Search Results

Search found 38244 results on 1530 pages for 'recursive function'.

Page 365/1530 | < Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >

  • Recursively MySQL Query

    - by Rachel
    How can I implement recursive MySQL Queries. I am trying to look for it but resources are not very helpful. Trying to implement similar logic. public function initiateInserts() { //Open Large CSV File(min 100K rows) for parsing. $this->fin = fopen($file,'r') or die('Cannot open file'); //Parsing Large CSV file to get data and initiate insertion into schema. $query = ""; while (($data=fgetcsv($this->fin,5000,";"))!==FALSE) { $query = $query + "INSERT INTO dt_table (id, code, connectid, connectcode) VALUES (" + $data[0] + ", " + $data[1] + ", " + $data[2] + ", " + $data[3] + ")"; } $stmt = $this->prepare($query); // Execute the statement $stmt->execute(); $this->checkForErrors($stmt); } @Author: Numenor Error Message: You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '0' at line 1 This Approach inspired to look for an MySQL recursive query approach.

    Read the article

  • postgres stored procedure problem

    - by easyrider
    Hi all, Ich have a problem in postgres function: CREATE OR REPLACE FUNCTION getVar(id bigint) RETURNS TABLE (repoid bigint, suf VARCHAR, nam VARCHAR) AS $$ declare rec record; BEGIN FOR rec IN (WITH RECURSIVE children(repoobjectid,variant_of_object_fk, suffix, variantname) AS ( SELECT repoobjectid, variant_of_object_fk, '' as suffix,variantname FROM b2m.repoobject_tab WHERE repoobjectid = id UNION ALL SELECT repo.repoobjectid, repo.variant_of_object_fk, suffix || '..' , repo.variantname FROM b2m.repoobject_tab repo, children WHERE children.repoobjectid = repo.variant_of_object_fk) SELECT repoobjectid,suffix,variantname FROM children) LOOP RETURN next; END LOOP; RETURN; END; It can be compiled, but if y try to call it select * from getVar(18) I got 8 empty rows with 3 columns. If i execute the following part of procedure with hard-coded id parameter: WITH RECURSIVE children(repoobjectid,variant_of_object_fk, suffix, variantname) AS ( SELECT repoobjectid, variant_of_object_fk, '' as suffix,variantname FROM b2m.repoobject_tab WHERE repoobjectid = 18 UNION ALL SELECT repo.repoobjectid, repo.variant_of_object_fk, suffix || '..' , repo.variantname FROM b2m.repoobject_tab repo, children WHERE children.repoobjectid = repo.variant_of_object_fk) SELECT repoobjectid,suffix,variantname FROM children I got exactly, what i need 8 rows with data: repoobjectid suffix variantname 18 19 .. for IPhone 22 .. for Nokia 23 .... OS 1.0 and so on. What is going wrong ? Please help. Thanx in advance

    Read the article

  • Works in Firefox & Opera, but not IE 8

    - by Ai Pragma
    1) This issue involves just one html webpage, lets call it "ajax.html".2) I have AJAX functions in this webpage that work in both Firefox and IE8.3) I now attempt generating just the option values of a dropdown list of dates using my ajax functions, and it works in Firefox & Opera, but not IE8.4) The surrounding html code for the dropdown looks like this:<select name="entry_7_single" id="entry_7" onChange="Ajax_PhpResultsWithVar('./secure/db/SummaryCls.php','entry_8','dateval',this.value)"></select>The onchange call refers to an ajax function that successfully(both Firefox & IE8) populates a textarea(entry_8) with a description of an event associated with the date selected in this dropdown. 5) An onload call initiates the ajax function to generate the dropdown list values:<body class="ss-base-body" onLoad="OnLoadWebPage()">6) The js script that calls the ajax function is as follows:function OnLoadWebPage(){    Ajax_PhpResults('./secure/db/GenDateListCls.php','entry_7');}7) Since it works in Firefox, but not IE8, I throw the output of the ajax function into a Firefox large textbox and I get the following:<option selected value="8 JUN 2010">8 JUN 2010</option>                   <option value="9 JUN 2010">9 JUN 2010</option>                   <option value="10 JUN 2010">10 JUN 2010</option>                   <option value="11 JUN 2010">11 JUN 2010</option> 8 ) There are over a hundred generated but you get the gist of what the ajax function generates. Next I will list the PHP function that outputs the above dropdown values://///////////////////////////////////////////////////////////////////////////////////////////////////////<?phpinclude_once 'SPSQLite.class.php';include_once 'misc_funcs.php';class GenDateListCls {    var $dbName;    var $sqlite;        function GenDateListCls()    {        $this->dbName = 'accrsc.db';        $this->ConstructEventDates();    }        function ConstructEventDates()    {         $this->sqlite = new SPSQLite($this->dbName);         $todayarr = getdate();         $today = $todayarr[mday] . " " . substr($todayarr[month],0,3) . " " . $todayarr[year];                  $ICalDate = ChangeToICalDate($today);         $dateQuery = "SELECT dtstart from events where substr(dtstart,1,8) >= '" . $ICalDate . "';";         $this->sqlite->query($dateQuery);         $datesResult = $this->sqlite->returnRows();                      foreach (array_reverse($datesResult) as $indx => $row)         {                       $normDate = NormalizeICalDate(substr($row[dtstart],0,8));              if ($indx==0)              { ?>                 <option selected value=<?php echo('"' . $normDate . '"'); ?>><?php echo $normDate; ?></option><?php                               }                          else              {?>                  <option value=<?php echo('"' . $normDate . '"'); ?>><?php echo $normDate; ?></option><?php                                   }                       }                   $this->sqlite->close();     }}$dateList = new GenDateListCls();    ?>/////////////////////////////////////////////////////////////////////////////////////////////////////////////<<< I appreciate any assistance on this matter. Aipragma >>> My Background: To let you all know, I am a complete newbie to PHP, Ajax, & javascript, and learning it all on my own, no classes. My background is in Linux, Windows, C++, Java, VB,VBA,MS XML, & some html.

    Read the article

  • Tail recursion and memoization with C#

    - by Jay
    I'm writing a function that finds the full path of a directory based on a database table of entries. Each record contains a key, the directory's name, and the key of the parent directory (it's the Directory table in an MSI if you're familiar). I had an iterative solution, but it started looking a little nasty. I thought I could write an elegant tail recursive solution, but I'm not sure anymore. I'll show you my code and then explain the issues I'm facing. Dictionary<string, string> m_directoryKeyToFullPathDictionary = new Dictionary<string, string>(); ... private string ExpandDirectoryKey(Database database, string directoryKey) { // check for terminating condition string fullPath; if (m_directoryKeyToFullPathDictionary.TryGetValue(directoryKey, out fullPath)) { return fullPath; } // inductive step Record record = ExecuteQuery(database, "SELECT DefaultDir, Directory_Parent FROM Directory where Directory.Directory='{0}'", directoryKey); // null check string directoryName = record.GetString("DefaultDir"); string parentDirectoryKey = record.GetString("Directory_Parent"); return Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey), directoryName); } This is how the code looked when I realized I had a problem (with some minor validation/massaging removed). I want to use memoization to short circuit whenever possible, but that requires me to make a function call to the dictionary to store the output of the recursive ExpandDirectoryKey call. I realize that I also have a Path.Combine call there, but I think that can be circumvented with a ... + Path.DirectorySeparatorChar + .... I thought about using a helper method that would memoize the directory and return the value so that I could call it like this at the end of the function above: return MemoizeHelper( m_directoryKeyToFullPathDictionary, Path.Combine(ExpandDirectoryKey(database, parentDirectoryKey)), directoryName); But I feel like that's cheating and not going to be optimized as tail recursion. Any ideas? Should I be using a completely different strategy? This doesn't need to be a super efficient algorithm at all, I'm just really curious. I'm using .NET 4.0, btw. Thanks!

    Read the article

  • Recursion in prepared statements

    - by Rob
    I've been using PDO and preparing all my statements primarily for security reasons. However, I have a part of my code that does execute the same statement many times with different parameters, and I thought this would be where the prepared statements really shine. But they actually break the code... The basic logic of the code is this. function someFunction($something) { global $pdo; $array = array(); static $handle = null; if (!$handle) { $handle = $pdo->prepare("A STATEMENT WITH :a_param"); } $handle->bindValue(":a_param", $something); if ($handle->execute()) { while ($row = $handle->fetch()) { $array[] = someFunction($row['blah']); } } return $array; } It looked fine to me, but it was missing out a lot of rows. Eventually I realised that the statement handle was being changed (executed with different param), which means the call to fetch in the while loop will only ever work once, then the function calls itself again, and the result set is changed. So I am wondering what's the best way of using PDO prepared statements in a recursive way. One way could be to use fetchAll(), but it says in the manual that has a substantial overhead. The whole point of this is to make it more efficient. The other thing I could do is not reuse a static handle, and instead make a new one every time. I believe that since the query string is the same, internally the MySQL driver will be using a prepared statement anyway, so there is just the small overhead of creating a new handle on each recursive call. Personally I think that defeats the point. Or is there some way of rewriting this?

    Read the article

  • [CODE GENERATION] How to generate DELETE statements in PL/SQL, based on the tables FK relations?

    - by The chicken in the kitchen
    Is it possible via script/tool to generate authomatically many delete statements based on the tables fk relations, using Oracle PL/SQL? In example: I have the table: CHICKEN (CHICKEN_CODE NUMBER) and there are 30 tables with fk references to its CHICKEN_CODE that I need to delete; there are also other 150 tables foreign-key-linked to that 30 tables that I need to delete first. Is there some tool/script PL/SQL that I can run in order to generate all the necessary delete statements based on the FK relations for me? (by the way, I know about cascade delete on the relations, but please pay attention: I CAN'T USE IT IN MY PRODUCTION DATABASE, because it's dangerous!) I'm using Oracle DataBase 10G R2. This is the result I've written, but it is not recursive: This is a view I have previously written, but of course it is not recursive! CREATE OR REPLACE FORCE VIEW RUN ( OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, VINCOLO ) AS SELECT OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME, '(' || LTRIM ( EXTRACT (XMLAGG (XMLELEMENT ("x", ',' || COLUMN_NAME)), '/x/text()'), ',') || ')' VINCOLO FROM ( SELECT CON1.OWNER OWNER_1, CON1.TABLE_NAME TABLE_NAME_1, CON1.CONSTRAINT_NAME CONSTRAINT_NAME_1, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME FROM DBA_CONSTRAINTS CON, DBA_CONS_COLUMNS COL, DBA_CONSTRAINTS CON1 WHERE CON.OWNER = 'TABLE_OWNER' AND CON.TABLE_NAME = 'TABLE_OWNED' AND ( (CON.CONSTRAINT_TYPE = 'P') OR (CON.CONSTRAINT_TYPE = 'U')) AND COL.TABLE_NAME = CON1.TABLE_NAME AND COL.CONSTRAINT_NAME = CON1.CONSTRAINT_NAME --AND CON1.OWNER = CON.OWNER AND CON1.R_CONSTRAINT_NAME = CON.CONSTRAINT_NAME AND CON1.CONSTRAINT_TYPE = 'R' GROUP BY CON1.OWNER, CON1.TABLE_NAME, CON1.CONSTRAINT_NAME, CON1.DELETE_RULE, CON1.STATUS, CON.TABLE_NAME, CON.CONSTRAINT_NAME, COL.POSITION, COL.COLUMN_NAME) GROUP BY OWNER_1, CONSTRAINT_NAME_1, TABLE_NAME_1, TABLE_NAME; ... and it contains the error of using DBA_CONSTRAINTS instead of ALL_CONSTRAINTS...

    Read the article

  • No idea how to solve SICP exercise 1.11

    - by Javier Badia
    This is not homework. Exercise 1.11: A function f is defined by the rule that f(n) = n if n<3 and f(n) = f(n - 1) + 2f(n - 2) + 3f(n - 3) if n 3. Write a procedure that computes f by means of a recursive process. Write a procedure that computes f by means of an iterative process. Implementing it recursively is simple enough. But I couldn't figure out how to do it iteratively. I tried comparing with the Fibonacci example given, but I didn't know how to use it as an analogy. So I gave up (shame on me) and Googled for an explanation, and I found this: (define (f n) (if (< n 3) n (f-iter 2 1 0 n))) (define (f-iter a b c count) (if (< count 3) a (f-iter (+ a (* 2 b) (* 3 c)) a b (- count 1)))) After reading it, I understand the code and how it works. But what I don't understand is the process needed to get from the recursive defintion of the function to this. I don't get how the code formed in someone's head. Could you explain the thought process needed to arrive at the solution?

    Read the article

  • Running a Model::find in for loop in cakephp v1.3

    - by Gaurav Sharma
    Hi all, How can I achieve the following result in cakephp: In my application a Topic is related to category, category is related to city and city is finally related to state in other words: topic belongs to category, category belongs to city , city belongs to state.. Now in the Topic controller's index action I want to find out all the topics and it's city and state. How can I do this. I can easily do this using a custom query ($this-Model-query() function ) but then I will be facing pagination difficulties. I tried doing like this function index() { $this->Topic->recursive = 0; $topics = $this->paginate(); for($i=0; $i<count($topics);$i++) { $topics[$i]['City'] = $this->Topic->Category->City->find('all', array('conditions' => array('City.id' => $topics[$i]['Category']['city_id']))); } $this->set(compact('messages')); } The method that I have adopted is not a good one (running query in a loop) Using the recursive property and setting it to highest value (2) will degrade performance and is not going to yield me state information. How shall I solve this ? Please help Thanks

    Read the article

  • How to work with CTE. There is some error related to anchor.

    - by Shantanu Gupta
    I am creating a hierarchy representaion of a column. But an error occurs Details are Msg 240, Level 16, State 1, Line 1 Types don't match between the anchor and the recursive part in column "DISPLAY" of recursive query "CTE". I know there is some typecasting error. But I dont know how to remove error. Please just dont only sort out my error. I need explanation why this error is coming. When this error occurs. I am trying to sort table on the basis of sort col that i m introducing. I want to add '-' at every level and want to sort accordingly. Please help WITH CTE (PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH) AS ( SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, '-' AS DISPLAY, '--' AS SORT, 0 AS DEPTH FROM dbo.L_CATEGORY_TYPE WHERE FK_CATEGORY_ID IS NULL UNION ALL SELECT T.PK_CATEGORY_ID, T.[DESCRIPTION], T.FK_CATEGORY_ID, CAST(DISPLAY+T.[DESCRIPTION] AS VARCHAR(1000)), '--' AS SORT, C.DEPTH +1 FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.PK_CATEGORY_ID = T.FK_CATEGORY_ID --SELECT T.PK_CATEGORY_ID, C.SORT+T.[DESCRIPTION], T.FK_CATEGORY_ID --, CAST('--' + C.SORT AS VARCHAR(1000)) AS SORT, CAST(DEPTH +1 AS INT) AS DEPTH --FROM dbo.L_CATEGORY_TYPE T JOIN CTE C ON C.FK_CATEGORY_ID = T.PK_CATEGORY_ID ) SELECT PK_CATEGORY_ID, [DESCRIPTION], FK_CATEGORY_ID, DISPLAY, SORT, DEPTH FROM CTE ORDER BY SORT

    Read the article

  • C# Recursion SumOfOnlyNeg Elements

    - by Chris
    Hello, A array gets filled up with random elements (negative and positive). Now i want to calculate the sum of ONLY the postive elements. Iterative there is no problem, but in the recursion version i can only get the sum of both negative and postive. How can i "check" in the recursive version that it only sums up the Postive elements? Best Regards. Iterative version: public int IterSomPosElem(int[] tabel, int n) { n = 0; for (int i = 0; i < tabel.Length; i++) { if (tabel[i] >= 0) { n += tabel[i]; } } return n; } Recursive version atm (sums up all the elements insteed, of only the positive) public int RecuSomPosElem(int[] tabel, int n) { if(n == 1) return tabel[0]; //stopCriterium else { return (tabel[n - 1] + RecuSomPosElem(tabel, n - 1)); // how to check, so it only sums up the postive elements and "ignores" the negative elements. } }

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Efficient Multiplication of Varying-Length #s [Conceptual]

    - by Milan Patel
    Write the pseudocode of an algorithm that takes in two arbitrary length numbers (provided as strings), and computes the product of these numbers. Use an efficient procedure for multiplication of large numbers of arbitrary length. Analyze the efficiency of your algorithm. I decided to take the (semi) easy way out and use the Russian Peasant Algorithm. It works like this: a * b = a/2 * 2b if a is even a * b = (a-1)/2 * 2b + a if a is odd My pseudocode is: rpa(x, y){ if x is 1 return y if x is even return rpa(x/2, 2y) if x is odd return rpa((x-1)/2, 2y) + y } I have 3 questions: Is this efficient for arbitrary length numbers? I implemented it in C and tried varying length numbers. The run-time in was near-instant in all cases so it's hard to tell empirically... Can I apply the Master's Theorem to understand the complexity...? a = # subproblems in recursion = 1 (max 1 recursive call across all states) n / b = size of each subproblem = n / 1 - b = 1 (problem doesn't change size...?) f(n^d) = work done outside recursive calls = 1 - d = 0 (the addition when a is odd) a = 1, b^d = 1, a = b^d - complexity is in n^d*log(n) = log(n) this makes sense logically since we are halving the problem at each step, right? What might my professor mean by providing arbitrary length numbers "as strings". Why do that? Many thanks in advance

    Read the article

  • git submodule pull and commit automatically on webserver

    - by Lukas Oppermann
    I have the following setup, I am working on a project project with the submodule submodule. Whenever I push changes to github it sends a post request to update.php on the server. This php file executes a git command. Without submodules I can just do a git pull and everything is fine but with submodules it is much more difficult. I have this at the moment, but it does not do what I want. I should git pull the repo and update and pull the latest version of each submodule. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -m "updating"' && git pull && git submodule foreach 'git add -A .' && git commit -m "updating to latest version including submodules" 2>&1s`; EDIT// Okay, I got it half way done. <?php echo `git submodule foreach 'git checkout master; git pull; git submodule update --init --recursive; git commit -am "updating"; echo "updated"' && git pull && git commit -am "updating to latest version including submodules" && echo 'updated'`; The echo prevents the script to stop because of non-zero returned. It works 100% fine when I run it from the console using php update.php. When github initialized the file, or I run it from the browser it still does not work. Any ideas?

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • Insertion into BST without header Node JAVA

    - by Petiatil
    I am working on a recursive insertion method for a BST. This function is suppose to be a recursive helper method and is in a private class called Node. The Node class is in a class called BinarySearchTree which contains an instance variable for the root. When I am trying to insert an element, I get a NullPointerException at : this.left = insert(((Node)left).element); I am unsure about why this occurs. If I understand correctly, in a BST, I am suppose to insert the item at the last spot on the path transversed. Any help is appreciated! private class Node implements BinaryNode<E> { E item; BinaryNode<E> left, right; public BinaryNode<E> insert(E item) { int compare = item.compareTo(((Node)root).item); if(root == null) { root = new Node(); ((Node)root).item = item; } else if(compare < 0) { this.left = insert(((Node)left).item); } else if(compare > 0) { this.right = insert(((Node)right).item); } return root; } }

    Read the article

  • Breaking out of first element in IHTMLTxtRange

    - by XwipeoutX
    I'm trying to do a rich text editor for a web application, and I need to be able to mark some elements in the text as uneditable by the user. The reason for this is they're placeholders for dynamic content (like created date) that I want to have a live preview for. Take the following Code as an example - there's no toolbar or anything in this one, for light weightness, but the textarea and html are synchronized. <!-- DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-strict.dtd" --> <html> <head> <title>Hi</title> <script type="text/javascript" src="http://code.jquery.com/jquery-1.4.2.min.js"></script> <script> $(function() { g = {}; g.iFrame = document.createElement("IFRAME"); $("#frameContainer").append(g.iFrame); g.iDoc = g.iFrame.contentWindow.document; g.iDoc.designMode = "on"; g.jTextArea = $("#textContainer textarea"); setTimeout(function() { g.iDoc.body.innerHTML = "<b class=\"notype\">Cannot type here</b>"; $(g.iDoc).trigger("keyup"); $(g.iDoc.body).focus(); }, 0); $(g.iDoc).keyup(function() { g.jTextArea.text(g.iDoc.body.innerHTML); }); g.jTextArea.keyup(function() { g.iDoc.body.innerHTML = this.innerText; }); var getSelection = function() { if (typeof g.iDoc.selection !== "undefined" && g.iDoc.selection.type !== "Text" && g.iDoc.selection.type !== "None") { g.iDoc.selection.clear(); } return g.iDoc.selection.createRange(); }; $(g.iDoc).keypress(function(event) { // If we're in a marked field, disable the operation. var sel = getSelection(); if ($(sel.parentElement()).hasClass('notype')) { sel.moveToElementText(sel.parentElement()); sel.collapse(); sel.move("character", -1); sel.select(); $("#log").append("<div>outside of thing</div>"); } }); $(testLink).click(function() { // Try and insert stuff at the front $(g.iDoc.body).focus(); var sel = getSelection(); sel.moveToElementText(sel.parentElement()); sel.collapse(); sel.move("character", -100); sel.pasteHTML("Before html?"); $(g.iDoc).trigger("keyup"); $(g.iDoc.body).focus(); }); }); </script> </head> <body id="#body"> <div id="container"> <div id="frameContainer"> <h1> Frame</h1> </div> <div id="textContainer"> <h1> Text</h1> <textarea rows="10" cols="80"></textarea> </div> <a href="#" id="testLink">Test</a> <div id="log"> </div> </div> </body> </html> In the keyup binding, I can successfuly detect if I'm inside another element, and move the cursor to the front of the text before inserting it no problem. However, since there is no text before the element marked as 'notype', it gets inserted inside the same element. This is double bad when the user presses "enter", as a new tag is genrated, and the "notype" tag is duplicated, obviously not required. I want the behaviour as follows: * If the user types while the cursor is in the 'notype' tag, the cursor is moved to front and the text goes there * If the cursor is at the last position inside the 'notype' tag, then the text appears after the tag * If the user types anywhere else, it's inserted as always. The link at the bottom tries to manually put the cursor at the front and insert the html. Obviously fails. I know this one can work by doing something like $(g.iDoc.body).prepend("before!"), but this obviously won't work in a real scenario (using keyup).

    Read the article

  • Loading FireMonkey style resourses with RTTI

    - by HeMet
    I am trying to write class that inherits from FMX TStyledControl. When style is updated it loads style resource objects to cache. I created project group for package with custom controls and test FMX HD project as it describes in Delphi help. After installing package and placing TsgSlideHost on the test form I run test app. It’s work well, but when I close it and try to rebuild package RAD Studio says “Error in rtl160.bpl” or “invalid pointer operation”. It seems what problem in LoadToCacheIfNeeded procedure from TsgStyledControl, but I’m not understand why. Is there any restriction on using RTTI with FMX styles or anything? TsgStyledControl sources: unit SlideGUI.TsgStyledControl; interface uses System.SysUtils, System.Classes, System.Types, FMX.Types, FMX.Layouts, FMX.Objects, FMX.Effects, System.UITypes, FMX.Ani, System.Rtti, System.TypInfo; type TCachedAttribute = class(TCustomAttribute) private fStyleName: string; public constructor Create(const aStyleName: string); property StyleName: string read fStyleName; end; TsgStyledControl = class(TStyledControl) private procedure CacheStyleObjects; procedure LoadToCacheIfNeeded(aField: TRttiField); protected function FindStyleResourceAs<T: class>(const AStyleLookup: string): T; function GetStyleName: string; virtual; abstract; function GetStyleObject: TControl; override; public procedure ApplyStyle; override; published { Published declarations } end; implementation { TsgStyledControl } procedure TsgStyledControl.ApplyStyle; begin inherited; CacheStyleObjects; end; procedure TsgStyledControl.CacheStyleObjects; var ctx: TRttiContext; typ: TRttiType; fld: TRttiField; begin ctx := TRttiContext.Create; try typ := ctx.GetType(Self.ClassType); for fld in typ.GetFields do LoadFromCacheIfNeeded(fld); finally ctx.Free end; end; function TsgStyledControl.FindStyleResourceAs<T>(const AStyleLookup: string): T; var fmxObj: TFmxObject; begin fmxObj := FindStyleResource(AStyleLookup); if Assigned(fmxObj) and (fmxObj is T) then Result := fmxObj as T else Result := nil; end; function TsgStyledControl.GetStyleObject: TControl; var S: TResourceStream; begin if (FStyleLookup = '') then begin if FindRCData(HInstance, GetStyleName) then begin S := TResourceStream.Create(HInstance, GetStyleName, RT_RCDATA); try Result := TControl(CreateObjectFromStream(nil, S)); Exit; finally S.Free; end; end; end; Result := inherited GetStyleObject; end; procedure TsgStyledControl.LoadToCacheIfNeeded(aField: TRttiField); var attr: TCustomAttribute; styleName: string; styleObj: TFmxObject; val: TValue; begin for attr in aField.GetAttributes do begin if attr is TCachedAttribute then begin styleName := TCachedAttribute(attr).StyleName; if styleName <> '' then begin styleObj := FindStyleResource(styleName); val := TValue.From<TFmxObject>(styleObj); aField.SetValue(Self, val); end; end; end; end; { TCachedAttribute } constructor TCachedAttribute.Create(const aStyleName: string); begin fStyleName := aStyleName; end; end. Using of TsgStyledControl: type TsgSlideHost = class(TsgStyledControl) private [TCached('SlideHost')] fSlideHost: TLayout; [TCached('SideMenu')] fSideMenuLyt: TLayout; [TCached('SlideContainer')] fSlideContainer: TLayout; fSideMenu: IsgSideMenu; procedure ReapplyProps; procedure SetSideMenu(const Value: IsgSideMenu); protected function GetStyleName: string; override; function GetStyleObject: TControl; override; procedure UpdateSideMenuLyt; public constructor Create(AOwner: TComponent); override; procedure ApplyStyle; override; published property SideMenu: IsgSideMenu read fSideMenu write SetSideMenu; end;

    Read the article

  • SQL CLR Assembly Error 80131051 when late binding to a registered C# COM .dll

    - by Shanubus
    I must have hit an unusual one, because I can't find any reference to this specific failing anywhere... Scenario: I have a legacy SQL function used to transform(encrypt) data. This function is called from within many stored procedures used by multiple applications. I say this, because the obvious answer of 'just call it from your code' is not really an option (or at least one I'd prefer not explore). The legacy function used sp_OA with an ActiveX dll on SQL2000 to perform its work. The new function is targeted at SQL2008 x64. I am ditching the sp_OA call in favor of CLR assembly; and am getting rid of the ActiveX dll and using a COM+ .dll (3rd party) to perform the same work. This 3rd party COM+ is required to be used based on spec given to me, so can't get rid of this piece either. Problem: After multiple attempts at getting this to work I have eliminated the following approaches 1) Create a Sql Assembly to call the local COM+ directly -- Can't do this as it requires a reference to System.EnterpriseServices. Including this requires that a whole slew of unsupported assemblies be registered which I don't want. The COM+ requires it's methods to be accessed via an Interface, so my attempts at late binding to it directly have not been successful (late binding would allow me to drop the unsupported references). 2) Create a Sql Assembly which references a C# class library that then calls the COM+. -- Same issue as #1; since the referenced dll uses System.EnterpriseServices and will be added as a dependency when referenced in the Sql Assembly, again trying to load all the unsupported libraries 3) Create a Sql Assembly which late binds to an ActiveX COM dll that calls the COM+. -- Worked in my dev environment, but can't go to x64 in production with ActiveX dll's written in VB6 (not to mention I hate backtracking anyway)... again failure... I am now onto an approach that is almost working, with of course one last hangup. I now have -a Sql Assembly that late binds to a C# COM dll, eliminating the need for including System.EnterpriseServices and eliminating the need to reference the C# COM in the SqlAssembly itself. The C# COM does reference System.EnterpriseServices to call the COM+, but since I am late binding to it from the SqlAssembly, I bypass the need for Sql to actually load them as referenced assemblies. Works in debugger.. Works on my dev box when the SqlAssembly dll is referenced in a test console app and called directly Installs to Sql2008 just fine Executing the actual UDF works, but returns no data due to a failure reporting from the late bound dll! So the SqlAssembly is instanciated just fine. It actually fails on it's late binding to the C# COM, which is working from a test console app on the same machine. It appears to be a difference in behavior based on whether called from within the SQL UDF or not. Since it is working on the same box from my console app, I am assuming it's on the SQL side. My steps to install were. --Install the COM+ dll and ensure it can be called successfully (as from with in the console app) --Register the C# COM dll (which calls the COM+) and get it to the GAC (again proofed to be working from console app) --Create my Assymetric Key CREATE ASYMMETRIC KEY SqlCryptoKey FROM EXECUTABLE FILE = 'D:\SqlEx.dll' CREATE LOGIN SqlExLogin FROM ASYMMETRIC KEY SqlExKey GRANT UNSAFE ASSEMBLY TO SqlExLogin GO --Add the assembly CREATE ASSEMBLY SqlEx FROM 'D:\SqlEx.dll' WITH PERMISSION_SET = UNSAFE; GO --Create the function CREATE FUNCTION dbo.f_SqlEx( @clearText [nvarchar](512) ) RETURNS nvarchar(512) WITH EXECUTE AS CALLER AS EXTERNAL NAME SqlEx.[SqlEx.SqlEx].Ex GO With all that done, I can now call my function SELECT dbo.f_SqlEx('test') But get this error in the event log... Retrieving the COM class factory for component with CLSID {F69D6320-5884-323F-936A-7657946604BE} failed due to the following error: 80131051. I can't really provide direct code examples, due to internal security implications; but all the code itself seems to work, I am suspecting perms or something of the like... I just find it odd that I can't find any reference to error 80131051. If someone out there believe some 'indirect' code samples will help, I will be happy to provide. Any assistance is appreciated.

    Read the article

  • Uploadify Minimum Image Width And Height

    - by Richard Knop
    So I am using the Uplodify plugin to allow users to upload multiple images at once. The problem is I need to set a minimum width and height for images. Let's say 150x150px is the smallest image users can upload. How can I set this limitation in the Uploadify plugin? When user tries to upload smaller picture, I would like to display some error message as well. Here is the PHP file that is called bu the plugin to upload images: <?php define('BASE_PATH', substr(dirname(dirname(__FILE__)), 0, -22)); // set the include path set_include_path(BASE_PATH . '/../library' . PATH_SEPARATOR . BASE_PATH . '/library' . PATH_SEPARATOR . get_include_path()); // autoload classes from the library function __autoload($class) { include str_replace('_', '/', $class) . '.php'; } $configuration = new Zend_Config_Ini(BASE_PATH . '/application' . '/configs/application.ini', 'development'); $dbAdapter = Zend_Db::factory($configuration->database); Zend_Db_Table_Abstract::setDefaultAdapter($dbAdapter); function _getTable($table) { include BASE_PATH . '/application/modules/default/models/' . $table . '.php'; return new $table(); } $albums = _getTable('Albums'); $media = _getTable('Media'); if (false === empty($_FILES)) { $tempFile = $_FILES['Filedata']['tmp_name']; $extension = end(explode('.', $_FILES['Filedata']['name'])); // insert temporary row into the database $data = array(); $data['type'] = 'photo'; $data['type2'] = 'public'; $data['status'] = 'temporary'; $data['user_id'] = $_REQUEST['user_id']; $paths = $media->add($data, $extension, $dbAdapter); // save the photo move_uploaded_file($tempFile, BASE_PATH . '/public/' . $paths[0]); // create a thumbnail include BASE_PATH . '/library/My/PHPThumbnailer/ThumbLib.inc.php'; $thumb = PhpThumbFactory::create(BASE_PATH . '/public/' . $paths[0]); $thumb->adaptiveResize(85, 85); $thumb->save(BASE_PATH . '/public/' . $paths[1]); // add watermark to the bottom right corner $pathToFullImage = BASE_PATH . '/public/' . $paths[0]; $size = getimagesize($pathToFullImage); switch ($extension) { case 'gif': $im = imagecreatefromgif($pathToFullImage); break; case 'jpg': $im = imagecreatefromjpeg($pathToFullImage); break; case 'png': $im = imagecreatefrompng($pathToFullImage); break; } if (false !== $im) { $white = imagecolorallocate($im, 255, 255, 255); $font = BASE_PATH . '/public/fonts/arial.ttf'; imagefttext($im, 13, // font size 0, // angle $size[0] - 132, // x axis (top left is [0, 0]) $size[1] - 13, // y axis $white, $font, 'HunnyHive.com'); switch ($extension) { case 'gif': imagegif($im, $pathToFullImage); break; case 'jpg': imagejpeg($im, $pathToFullImage, 100); break; case 'png': imagepng($im, $pathToFullImage, 0); break; } imagedestroy($im); } echo "1"; } And here's the javascript: $(document).ready(function() { $('#photo').uploadify({ 'uploader' : '/flash-uploader/scripts/uploadify.swf', 'script' : '/flash-uploader/scripts/upload-public-photo.php', 'cancelImg' : '/flash-uploader/cancel.png', 'scriptData' : {'user_id' : 'USER_ID'}, 'queueID' : 'fileQueue', 'auto' : true, 'multi' : true, 'sizeLimit' : 2097152, 'fileExt' : '*.jpg;*.jpeg;*.gif;*.png', 'wmode' : 'transparent', 'onComplete' : function() { $.get('/my-account/temporary-public-photos', function(data) { $('#temporaryPhotos').html(data); }); } }); $('#upload_public_photo').hover(function() { var titles = '{'; $('.title').each(function() { var title = $(this).val(); if ('Title...' != title) { var id = $(this).attr('name'); id = id.substr(5); title = jQuery.trim(title); if (titles.length > 1) { titles += ','; } titles += '"' + id + '"' + ':"' + title + '"'; } }); titles += '}'; $('#titles').val(titles); }); }); Now bear in mind that I know how to check images dimensions in the PHP file. But I'm not sure how to modify the javascript so it won't upload images with very small dimensions.

    Read the article

  • CURL Authentication being lost?

    - by John Sloan
    I am authenticating a login via CURL just fine. I have a variable I am using to display the returned HTML, and it is returning my user control panel as if I am logged in. After authenticating, I want to communicate variables with a form on another page within the site; but for some reason the HTML from that page is returning a non-authenticated version of the header (as if the original authentication never took place.) I have a cookies.txt file with 777 permissions, and have tried just getting the contents of the same page shown when I authenticate and it is as if I am losing any associated session/cookie data somewhere along the way. Here is my curl.class file - <? class Curl { public $cookieJar = ""; // Make sure the cookies.txt file is read/write permissions public function __construct($cookieJarFile = 'cookies.txt') { $this->cookieJar = $cookieJarFile; } function setup() { $header = array(); $header[0] = "Accept: text/xml,application/xml,application/xhtml+xml,"; $header[0] .= "text/html;q=0.9,text/plain;q=0.8,image/png,*/*;q=0.5"; $header[] = "Cache-Control: max-age=0"; $header[] = "Connection: keep-alive"; $header[] = "Keep-Alive: 300"; $header[] = "Accept-Charset: ISO-8859-1,utf-8;q=0.7,*;q=0.7"; $header[] = "Accept-Language: en-us,en;q=0.5"; $header[] = "Pragma: "; // browsers keep this blank. curl_setopt($this->curl, CURLOPT_USERAGENT, 'Mozilla/5.0 (Windows; U; Windows NT 5.2; en-US; rv:1.8.1.7) Gecko/20070914 Firefox/2.0.0.7'); curl_setopt($this->curl, CURLOPT_HTTPHEADER, $header); curl_setopt($this->curl, CURLOPT_COOKIEJAR, $this->cookieJar); curl_setopt($this->curl, CURLOPT_COOKIEFILE, $this->cookieJar); curl_setopt($this->curl, CURLOPT_AUTOREFERER, true); curl_setopt($this->curl, CURLOPT_COOKIESESSION, true); curl_setopt($this->curl, CURLOPT_FOLLOWLOCATION, true); curl_setopt($this->curl, CURLOPT_RETURNTRANSFER, true); } function get($url) { $this->curl = curl_init($url); $this->setup(); return $this->request(); } function getAll($reg, $str) { preg_match_all($reg, $str, $matches); return $matches[1]; } function postForm($url, $fields, $referer = '') { $this->curl = curl_init($url); $this->setup(); curl_setopt($this->curl, CURLOPT_URL, $url); curl_setopt($this->curl, CURLOPT_POST, 1); curl_setopt($this->curl, CURLOPT_REFERER, $referer); curl_setopt($this->curl, CURLOPT_POSTFIELDS, $fields); return $this->request(); } function getInfo($info) { $info = ($info == 'lasturl') ? curl_getinfo($this->curl, CURLINFO_EFFECTIVE_URL) : curl_getinfo($this->curl, $info); return $info; } function request() { return curl_exec($this->curl); } } ?> And here is my curl.php file - <? include('curl.class.php'); // This path would change to where you store the file $curl = new Curl(); $url = "http://www.site.com/public/member/signin"; $fields = "MAX_FILE_SIZE=50000000&dado_form_3=1&member[email]=email&member[password]=pass&x=16&y=5&member[persistent]=true"; // Calling URL $referer = "http://www.site.com/public/member/signin"; $html = $curl->postForm($url, $fields, $referer); echo($html); ?> <hr style="clear:both;"/> <? $html = $curl->postForm('http://www.site.com/index.php','nid=443&sid=733005&tab=post&eval=yes&ad=&MAX_FILE_SIZE=10000000&ip=63.225.235.30','http://www.site.com/public/member/signin'); echo $html; // This will show you the HTML of the current page you and logged into ?> Any ideas?

    Read the article

  • Increase efficiency of a loop with jQuery

    - by Pez Cuckow
    I have a game coded in jQuery where bots are moved around the screen. The below code is a loop that runs every 20ms, currently if you have over 15 bots you start to notice the browser lagging (simply because of all the advanced collision detection going on). Is there any way to reduce the lag, can I make it any more efficient? P.s. sorrry for just posting a block of code, I can't see a way to make my point clear enough without! $.playground().registerCallback(function(){ //Movement Loop if(!pause) { for (var i in bots) { //bots - color, dir, x, y, z, spawned?, spawnerid, prevd var self = $('#b' + i); var current = bots[i]; if(bots[i][5]==1) { var xspeed = 0, yspeed = 0; if(current[1]==0) { yspeed = -D_SPEED; } else if(current[1]==1) { xspeed = D_SPEED; } else if(current[1]==2) { yspeed = D_SPEED; } else if(current[1]==3) { xspeed = -D_SPEED; } var x = current[2] + xspeed; var y = current[3] + yspeed; var z = current[3] + 120; if(current[2]>0&&x>PLAYGROUND_WIDTH||current[2]<0&&x<-GRID_SIZE|| current[3]>0&&y>PLAYGROUND_HEIGHT||current[3]<0&&y<-GRID_SIZE) { remove_bot(i, self); } else { if(current[7]!=current[1]) { self.setAnimation(colors[current[0]][current[1]]); bots[i][7] = current[1]; } if(self.css({"left": ""+(x)+"px", "top": ""+(y)+"px", "z-index": z})) { bots[i][2] = x; bots[i][3] = y; bots[i][4] = z; bots[i][8]++; } } } } $("#debug").html(dump(arrows)); $(".bot").each(function(){ var b_id = $(this).attr("id").substr(1); var collision = false; var c_bot = bots[b_id]; var b_x = c_bot[2]; var b_y = c_bot[3]; var b_d = c_bot[1]; $(this).collision(".arrow,#arrows").each(function(){ //Many thanks to Selim Arsever for this fix! var a_id = $(this).attr("id").substr(1); var piece = arrows[a_id]; var a_v = piece[0]; if(a_v==1) { var a_x = piece[2]; var a_y = piece[3]; var d_x = b_x-a_x; var d_y = b_y-a_y; if(d_x>=4&&d_x<=5&&d_y>=1&&d_y<=2) { //bots - color, dir, x, y, z, spawned?, spawnerid, prevd bots[b_id][7] = c_bot[1]; bots[b_id][1] = piece[1]; collision = true; } } }); if(!collision) { $(this).collision(".wall,#level").each(function(){ var w_id = $(this).attr("id").substr(1); var piece = pieces[w_id]; var w_x = piece[1]; var w_y = piece[2]; d_x = b_x-w_x; d_y = b_y-w_y; if(b_d==0&&d_x>=4&&d_x<=5&&d_y>=27&&d_y<=28) { kill_bot(b_id); collision = true; } //4 // 33 if(b_d==1&&d_x>=-12&&d_x<=-11&&d_y>=21&&d_y<=22) { kill_bot(b_id); collision = true; } //-14 // 21 if(b_d==2&&d_x>=4&&d_x<=5&&d_y>=-9&&d_y<=-8) { kill_bot(b_id); collision = true; } //4 // -9 if(b_d==3&&d_x>=22&&d_x<=23&&d_y>=20&&d_y<=21) { kill_bot(b_id); collision = true; } //22 // 21 }); } if(!collision&&c_bot[8]>GRID_MOVE) { $(this).collision(".spawn,#level").each(function(){ var s_id = $(this).attr("id").substr(1); var piece = pieces[s_id]; var s_x = piece[1]; var s_y = piece[2]; d_x = b_x-s_x; d_y = b_y-s_y; if(b_d==0&&d_x>=4&&d_x<=5&&d_y>=19&&d_y<=20) { kill_bot(b_id); collision = true; } //4 // 33 if(b_d==1&&d_x>=-14&&d_x<=-13&&d_y>=11&&d_y<=12) { kill_bot(b_id); collision = true; } //-14 // 21 if(b_d==2&&d_x>=4&&d_x<=5&&d_y>=-11&&d_y<=-10) { kill_bot(b_id); collision = true; } //4 // -9 if(b_d==3&&d_x>=22&&d_x<=23&&d_y>=11&&d_y<=12) { kill_bot(b_id); collision = true; } //22 // 21*/ }); } if(!collision) { $(this).collision(".exit,#level").each(function(){ var e_id = $(this).attr("id").substr(1); var piece = pieces[e_id]; var e_x = piece[1]; var e_y = piece[2]; d_x = b_x-e_x; d_y = b_y-e_y; if(d_x>=4&&d_x<=5&&d_y>=1&&d_y<=2) { current_bots++; bots[b_id] = false; $("#current_bots").html(current_bots); $("#b" + b_id).setAnimation(exit[2], function(node){$(node).fadeOut(200)}); } }); } if(!collision) { $(this).collision(".bot,#level").each(function(){ var bd_id = $(this).attr("id").substr(1); if(bd_id!=b_id) { var piece = bots[bd_id]; var bd_x = piece[2]; var bd_y = piece[3]; d_x = b_x-bd_x; d_y = b_y-bd_y; if(d_x>=0&&d_x<=2&&d_y>=0&&d_y<=2) { kill_bot(b_id); kill_bot(bd_id); collision = true; } } }); } }); } }, REFRESH_RATE); Many thanks,

    Read the article

  • Generic Aggregation of C++ Objects by Attribute When Attribute Name is Unknown at Runtime

    - by stretch
    I'm currently implementing a system with a number of class's representing objects such as client, business, product etc. Standard business logic. As one might expect each class has a number of standard attributes. I have a long list of essentially identical requirements such as: the ability to retrieve all business' whose industry is manufacturing. the ability to retrieve all clients based in London Class business has attribute sector and client has attribute location. Clearly this a relational problem and in pseudo SQL would look something like: SELECT ALL business in business' WHERE sector == manufacturing Unfortunately plugging into a DB is not an option. What I want to do is have a single generic aggregation function whose signature would take the form: vector<generic> genericAggregation(class, attribute, value); Where class is the class of object I want to aggregate, attribute and value being the class attribute and value of interest. In my example I've put vector as return type, but this wouldn't work. Probably better to declare a vector of relevant class type and pass it as an argument. But this isn't the main problem. How can I accept arguments in string form for class, attribute and value and then map these in a generic object aggregation function? Since it's rude not to post code, below is a dummy program which creates a bunch of objects of imaginatively named classes. Included is a specific aggregation function which returns a vector of B objects whose A object is equal to an id specified at the command line e.g. .. $ ./aggregations 5 which returns all B's whose A objects 'i' attribute is equal to 5. See below: #include <iostream> #include <cstring> #include <sstream> #include <vector> using namespace std; //First imaginativly names dummy class class A { private: int i; double d; string s; public: A(){} A(int i, double d, string s) { this->i = i; this->d = d; this->s = s; } ~A(){} int getInt() {return i;} double getDouble() {return d;} string getString() {return s;} }; //second imaginativly named dummy class class B { private: int i; double d; string s; A *a; public: B(int i, double d, string s, A *a) { this->i = i; this->d = d; this->s = s; this->a = a; } ~B(){} int getInt() {return i;} double getDouble() {return d;} string getString() {return s;} A* getA() {return a;} }; //Containers for dummy class objects vector<A> a_vec (10); vector<B> b_vec;//100 //Util function, not important.. string int2string(int number) { stringstream ss; ss << number; return ss.str(); } //Example function that returns a new vector containing on B objects //whose A object i attribute is equal to 'id' vector<B> getBbyA(int id) { vector<B> result; for(int i = 0; i < b_vec.size(); i++) { if(b_vec.at(i).getA()->getInt() == id) { result.push_back(b_vec.at(i)); } } return result; } int main(int argc, char** argv) { //Create some A's and B's, each B has an A... //Each of the 10 A's are associated with 10 B's. for(int i = 0; i < 10; ++i) { A a(i, (double)i, int2string(i)); a_vec.at(i) = a; for(int j = 0; j < 10; j++) { B b((i * 10) + j, (double)j, int2string(i), &a_vec.at(i)); b_vec.push_back(b); } } //Got some objects so lets do some aggregation //Call example aggregation function to return all B objects //whose A object has i attribute equal to argv[1] vector<B> result = getBbyA(atoi(argv[1])); //If some B's were found print them, else don't... if(result.size() != 0) { for(int i = 0; i < result.size(); i++) { cout << result.at(i).getInt() << " " << result.at(i).getA()->getInt() << endl; } } else { cout << "No B's had A's with attribute i equal to " << argv[1] << endl; } return 0; } Compile with: g++ -o aggregations aggregations.cpp If you wish :) Instead of implementing a separate aggregation function (i.e. getBbyA() in the example) I'd like to have a single generic aggregation function which accounts for all possible class attribute pairs such that all aggregation requirements are met.. and in the event additional attributes are added later, or additional aggregation requirements, these will automatically be accounted for. So there's a few issues here but the main one I'm seeking insight into is how to map a runtime argument to a class attribute. I hope I've provided enough detail to adequately describe what I'm trying to do...

    Read the article

  • How to set the skin of a DotNetNuke page through code?

    - by ks78
    I'm working on a DNN module that creates DNN pages (tabs) and places DNN modules on them through code. So, far that's working very well. However, I'd like it to also be able to programmatically set the page's skin and place the modules in the appropriate pane. Does anyone know how to do this using code? Solution: I set SkinSrc and ContainerSrc as mika suggested. Here's my source, if you're interested. This is where I set SkinSrc. ''' <summary>Create new DNN tab/page.</summary> Private Function CreatePage(ByVal ParentID As Integer, ByVal PageName As String, ByVal PageTitle As String, ByVal Description As String, ByVal Keywords As String, ByVal Permissions As TabPermissionCollection, Optional ByVal SkinSrc As String = "", Optional ByVal isVisible As Boolean = True, Optional ByVal LoadDefaultModules As Boolean = True) As Tabs.TabInfo Try Dim tabCtrlr As New TabController Dim newTab As New Tabs.TabInfo Dim newPermissions As TabPermissionCollection = newTab.TabPermissions Dim permissionProvider As PermissionProvider = permissionProvider.Instance Dim infPermission As TabPermissionInfo ' set new page properties newTab.PortalID = PortalId newTab.TabName = PageName newTab.Title = PageTitle newTab.Description = Description newTab.KeyWords = Keywords newTab.IsDeleted = False newTab.IsSuperTab = False newTab.IsVisible = isVisible newTab.DisableLink = False newTab.IconFile = "" newTab.Url = "" newTab.ParentId = ParentID 'add skinsrc if specified If (SkinSrc.Length > 0) Then newTab.SkinSrc = SkinSrc ' create new page tabCtrlr.AddTab(newTab, LoadDefaultModules) ' copy permissions selected in Permissions collection For index As Integer = 0 To (Permissions.Count - 1) infPermission = New TabPermissionInfo infPermission.AllowAccess = Permissions(index).AllowAccess infPermission.RoleID = Permissions(index).RoleID infPermission.RoleName = Permissions(index).RoleName infPermission.TabID = Permissions(index).TabID infPermission.PermissionID = Permissions(index).PermissionID 'save permission info newPermissions.Add(infPermission, True) permissionProvider.SaveTabPermissions(newTab) Next index 'return TabInfo of new page Return newTab Catch ex As Exception 'failure Return New Tabs.TabInfo End Try End Function These next two functions were taken from the DNN source and tweaked slightly, so I can't take credit for much of them. Also, if you use these in your own modules there could be issues when upgrading DNN. Although the upgrade from 5.05 to 5.06 went smoothly for me. In the AddNewModule function, I used ContainerSrc to specify the custom container to use. PaneName is the property used to specify which panel the module should be placed in. #Region "From DNN Source --mostly" #Region "Enums" Private Enum ViewPermissionType View = 0 Edit = 1 End Enum #End Region ''' ----------------------------------------------------------------------------- ''' <summary>Adds a New Module to a Pane</summary> ''' <param name="align">The alignment for the Module</param> ''' <param name="desktopModuleId">The Id of the DesktopModule</param> ''' <param name="permissionType">The View Permission Type for the Module</param> ''' <param name="title">The Title for the resulting module</param> ''' <param name="paneName">The pane to add the module to</param> ''' <param name="position">The relative position within the pane for the module</param> ''' ----------------------------------------------------------------------------- Private Function AddNewModule(ByVal TabID As Integer, ByVal title As String, ByVal desktopModuleId As Integer, ByVal paneName As String, ByVal position As Integer, ByVal permissionType As ViewPermissionType, ByVal align As String) As Integer Dim objTabController As New TabController Dim objTabPermissions As TabPermissionCollection = objTabController.GetTab(TabID, PortalId, True).TabPermissions Dim objPermissionController As New PermissionController Dim objModules As New ModuleController Dim objModuleDefinition As ModuleDefinitionInfo Dim objEventLog As New Services.Log.EventLog.EventLogController Dim newModuleID As Integer Dim j As Integer Try Dim desktopModule As DesktopModuleInfo = Nothing If Not DesktopModuleController.GetDesktopModules(PortalSettings.PortalId).TryGetValue(desktopModuleId, desktopModule) Then Throw New ArgumentException("desktopModuleId") End If Catch ex As Exception LogException(ex) End Try Dim UserId As Integer = -1 If Request.IsAuthenticated Then Dim objUserInfo As Users.UserInfo = UserController.GetCurrentUserInfo UserId = objUserInfo.UserID End If For Each objModuleDefinition In ModuleDefinitionController.GetModuleDefinitionsByDesktopModuleID(desktopModuleId).Values Dim objModule As New ModuleInfo objModule.Initialize(PortalSettings.PortalId) objModule.PortalID = PortalSettings.PortalId objModule.TabID = TabID objModule.ModuleOrder = position If title = "" Then objModule.ModuleTitle = objModuleDefinition.FriendlyName Else objModule.ModuleTitle = title End If objModule.PaneName = paneName objModule.ModuleDefID = objModuleDefinition.ModuleDefID If objModuleDefinition.DefaultCacheTime > 0 Then objModule.CacheTime = objModuleDefinition.DefaultCacheTime If Portals.PortalSettings.Current.DefaultModuleId > Null.NullInteger AndAlso Portals.PortalSettings.Current.DefaultTabId > Null.NullInteger Then Dim defaultModule As ModuleInfo = objModules.GetModule(Portals.PortalSettings.Current.DefaultModuleId, Portals.PortalSettings.Current.DefaultTabId, True) If Not defaultModule Is Nothing Then objModule.CacheTime = defaultModule.CacheTime End If End If End If Select Case permissionType Case ViewPermissionType.View objModule.InheritViewPermissions = True Case ViewPermissionType.Edit objModule.InheritViewPermissions = False End Select ' get the default module view permissions Dim arrSystemModuleViewPermissions As ArrayList = objPermissionController.GetPermissionByCodeAndKey("SYSTEM_MODULE_DEFINITION", "VIEW") ' get the permissions from the page For Each objTabPermission As TabPermissionInfo In objTabPermissions If objTabPermission.PermissionKey = "VIEW" AndAlso permissionType = ViewPermissionType.View Then 'Don't need to explicitly add View permisisons if "Same As Page" Continue For End If ' get the system module permissions for the permissionkey Dim arrSystemModulePermissions As ArrayList = objPermissionController.GetPermissionByCodeAndKey("SYSTEM_MODULE_DEFINITION", objTabPermission.PermissionKey) ' loop through the system module permissions For j = 0 To arrSystemModulePermissions.Count - 1 ' create the module permission Dim objSystemModulePermission As PermissionInfo objSystemModulePermission = CType(arrSystemModulePermissions(j), PermissionInfo) If objSystemModulePermission.PermissionKey = "VIEW" AndAlso permissionType = ViewPermissionType.Edit AndAlso _ objTabPermission.PermissionKey <> "EDIT" Then 'Only Page Editors get View permissions if "Page Editors Only" Continue For End If Dim objModulePermission As ModulePermissionInfo = AddModulePermission(objModule, _ objSystemModulePermission, _ objTabPermission.RoleID, objTabPermission.UserID, _ objTabPermission.AllowAccess) ' ensure that every EDIT permission which allows access also provides VIEW permission If objModulePermission.PermissionKey = "EDIT" And objModulePermission.AllowAccess Then Dim objModuleViewperm As ModulePermissionInfo = AddModulePermission(objModule, _ CType(arrSystemModuleViewPermissions(0), PermissionInfo), _ objModulePermission.RoleID, objModulePermission.UserID, _ True) End If Next 'Get the custom Module Permissions, Assume that roles with Edit Tab Permissions 'are automatically assigned to the Custom Module Permissions If objTabPermission.PermissionKey = "EDIT" Then Dim arrCustomModulePermissions As ArrayList = objPermissionController.GetPermissionsByModuleDefID(objModule.ModuleDefID) ' loop through the custom module permissions For j = 0 To arrCustomModulePermissions.Count - 1 ' create the module permission Dim objCustomModulePermission As PermissionInfo objCustomModulePermission = CType(arrCustomModulePermissions(j), PermissionInfo) AddModulePermission(objModule, objCustomModulePermission, _ objTabPermission.RoleID, objTabPermission.UserID, _ objTabPermission.AllowAccess) Next End If Next objModule.AllTabs = False objModule.Alignment = align 'apply Custom Container to module objModule.ContainerSrc = CONTAINER_TRANSPARENT_PLAIN newModuleID = objModules.AddModule(objModule) Next Return newModuleID End Function ''' ----------------------------------------------------------------------------- ''' <summary>Adds a Module Permission</summary> ''' <param name="permission">The permission to add</param> ''' <param name="roleId">The Id of the role to add the permission for.</param> ''' ----------------------------------------------------------------------------- Private Function AddModulePermission(ByVal objModule As ModuleInfo, ByVal permission As PermissionInfo, ByVal roleId As Integer, ByVal userId As Integer, ByVal allowAccess As Boolean) As ModulePermissionInfo Dim objModulePermission As New ModulePermissionInfo objModulePermission.ModuleID = objModule.ModuleID objModulePermission.PermissionID = permission.PermissionID objModulePermission.RoleID = roleId objModulePermission.UserID = userId objModulePermission.PermissionKey = permission.PermissionKey objModulePermission.AllowAccess = allowAccess ' add the permission to the collection If Not objModule.ModulePermissions.Contains(objModulePermission) Then objModule.ModulePermissions.Add(objModulePermission) End If Return objModulePermission End Function #End Region

    Read the article

  • How to get javascript object references or reference count?

    - by Tauren
    How to get reference count for an object Is it possible to determine if a javascript object has multiple references to it? Or if it has references besides the one I'm accessing it with? Or even just to get the reference count itself? Can I find this information from javascript itself, or will I need to keep track of my own reference counters. Obviously, there must be at least one reference to it for my code access the object. But what I want to know is if there are any other references to it, or if my code is the only place it is accessed. I'd like to be able to delete the object if nothing else is referencing it. If you know the answer, there is no need to read the rest of this question. Below is just an example to make things more clear. Use Case In my application, I have a Repository object instance called contacts that contains an array of ALL my contacts. There are also multiple Collection object instances, such as friends collection and a coworkers collection. Each collection contains an array with a different set of items from the contacts Repository. Sample Code To make this concept more concrete, consider the code below. Each instance of the Repository object contains a list of all items of a particular type. You might have a repository of Contacts and a separate repository of Events. To keep it simple, you can just get, add, and remove items, and add many via the constructor. var Repository = function(items) { this.items = items || []; } Repository.prototype.get = function(id) { for (var i=0,len=this.items.length; i<len; i++) { if (items[i].id === id) { return this.items[i]; } } } Repository.prototype.add = function(item) { if (toString.call(item) === "[object Array]") { this.items.concat(item); } else { this.items.push(item); } } Repository.prototype.remove = function(id) { for (var i=0,len=this.items.length; i<len; i++) { if (items[i].id === id) { this.removeIndex(i); } } } Repository.prototype.removeIndex = function(index) { if (items[index]) { if (/* items[i] has more than 1 reference to it */) { // Only remove item from repository if nothing else references it this.items.splice(index,1); return; } } } Note the line in remove with the comment. I only want to remove the item from my master repository of objects if no other objects have a reference to the item. Here's Collection: var Collection = function(repo,items) { this.repo = repo; this.items = items || []; } Collection.prototype.remove = function(id) { for (var i=0,len=this.items.length; i<len; i++) { if (items[i].id === id) { // Remove object from this collection this.items.splice(i,1); // Tell repo to remove it (only if no other references to it) repo.removeIndxe(i); return; } } } And then this code uses Repository and Collection: var contactRepo = new Repository([ {id: 1, name: "Joe"}, {id: 2, name: "Jane"}, {id: 3, name: "Tom"}, {id: 4, name: "Jack"}, {id: 5, name: "Sue"} ]); var friends = new Collection( contactRepo, [ contactRepo.get(2), contactRepo.get(4) ] ); var coworkers = new Collection( contactRepo, [ contactRepo.get(1), contactRepo.get(2), contactRepo.get(5) ] ); contactRepo.items; // contains item ids 1, 2, 3, 4, 5 friends.items; // contains item ids 2, 4 coworkers.items; // contains item ids 1, 2, 5 coworkers.remove(2); contactRepo.items; // contains item ids 1, 2, 3, 4, 5 friends.items; // contains item ids 2, 4 coworkers.items; // contains item ids 1, 5 friends.remove(4); contactRepo.items; // contains item ids 1, 2, 3, 5 friends.items; // contains item ids 2 coworkers.items; // contains item ids 1, 5 Notice how coworkers.remove(2) didn't remove id 2 from contactRepo? This is because it was still referenced from friends.items. However, friends.remove(4) causes id 4 to be removed from contactRepo, because no other collection is referring to it. Summary The above is what I want to do. I'm sure there are ways I can do this by keeping track of my own reference counters and such. But if there is a way to do it using javascript's built-in reference management, I'd like to hear about how to use it.

    Read the article

  • Wiring up JavaScript handlers after a Partial Postback in ASP.NET

    - by Richard
    I am trying to use LinkButtons with the DefaultButton property of the ASP.NET Panel in an UpdatePanel. I have read and used the various other answers that are around describing the wiring up of the click event so that a full postback is not done instead of a partial postback. When the page loads, I wire up the .click function of the LinkButton so that the DefaultButton property of the ASP.NET panel will work. This all works fine, until you bring an UpdatePanel into the mix. With an UpdatePanel, if there is a partial postback, the script to wire up the .click function is not called in the partial postback, and hitting enter reverts to causing a full submit of the form rather than triggering the LinkButton. How can I cause javascript to be executed after a partial postback to re-wire up the .click function of the LinkButton? I have produced a sample page which shows the problem. There are two alerts showing 1) When the code to hook up the .click function is being called, and 2) When the .click function has been called (this only happens when you hit enter in the textbox after the event has been wired up). To test this code, type something in the textbox and hit Enter. The text will be copied to the label control, but "Wiring up Event Click" alert will not be shown. Add another letter, hit enter again, and you'll get a full postback without the text being copied to the label control (as the LinkButton wasn't called). Because that was a full postback, the Wiring Up Event Click event will be called again, and the form will work properly the next time again. This is being done with ASP.NET 3.5. Test Case Code: <%@ Page Language="C#" Inherits="System.Web.UI.Page" Theme="" EnableTheming="false" AutoEventWireup="true" %> <script runat="server"> void cmdComplete_Click(object sender, EventArgs e) { lblOutput.Text = "Complete Pressed: " + txtInput.Text; } void cmdFirstButton_Click(object sender, EventArgs e) { lblOutput.Text = "First Button Pressed"; } protected override void OnLoad(EventArgs e) { HookupButton(cmdComplete); } void HookupButton(LinkButton button) { // Use the click event of the LinkButton to trigger the postback (this is used by the .click code below) button.OnClientClick = Page.ClientScript.GetPostBackEventReference(button, String.Empty); // Wire up the .click event of the button to call the onclick function, and prevent a form submit string clickString = string.Format(@" alert('Wiring up click event'); document.getElementById('{0}').click = function() {{ alert('Default button pressed'); document.getElementById('{0}').onclick(); }};", button.ClientID, Page.ClientScript.GetPostBackEventReference(button, "")); Page.ClientScript.RegisterStartupScript(button.GetType(), "click_hookup_" + button.ClientID, clickString, true); } </script> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html> <head> <title>DefaultButton/LinkButton Testing</title> <style type="text/css"> a.Button { line-height: 2em; padding: 5px; border: solid 1px #CCC; background-color: #EEE; } </style> </head> <body> <h1> DefaultButton/LinkButton Testing</h1> <form runat="server"> <asp:ScriptManager runat="server" /> <asp:UpdatePanel ID="UpdatePanel1" runat="server"> <ContentTemplate> <div style="position: relative"> <fieldset> <legend>Output</legend> <asp:Label runat="server" ID="lblOutput" /> </fieldset> <asp:Button runat="server" Text="First Button" ID="cmdFirstButton" OnClick="cmdFirstButton_Click" UseSubmitBehavior="false" /> <asp:Panel ID="Panel1" runat="server" DefaultButton="cmdComplete"> <label> Enter Text:</label> <asp:TextBox runat="server" ID="txtInput" /> <asp:LinkButton runat="server" CssClass="Button" ID="cmdComplete" OnClick="cmdComplete_Click" Text="Complete" /> </asp:Panel> </div> </ContentTemplate> </asp:UpdatePanel> <asp:Button runat="server" ID="cmdFullPostback" Text="Full Postback" /> </form> </body> </html>

    Read the article

< Previous Page | 361 362 363 364 365 366 367 368 369 370 371 372  | Next Page >