Search Results

Search found 13534 results on 542 pages for 'python 2 1'.

Page 365/542 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • How can I draw a log-normalized imshow plot with a colorbar representing the raw data in matplotlib

    - by Adam Fraser
    I'm using matplotlib to plot log-normalized images but I would like the original raw image data to be represented in the colorbar rather than the [0-1] interval. I get the feeling there's a more matplotlib'y way of doing this by using some sort of normalization object and not transforming the data beforehand... in any case, there could be negative values in the raw image. import matplotlib.pyplot as plt import numpy as np def log_transform(im): '''returns log(image) scaled to the interval [0,1]''' try: (min, max) = (im[im > 0].min(), im.max()) if (max > min) and (max > 0): return (np.log(im.clip(min, max)) - np.log(min)) / (np.log(max) - np.log(min)) except: pass return im a = np.ones((100,100)) for i in range(100): a[i] = i f = plt.figure() ax = f.add_subplot(111) res = ax.imshow(log_transform(a)) # the colorbar drawn shows [0-1], but I want to see [0-99] cb = f.colorbar(res) I've tried using cb.set_array, but that didn't appear to do anything, and cb.set_clim, but that rescales the colors completely. Thanks in advance for any help :)

    Read the article

  • etree.findall: 'OR'-lookup?

    - by piquadrat
    I want to find all stylesheet definitions in a XHTML file with lxml.etree.findall. This could be as simple as elems = tree.findall('link[@rel="stylesheet"]') + tree.findall('style') But the problem with CSS style definitions is that the order matters, e.g. <link rel="stylesheet" type="text/css" href="/media/css/first.css" /> <style>body:{font-size: 10px;}</style> <link rel="stylesheet" type="text/css" href="/media/css/second.css" /> if the contents of the style tag is applied after the rules in the two link tags, the result may be completely different from the one where the rules are applied in order of definition. So, how would I do a lookup that inlcudes both link[@rel="stylesheet"] and style?

    Read the article

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • Why wont numpy matrix let me print its rows?

    - by uberjumper
    Okay this is probably a really dumb question, however its really starting to hurt. I have a numpy matrix, and basically i print it out row by row. However i want to make each row be formatted and separated properly. >>> arr = numpy.matrix([[x for x in range(5)] for y in range(5)]) >>> arr matrix([[0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4], [0, 1, 2, 3, 4]]) Lets say i want to print the first row, and add a '|' between each element: >>> '|'.join(map(str, arr[0,])) '[[0 1 2 3 4]]' Err... >>> '|'.join(map(lambda x: str(x[0]), arr[0])) '[[0 1 2 3 4]]' I am really confused by this behavior why does it do this?

    Read the article

  • Dropdown sorting in django-admin

    - by Andrey
    I'd like to know how can I sort values in the Django admin dropdowns. For example, I have a model called Article with a foreign key pointing to the Users model, smth like: class Article(models.Model): title = models.CharField(_('Title'), max_length=200) slug = models.SlugField(_('Slug'), unique_for_date='publish') author = models.ForeignKey(User) body = models.TextField(_('Body')) status = models.IntegerField(_('Status')) categories = models.ManyToManyField(Category, blank=True) publish = models.DateTimeField(_('Publish date')) I edit this model in django admin: class ArticleAdmin(admin.ModelAdmin): list_display = ('title', 'publish', 'status') list_filter = ('publish', 'categories', 'status') search_fields = ('title', 'body') prepopulated_fields = {'slug': ('title',)} admin.site.register(Article, ArticleAdmin) and of course it makes the nice user select dropdown for me, but it's not sorted and it takes a lot of time to find a user by username.

    Read the article

  • How can I detect whether an image is a PNG or APNG format?

    - by perlit
    APNG is backwards compatible with PNG. I opened up an apng and png file in a hex editor and the first few bytes look identical. So if a user uploads either of these formats, how do I detect what the format really is? I've seen this done on some sites that block apng. I'm guessing the ImageMagick library makes this easy, but what if I were to do the detect without the use of an image processing library (for learning purposes)? Can I look for specific bytes that tell me if the file is apng? Solutions in any language is welcome.

    Read the article

  • Dynamically setting the queryset of a ModelMultipleChoiceField to a custom recordset

    - by Daniel Quinn
    I've seen all the howtos about how you can set a ModelMultipleChoiceField to use a custom queryset and I've tried them and they work. However, they all use the same paradigm: the queryset is just a filtered list of the same objects. In my case, I'm trying to get the admin to draw a multiselect form that instead of using usernames as the text portion of the , I'd like to use the name field from my account class. Here's a breakdown of what I've got: # models.py class Account(models.Model): name = models.CharField(max_length=128,help_text="A display name that people understand") user = models.ForeignKey(User, unique=True) # Tied to the User class in settings.py class Organisation(models.Model): administrators = models.ManyToManyField(User) # admin.py from django.forms import ModelMultipleChoiceField from django.contrib.auth.models import User class OrganisationAdminForm(forms.ModelForm): def __init__(self, *args, **kwargs): from ethico.accounts.models import Account self.base_fields["administrators"] = ModelMultipleChoiceField( queryset=User.objects.all(), required=False ) super(OrganisationAdminForm, self).__init__(*args, **kwargs) class Meta: model = Organisation This works, however, I want queryset above to draw a selectbox with the Account.name property and the User.id property. This didn't work: queryset=Account.objects.all().order_by("name").values_list("user","name") It failed with this error: 'tuple' object has no attribute 'pk' I figured that this would be easy, but it's turned into hours of dead-ends. Anyone care to shed some light?

    Read the article

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Trouble with encoding and urllib

    - by Ockonal
    Hello, I'm loading web-page using urllib. Ther eis russian symbols, but page encoding is 'utf-8' 1 pageData = unicode(requestHandler.read()).decode('utf-8') UnicodeDecodeError: 'ascii' codec can't decode byte 0xd0 in position 262: ordinal not in range(128) 2 pageData = requestHandler.read() soupHandler = BeautifulSoup(pageData) print soupHandler.findAll(...) UnicodeEncodeError: 'ascii' codec can't encode characters in position 340-345: ordinal not in range(128)

    Read the article

  • How to classify NN/NNP/NNS obtained from POS tagged document as a product feature

    - by Shweta .......
    I'm planning to perform sentiment analysis on reviews of product features (collected from Amazon dataset). I have extracted review text from the dataset and performed POS tagging on that. I'm able to extract NN/NNP as well. But my doubt is how do I come to know that extracted words classify as features of the products? I know there are classifiers in nltk but I don't know how I should use it for my project. I'm assuming there are 2 ways of finding whether the extracted word is a product feature or not. One is to compare with a bag of words and find out if my word exists in that. Doubt: How do I create/get bag of words? Second way is to implement some kind of apriori algorithm to find out frequently occurring words as features. I would like to know which method is good and how to go about implementing it. Some pointers to available softwares or code snippets would be helpful! Thanks!

    Read the article

  • SQLAlchemy - SQLite for testing and Postgresql for devlopment - How to port?

    - by StackUnderflow
    I want to use sqlite memory database for all my testing and Postgresql for my development/production server. But the SQL syntax is not same in both dbs. for ex: SQLite has autoincrement, and Postgresql has serial Is it easy to port the SQL script from sqlite to postgresql... what are your solutions? If you want me to use standard SQL, how should I go about generating primary key in both the databases?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Multiprocessing Bomb

    - by iKarampa
    I was working the following example from Doug Hellmann tutorial on multiprocessing: import multiprocessing def worker(): """worker function""" print 'Worker' return if __name__ == '__main__': jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() When I tried to run it outside the if statement: import multiprocessing def worker(): """worker function""" print 'Worker' jobs = [] for i in range(5): p = multiprocessing.Process(target=worker) jobs.append(p) p.start() It started spawning processes non-stop, without any way of to terminating it. Why would that happen? Why it did not generate 5 processes and exit? Why do I need the if statement?

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • List Directories and get the name of the Directory

    - by chrissygormley
    Hello, I am trying to get the code to list all the directories in a folder, change directory into that folder and get the name of the current folder. The code I have so far is below and isn't working at the minute. I seem to be getting the parent folder name. import os for directories in os.listdir(os.getcwd()): dir = os.path.join('/home/user/workspace', directories) os.chdir(dir) current = os.path.dirname(dir) new = str(current).split("-")[0] print new I also have other files in the folder but I do not want to list them. I have tried the below code but I haven't got it working yet either. for directories in os.path.isdir(os.listdir(os.getcwd())): Can anyone see where I am going wrong? Thanks

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >