand-table-rows-with-jQuery-jExpand-plugin.aspx I have anchors in the code such as: <a name="art" id="art2"></a> Articles How can I open that particular row then? In other words, when a user clicks a link from another page to this landing page I would like the appropriate row to open up based on the anchor tag. Thanks in advance!

    Read the article

  • Hiding Group Column Names

    - by Robert
    You once replied to a post about hiding list group header names. http://edinkapic.blogspot.com/2008/06/hiding-list-view-group-headers.html I do not write code or jQuery at that. But you mentioned that it would be better to write a solution in jQuery. Would you have code that would hide the group header and colon in a 2003 list (SP v.2)? Do you have any good leads? Thanks. Robert S.

    Read the article

  • Wordpress display specific sub category of a parent category.

    - by Pennf0lio
    So here's the scenario, I'm building a theme that would display sub category of a parent post for Food: [Food] -Hotdog -Eggs -Fries for Toys: [Toys] -Doll -Car -Drums for People: [People] -Mom -Dad -Uncle now I don't want to display their parent category, just their subcategory (eg Doll, Car, Drums). I've looked list_cats() and wp_list_categories() but I can't figure out how to display it right. Thanks!

    Read the article

  • Live search results as you type... am I going about this the right way? jQuery + PHP

    - by dallen
    This is my first time building a tool like this, so please bare with me. I'm doing this to learn more about jQuery and AJAX. Basically, I have a search input and a hidden div. When you start typing in the search input, the hidden div becomes visible and results are brought in. In this case, I'm searching for client names. It all works fine, however I think my code could be better but I'm not sure exactly where to begin. Each keyup requests a PHP script which accesses a table in a database to find a like string. But in my PHP script, I'm echo'ing some JS/jQuery which I'm not sure is good practice. Below is my code. Am I going about this the right way or am I totally off base? Any suggestions for improvement? Javascript $("#search").keyup(function() { $("#search_results").show("fast"); $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search/" + $("#search").val(), success: function(html) { $("#search_results").html(html); } }); }); PHP function search($search_string = false) { if ($search_string) { $this->db->like('name', $search_string); $query = $this->db->get('clients'); if ($query->num_rows() == 0) { echo "No client exists."; } else { foreach ($query->result() as $row) { echo '<script>'; echo ' $("#client_results_'.$row->id.'").hide(); $("#'.$row->id.'").toggle(function() { $.ajax ({ type: "POST", url: "http://localhost:8888/index.php/welcome/search_client_ads/" + '.$row->id.', success: function(html) { $("#client_results_'.$row->id.'").html(html).show("fast"); } }); }, function() { $("#client_results_'.$row->id.'").hide("fast").html(""); });'; echo '</script>'; echo '<p><span id="'.$row->id.'">'.$row->name.'</span></p>'; echo '<div id="client_results_'.$row->id.'"></div>'; } } } else { echo ''; } } function search_client_ads($client_id) { $query = $this->db->get_where('online_ads', array('client' => $client_id)); if ($query->num_rows() == 0) { echo "No ads exist."; } else { foreach ($query->result() as $row) { echo $row->id; } } }

    Read the article

  • Describe your workflow of using version control (VCS or DVCS)

    - by edwin.nathaniel
    I'd like to learn other people workflow when using either SVN or GIT. Please describe your strategy to handle the following tasks: Implement a feature Fixing bugs (during development and deployed app) Code Review Refactoring code (post code-review) Incorporate patches Releasing the newer version of your app (desktop, web, mobile, would you treat them differently?) Feel free to organize your answer not grouped by the tasks but grouped by whatever you think is relevant but please organize it by VCS/DVCS (please don't mix them). Thank you.

    Read the article

  • How Does One Differentiate Between Routes POSTed To In Asp.Net MVC?

    - by Laz
    I have two actions, one that accepts a ViewModel and one that accepts two parameters a string and an int, when I try to post to the action, it gives me an error telling me that the current request is ambiguous between the two actions. Is it possible to indicate to the routing system which action is the relevant one, and if it is how is it done?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • virtualenvwrapper .hook problem

    - by Wraith
    I've used virtualenvwrapper, but I'm having problems running it on a new computer. My .bashrc file is updated per the instructions: export WORKON_HOME=$DEV_HOME/projects source /usr/local/bin/virtualenvwrapper.sh But when source is run, I get the following: bash: /25009.hook: Permission denied bash: /25009.hook: No such file or directory This previous post leads me to believe the filename is being recycled and locked because virtualenvwrapper.sh uses $$. Is there any way to fix this?

    Read the article

< Previous Page | 347 348 349 350 351 352 353 354 355 356 357 358  | Next Page >