Search Results

Search found 11409 results on 457 pages for 'large teams'.

Page 367/457 | < Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >

  • What are the limitations of the .NET Assembly format?

    - by McKAMEY
    We just ran into an interesting issue that I've not experienced before. We have a large scale production ASP.NET 3.5 SP1 Web App Project in Visual Studio 2008 SP1 which gets compiled and deployed using a Website Deployment Project. Everything has worked fine for the last year, until after a check-in yesterday the app started critically failing with BadImageFormatException. The check-in in question doesn't change anything particularly special and the errors are coming from areas of the app not even changed. Using Reflector we inspected the offending methods to find that there were garbage strings in the code (which Reflector humorously interpreted as Chinese characters). We have consistently reproduced this on several machines so it does not appear to be hardware related. Further inspection showed that those garbage strings did not exist in the Assemblies used as inputs to aspnet_merge.exe during deployment. Web Deployment Project Output Assemblies Properties: Merge all outputs to a single assembly Merge each individual folder output to its own assembly Merge all pages and control outputs to a single assembly Create a separate assembly for each page and control output In the web deployment project properties if we set the merge options to the first option ("Merge all outputs to a single assembly") we experience the issue, yet all of the other options work perfectly! So my question: does anyone know why this is happening? Is there a size-limit to aspnet_merge.exe's capabilities (the resulting merged DLL is around 19.3 MB)? Are there any other known issues with merging the output of WAPs? I would love it if any Assembly format / aspnet_merge gurus know about any such limitations like this. Seems to me like a 25MB Assembly, while big, isn't outrageous. Less disk to hit if it is all pregen'd stuff.

    Read the article

  • How to temporarily replace one primitive type with another when compiling to different targets in c#

    - by Keith
    How to easily/quickly replace float's for doubles (for example) for compiling to two different targets using these two particular choices of primitive types? Discussion: I have a large amount of c# code under development that I need to compile to alternatively use float, double or decimals depending on the use case of the target assembly. Using something like “class MYNumber : Double” so that it is only necessary to change one line of code does not work as Double is sealed, and obviously there is no #define in C#. Peppering the code with #if #else statements is also not an option, there is just too much supporting Math operators/related code using these particular primitive types. I am at a loss on how to do this apparently simple task, thanks! Edit: Just a quick comment in relation to boxing mentioned in Kyles reply: Unfortunately I need to avoid boxing, mainly since float's are being chosen when maximum speed is required, and decimals when maximum accuracy is the priority (and taking the 20x+ performance hit is acceptable). Boxing would probably rules out decimals as a valid choice and defeat the purpose somewhat. Edit2: For reference, those suggesting generics as a possible answer to this question note that there are many issues which count generics out (at least for our needs). For an overview and further references see Using generics for calculations

    Read the article

  • Amazon S3 and swfaddress

    - by justinbach
    I recently migrated a large AS3 site (lots of swfs, lots of flvs) to Amazon S3. Pretty much everything but HTML and JS files is being stored/served from Amazon, and it's working well. The only problem I'm having is that I built the site using SWFaddress (actually, via the Gaia framework which uses SWFaddress), and for some reason, SWFaddress is no longer updating the address bar correctly as users navigate from page to page. In other words, the URL persistently remains http://www.mysite.com, not http://www.mysite.com/#/section as would be the case were SWFaddress functioning correctly (and as it was functioning prior to the migration). Stranger yet, if I go to (e.g.) http://www.mysite.com/#/section directly, the deeplinking functions as you'd expect--I arrive directly at the correct section. However, navigating away from that section doesn't have any effect on the address bar, despite the fact that it should be dynamically updated. I've got a crossdomain.xml file set up on the site that allows access from all domains, so that's not the issue, and I don't know what else might be. Any ideas would be greatly appreciated! P.S. I integrated S3 by putting pretty much the entire site in an S3 bucket and then just changing the initial swfobject embed to point to the S3 instance of main.swf, passing in the S3 path as the "base" param to the embedded swf so that all dynamically loaded assets and swfs would also be sourced from s3. Dunno if that's related to the troubles I'm having.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Ideal Multi-Developer Lamp Stack?

    - by devians
    I would like to build an 'ideal' lamp development stack. Dual Server (Virtualised, ESX) Apache / PHP on one, Databases (MySQL, PgSQL, etc) on the other. User (Developer) Manageable mini environments, or instance. Each developer instance shares the top level config (available modules and default config etc) A developer should have control over their apache and php version for each project. A developer might be able to change minor settings, ie magicquotes on for legacy code. Each project would determine its database provider in its code The idea is that it is one administrate-able server that I can control, and provide globally configured things like APC, Memcached, XDebug etc. Then by moving into subsets for each project, i can allow my users to quickly control their environments for various projects. Essentially I'm proposing the typical system of a developer running their own stack on their own machine, but centralised. In this way I'd hope to avoid problems like Cross OS code problems, database inconsistencies, slightly different installs producing bugs etc. I'm happy to manage this in custom builds from source, but if at all possible it would be great to have a large portion of it managed with some sort of package management. We typically use CentOS, so yum? Has anyone ever built anything like this before? Is there something turnkey that is similar to what I have described? Are there any useful guides I should be reading in order to build something like this?

    Read the article

  • .NET: How do I know if I have an unmanaged resource?

    - by Shiftbit
    I've read that unmanaged resource are considered file handles, streams, anything low level. Does MSDN or any other source explain how to recognize an unmanaged resource? I can't seem to find any examples on the net that show unmanaged code, all the examples just have comments that say unmanaged code here. Can someone perhaps provide a realworld example where I would handle an unmanaged resources in an IDispose interface? I provided the IDisposable interface for your convience. How do I identify an unmanaged resource? Thanks in advance! IDisposable Reference Public Class Sample : Implements IDisposable Private disposedValue As Boolean = False 'To detect redundant calls ' IDisposable Protected Overridable Sub Dispose(ByVal disposing As Boolean) If Not Me.disposedValue Then If disposing Then ' TODO: free other state (managed objects). End If ' TODO: free your own state (unmanaged objects). ' TODO: set large fields to null. End If Me.disposedValue = True End Sub ' This code added by Visual Basic to correctly implement the disposable pattern. Public Sub Dispose() Implements IDisposable.Dispose ' Do not change this code. Put cleanup code in Dispose(ByVal disposing As Boolean) above. Dispose(True) GC.SuppressFinalize(Me) End Sub End Class

    Read the article

  • update variable based upon results from .NET backgroundworker

    - by Bruce
    I've got a C# program that talks to an instrument (spectrum analyzer) over a network. I need to be able to change a large number of parameters in the instrument and read them back into my program. I want to use backgroundworker to do the actual talking to the instrument so that UI performance doesn't suffer. The way this works is - 1) send command to the instrument with new parameter value, 2) read parameter back from the instrument so I can see what actually happened (for example, I try to set the center frequency above the max that the instrument will handle and it tells me what it will actually handle), and 3) update a program variable with the actual value received from the instrument. Because there are quite a few parameters to be updated I'd like to use a generic routine. The part I can't seem to get my brain around is updating the variable in my code with what comes back from the instrument via backgroundworker. If I used a separate RunWorkerCompleted event for each parameter I could hardwire the update directly to the variable. I'd like to come up with a way of using a single routine that's capable of updating any of the variables. All I can come up with is passing a reference number (different for each parameter) and using a switch statement in the RunWorkerCompleted handler to direct the result. There has to be a better way.

    Read the article

  • Open Source CMS (.Net vs Java)

    - by CmsAndDotNetKindaGuy
    I must say up-front that this is not a strictly programming-related question and a very opinionated one. I am the lead developer of the dominant .Net CMS in my country and I don't like my own product :). Managerial decisions over what is important or not and large chunks of legacy code done before I joined gives me headache every day I go for work. Anyway, having a vast amount of experience in web industry and a very good grasp of C# and programming practices I'm designing my own CMS the past few months. Now the problem is that I'm an open source kinda guy so I have a dilemma. Should I use C# and .Net which has crippled multi-platform support or should I drop .Net entirely and start learning Java where I can create a truly open-source and cross-platform CMS? Please don't answer that I should contribute to an existing open source CMS. I ruled that out after spending a great deal of time searching for something similar in structure to what I have in mind. I am not a native speaker, so feel free to correct my syntax or rephrase my question.

    Read the article

  • How to preprocess text to do OCR error correction

    - by eaglefarm
    Here is what I'm trying to accomplish: I need to get a several large text files from a computer that is not networked and has no other output except a printer. I tried printing the text, then scanning the printout with OCR to recover the text on another computer but the OCR gets lots of errors (1 vs l, o vs 0, O vs D, etc). To solve this I am thinking of writing a program to process (annotate?) the text file, before printing it, so that the errors can be corrected from the text output of the OCR program. For example, for 1 (number one) vs l (letter L), I could change the text like this: sample inserting \nnn after characters that are frequently wrong in the OCR results: sampl\108e Then I can write another program to examine the file, looking for \nnn and check the character before the \nnn (where nnn is the ascii code in decimal) and fix it if necessary. Of course the program will have to recognize that the \nnn may have errors too but at least it knows that the nnn are digits and can easily correct them. I think I would add a CRC on each line so that any line that isn't corrected perfectly can be flagged as having a problem. Has anyone done anything like this? If there is an existing way of doing this I'd rather not reinvent the wheel. Or any suggestions for annotation format that would help solve this problem would be helpful too.

    Read the article

  • Invalidating Memcached Keys on save() in Django

    - by Zack
    I've got a view in Django that uses memcached to cache data for the more highly trafficked views that rely on a relatively static set of data. The key word is relatively: I need invalidate the memcached key for that particular URL's data when it's changed in the database. To be as clear as possible, here's the meat an' potatoes of the view (Person is a model, cache is django.core.cache.cache): def person_detail(request, slug): if request.is_ajax(): cache_key = "%s_ABOUT_%s" % settings.SITE_PREFIX, slug # Check the cache to see if we've already got this result made. json_dict = cache.get(cache_key) # Was it a cache hit? if json_dict is None: # That's a negative Ghost Rider person = get_object_or_404(Person, display = True, slug = slug) json_dict = { 'name' : person.name, 'bio' : person.bio_html, 'image' : person.image.extra_thumbnails['large'].absolute_url, } cache.set(cache_key) # json_dict will now exist, whether it's from the cache or not response = HttpResponse() response['Content-Type'] = 'text/javascript' response.write(simpljson.dumps(json_dict)) # Make sure it's all properly formatted for JS by using simplejson return response else: # This is where the fully templated response is generated What I want to do is get at that cache_key variable in it's "unformatted" form, but I'm not sure how to do this--if it can be done at all. Just in case there's already something to do this, here's what I want to do with it (this is from the Person model's hypothetical save method) def save(self): # If this is an update, the key will be cached, otherwise it won't, let's see if we can't find me try: old_self = Person.objects.get(pk=self.id) cache_key = # Voodoo magic to get that variable old_key = cache_key.format(settings.SITE_PREFIX, old_self.slug) # Generate the key currently cached cache.delete(old_key) # Hit it with both barrels of rock salt # Turns out this doesn't already exist, let's make that first request even faster by making this cache right now except DoesNotExist: # I haven't gotten to this yet. super(Person, self).save() I'm thinking about making a view class for this sorta stuff, and having functions in it like remove_cache or generate_cache since I do this sorta stuff a lot. Would that be a better idea? If so, how would I call the views in the URLconf if they're in a class?

    Read the article

  • Best Practice for Uploading Many (2000+) Images to A Server

    - by bob
    Hello, I have a general question about this. When you have a gallery, sometimes people need to upload 1000's of images at once. Most likely, it would be done through a .zip file. What is the best way to go about uploading this sort of thing to a server. Many times, server have timeouts etc. that need to be accounted for. I am wondering what kinds of things should I be looking out for and what is the best way to handle a large amount of images being uploaded. I'm guessing that you would allow a user to upload a zip file (assuming the timeout does not effect you), and this zip file is uploaded to a specific directory, lets assume in this case a directory is created for each user in the system. You would then unzip the directory on the server and scan the user's folder for any directories containing .jpg or .png or .gif files (etc.) and then import them into a table accordingly. I'm guessing labeled by folder name. What kind of server side troubles could I run into? I'm aware that there may be many issues. Even general ideas would be could so I can then research further. Thanks! Also, I would be programming in Ruby on Rails but I think this question applies accross any language.

    Read the article

  • SQL deadlock on delete then bulk insert

    - by StarLite
    I have an issue with a deadlock in SQL Server that I haven't been able to resolve. Basically I have a large number of concurrent connections (from many machines) that are executing transactions where they first delete a range of entries and then re-insert entries within the same range with a bulk insert. Essentially, the transaction looks like this BEGIN TRANSACTION T1 DELETE FROM [TableName] WITH( XLOCK HOLDLOCK ) WHERE [Id]=@Id AND [SubId]=@SubId INSERT BULK [TableName] ( [Id] Int , [SubId] Int , [Text] VarChar(max) COLLATE SQL_Latin1_General_CP1_CI_AS ) WITH(CHECK_CONSTRAINTS, FIRE_TRIGGERS) COMMIT TRANSACTION T1 The bulk insert only inserts items matching the Id and SubId of the deletion in the same transaction. Furthermore, these Id and SubId entries should never overlap. When I have enough concurrent transaction of this form, I start to see a significant number of deadlocks between these statements. I added the locking hints XLOCK HOLDLOCK to attempt to deal with the issue, but they don't seem to be helpling. The canonical deadlock graph for this error shows: Connection 1: Holds RangeX-X on PK_TableName Holds IX Page lock on the table Requesting X Page lock on the table Connection 2: Holds IX Page lock on the table Requests RangeX-X lock on the table What do I need to do in order to ensure that these deadlocks don't occur. I have been doing some reading on the RangeX-X locks and I'm not sure I fully understand what is going on with these. Do I have any options short of locking the entire table here?

    Read the article

  • PowerShell: How to find and uninstall a MS Office Update

    - by Hank
    I've been hunting for a clean way to uninstall an MSOffice security update on a large number of workstations. I've found some awkward solutions, but nothing as clean or general like using PowerShell and get-wmiobject with Win32_QuickFixEngineering and the .Uninstall method on the resulting object. [Apparently, Win32_QuickFixEngineering only refers to Windows patches. See: http://social.technet.microsoft.com/Forums/en/winserverpowershell/thread/93cc0731-5a99-4698-b1d4-8476b3140aa3 ] Question 1: Is there no way to use get-wmiobject to find MSOffice updates? There are so many classes and namespaces, I have to wonder. This particualar Office update (KB978382) can be found in the registry here (for Office Ultimate): HKLM\Software\Microsoft\Windows\CurrentVersion\Uninstall\{91120000-002E-0000-0000-0000000FF1CE}_ULTIMATER_{6DE3DABF-0203-426B-B330-7287D1003E86} which kindly shows the uninstall command of: msiexec /package {91120000-002E-0000-0000-0000000FF1CE} /uninstall {6DE3DABF-0203-426B-B330-7287D1003E86} and the last GUID seems constant between different versions of Office. I've also found the update like this: $wu = new-object -com "Microsoft.Update.Searcher" $wu.QueryHistory(0,$wu.GetTotalHistoryCount()) | where {$_.Title -match "KB978382"} I like this search because it doesn't require any poking around in the registry, but: Question 2: If I've found it like this, what can I do with the found information to facilitate the Uninstall? Thanks

    Read the article

  • Autodetect Presence of CSV Headers in a File

    - by banzaimonkey
    Short question: How do I automatically detect whether a CSV file has headers in the first row? Details: I've written a small CSV parsing engine that places the data into an object that I can access as (approximately) an in-memory database. The original code was written to parse third-party CSV with a predictable format, but I'd like to be able to use this code more generally. I'm trying to figure out a reliable way to automatically detect the presence of CSV headers, so the script can decide whether to use the first row of the CSV file as keys / column names or start parsing data immediately. Since all I need is a boolean test, I could easily specify an argument after inspecting the CSV file myself, but I'd rather not have to (go go automation). I imagine I'd have to parse the first 3 to ? rows of the CSV file and look for a pattern of some sort to compare against the headers. I'm having nightmares of three particularly bad cases in which: The headers include numeric data for some reason The first few rows (or large portions of the CSV) are null There headers and data look too similar to tell them apart If I can get a "best guess" and have the parser fail with an error or spit out a warning if it can't decide, that's OK. If this is something that's going to be tremendously expensive in terms of time or computation (and take more time than it's supposed to save me) I'll happily scrap the idea and go back to working on "important things". I'm working with PHP, but this strikes me as more of an algorithmic / computational question than something that's implementation-specific. If there's a simple algorithm I can use, great. If you can point me to some relevant theory / discussion, that'd be great, too. If there's a giant library that does natural language processing or 300 different kinds of parsing, I'm not interested.

    Read the article

  • IDN aware tools to encode/decode human readable IRI to/from valid URI

    - by Denis Otkidach
    Let's assume a user enter address of some resource and we need to translate it to: <a href="valid URI here">human readable form</a> HTML4 specification refers to RFC 3986 which allows only ASCII alphanumeric characters and dash in host part and all non-ASCII character in other parts should be percent-encoded. That's what I want to put in href attribute to make link working properly in all browsers. IDN should be encoded with Punycode. HTML5 draft refers to RFC 3987 which also allows percent-encoded unicode characters in host part and a large subset of unicode in both host and other parts without encoding them. User may enter address in any of these forms. To provide human readable form of it I need to decode all printable characters. Note that some parts of address might not correspond to valid UTF-8 sequences, usually when target site uses some other character encoding. An example of what I'd like to get: <a href="http://xn--80aswg.xn--p1ai/%D0%BF%D1%83%D1%82%D1%8C?%D0%B7%D0%B0%D0%BF%D1%80%D0%BE%D1%81"> http://????.??/???????????</a> Are there any tools to solve these tasks? I'm especially interested in libraries for Python and JavaScript.

    Read the article

  • Improve Efficiency for This Text Processing Code

    - by johnv
    I am writing a program that counts the number of words in a text file which is already in lowercase and separated by spaces. I want to use a dictionary and only count the word IF it's within the dictionary. The problem is the dictionary is quite large (~100,000 words) and each text document has also ~50,000 words. As such, the codes that I wrote below gets very slow (takes about 15 sec to process one document on a quad i7 machine). I'm wondering if there's something wrong with my coding and if the efficiency of the program can be improved. Thanks so much for your help. Code below: public static string WordCount(string countInput) { string[] keywords = ReadDic(); /* read dictionary txt file*/ /*then reads the main text file*/ Dictionary<string, int> dict = ReadFile(countInput).Split(' ') .Select(c => c) .Where(c => keywords.Contains(c)) .GroupBy(c => c) .Select(g => new { word = g.Key, count = g.Count() }) .OrderBy(g => g.word) .ToDictionary(d => d.word, d => d.count); int s = dict.Sum(e => e.Value); string k = s.ToString(); return k; }

    Read the article

  • Algorithms for finding a numerical record in a list of ordered numbers

    - by Ankur
    I have a list of incomplete ordered numbers. I want to find a particular number with as few steps as possible. Are there any improvements on this algorithm, I assume you can count the set size without difficulty - it will be stored and updated every time a new item is added. Your object is to get your cursor over the value x The first number (smallest) is s, and the last number (greatest) is g. Take the midpoint m1 of the set: calculate is x < m1, If yes then s <= x < m1 If no then m1 < x <= g If m1 = x then you're done. Keep repeating till you find x. Basically dividing the set into two parts with each iteration till you hit x. The purpose is to retrieve a numerical id from a very large table to then find the associated other records. I would imagine this is the most trivial kind of indexing available, are there improvements?

    Read the article

  • Missing WM_PAINT when hosting a WPF control inside a winforms application.

    - by Boris
    Hi All, Consider the following scenario: 1) Create a winforms application with an empty form. 2) Create a WPF usercontrol in the same project which is just the default control with background changed to blue. <UserControl x:Class="WindowsFormsApplication2.UserControl1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Height="300" Width="300" Background="Blue"> <Grid> </Grid> </UserControl> 3) Build the project 4) Add the control to your form (an ElementHost is added and the control is added inside it). 5) Run the application (everything looks nice) 6) Start Spy++, click find window (Control+F) and move the cursor onto the WPF control (the blue square) Something strange happens, the control gets a WM_ERASEBKGND message but no WM_PAINT message so now it is white. You can resize the form, hide the form behind other windows and the WPF control will not get rendered. There is an image of the scenario here: http://img260.imageshack.us/img260/2296/wmpaint.png This is a simplified example of the situation I have in the actual application. Please tell me what is the best way to resolve this issue such that the WPF control renders itself correctly. I would like a solution that can be incorporated into a large application with many controls on the form. Thank you very much in advance, Boris

    Read the article

  • Chrome troubles...

    - by GaVrA
    Take this site for example: http://pms.rs/contact Everything is just fine just by using this css for textarea: #kontakt input, #kontakt textarea{ width:250px; } #kontakt textarea{ height:150px; } But ofc chrome is always smarter and in it user can drag that bottom right corner of textarea and resize it to the size he likes. Call me control freak, but that is very dumb thing to have if no other browser is using that. On sites like this it is not a big deal, but somewhere it can cover the entire content and for me personaly, i like to limit as much as possible what user can do so he does not break my site(like for example adding too large images in posts on forums...). So i have to do something like this: #kontakt input, #kontakt textarea{ width:250px; } #kontakt textarea{ height:150px; max-height:150px; max-width:250px; } Just so i get chrome to play as all other browsers do... While i was typing this i realised that i really dont have any question per se, but i just thought to share this with SO public, so i will mark this as community wiki. Also some other things i noticed are inputs, i always have to put width for input or textarea just because chrome is always not rendering them as he should.

    Read the article

  • JAVA vs .NET - Choice for way to go further [closed]

    - by Sarang
    I have my subject .Net acedemically. I also learned core Java and did a project as well. I took training from a Java firm. Now, as a skill I do have knowledge as both language. But, it is creating a large problem to me that, which field I should chhose? Even if having better OOP fundamentals, will it be easier for me to transfer from one to another in the future ? Please suggest me a way. Also, we do have may technologies available at both side, like JSP, JSF, J2ME, Share Point, SilverLight etc. Which is better as per their reliabity point of view? Which are fast growing and useful technologies used mostly in current IT corporate world ? Are they easier to learn at fresher's point of view? Please answer. Perhaps, this answer may help me mostly to create my way to learn them and go further. Every IT developer, please help to find me my way.

    Read the article

  • Locking issues with replacing files on a website

    - by Moe Sisko
    I want to replace existing files on an IIS website with updated versions. Say these files are large pdf documents, which can be accessed via hyperlinks. The site is up 24x7, so I'm concerned about locking issues when a file is being updated at exactly the same time that someone is trying to read the file. The files are updated using C# code run on the server. I can think of two options for opening the file for writing. Option 1) Open the file for writing, using FileShare.Read : using (FileStream stream = new FileStream(path, FileMode.Create, FileAccess.Write, FileShare.Read)) While this file is open, and a user requests the same file for reading in a web browser via a hyperlink, the document opens up as a blank page. Option 2) Open the file for writing using FileShare.None : using (FileStream stream = new FileStream(path, FileMode.Create, FileAccess.Write, FileShare.None)) While this file is open, and a user requests the same file for reading in a web browser via a hyperlink, the browser shows an error. In IE 8, you get HTTP 500, "The website cannot display the page", and in Firefox 3.5, you get : "The process cannot access the file because it is being used by another process." The browser behaviour kind of makes sense, and seem reasonable. I guess its highly unlikely that a user will attempt to read a file at exactly the same time you are updating it. It would be nice if somehow, the file update was atomic, like updating a database with SQL wrapped around a transaction. I'm wondering if you guys worry about this sort of thing, and prefer either of the above options, or even have other options of your own for updating files.

    Read the article

  • OpenGL - drawing 2D polygons shapes with texture

    - by plonkplonk
    I am trying to make a few effects in a C+GL game. So far I draw all my sprites as a quad, and it works. However, I am trying to make a large ring appear at times, with a texture following that ring, as it takes less memory than a quad with the ring texture inside. The type of ring I want to make is not a round-shaped GL mesh ring (the "tube" type) but a "paper" 2D ring. That way I can modify the "width" of the ring, getting more of the effect than a simple quad+ring texture. So far all my attempts have been...kind of ridiculous, as I don't understand GL's coordinates too well (and I can't really understand the available documentation...I am just a designer with no coder help or background. A n00b, basically). glBegin(GL_POLYGON); for(i = 0;i < 360; i += 10){ glTexCoord2f(0, 0); glVertex2f(Cos(i)*(H-10),Sin(i)H); glTexCoord2f(0, HP); glVertex2f(Sin(i)(H-10),Cos(i)*(H-10)); glTexCoord2f(WP, HP); glVertex2f(Cos(i)H,Sin(i)(H-10)); glTexCoord2f(WP, 0); glVertex2f(Sin(i)*H,Cos(i)*H); } glEnd(); This is my last attempt, and it seems to generate a "sunburst" from the right edge of the circle instead of a ring. It's an amusing effect but definitely not what I want. Other results included the circle looking exactly the same as the quad textured (aka drawing a sprite literally) or something that looked like a pop-art filter, by working on this train of thought. Seems like my logic here is entirely flawed, so, what would be the easiest way to obtain such a ring? No need to reply in code, just some guidance for a non-math-skilled user...

    Read the article

  • Will running aspnet_regiis.exe -ir create any problems?

    - by alexander-strandberg
    Hi there. I've asked a question about changing the version of .Net sites in the IIS. If it affects classic asp sites etc (See Does asp.net setting affect classic asp (IIS 6 settings)) And that seems fine. So my follow-up question is, will running this command get me fired? What it does is changing the default value (and all existing?) of the .net version to 2.0. This wont affect any of the .net sites since they're allready versioned to 2.0. The classic asp pages needs to get its app pools updated so its functionoal with 2.0 but may I run into any other troubles? I've tried doing this on a test environment and no sites whet down during the installation period (from the command) but I did not have any classic asp sites or any .net sites running though (which I should test, come to think about it) but may something else break? Is this command doing anything else? We have some very large sites running and we cannot have downtime periods so I need to be 100% sure that this command is safe. Since all sites go down everytime we change a new sites .net version number we need to get this fix live asap. Any good ideas?

    Read the article

  • Converting VS2008 Solution to VS2010 Creates compile errors in ASP.NET 3.5 SP1

    - by Lukasz
    I am converting a large solution from Visual Studio 2008 to Visual Studio 2010. The conversion completes without errors. When I go to build the solution one particular section of the application throws error but it didn't when the solution was 2008. Error 1 Could not load file or assembly 'System.Web.DataVisualization, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35' or one of its dependencies. The system cannot find the file specified. C:\MyProject\Results\Result.ascx 3 And C:\CMyProject\Results\Result.ascx(3): Build (web): Could not load file or assembly 'System.Web.DataVisualization, Version=3.5.0.0, Culture=neutral, PublicKeyToken=31bf3856ad364e35' or one of its dependencies. The system cannot find the file specified. The dll is in the bin and it is not in the GAC. The .refresh file is pointing to the correct location. And all sections in the Web.Config are there, if you need to see them let me know. I have gone over the fixes I found online and nothing seems to help. I would really appreciate if someone could help me or point me in the right direction? Thank You.

    Read the article

  • shell scripting: search/replace & check file exist

    - by johndashen
    I have a perl script (or any executable) E which will take a file foo.xml and write a file foo.txt. I use a Beowulf cluster to run E for a large number of XML files, but I'd like to write a simple job server script in shell (bash) which doesn't overwrite existing txt files. I'm currently doing something like #!/bin/sh PATTERN="[A-Z]*0[1-2][a-j]"; # this matches foo in all cases todo=`ls *.xml | grep $PATTERN -o`; isdone=`ls *.txt | grep $PATTERN -o`; whatsleft=todo - isdone; # what's the unix magic? #tack on the .xml prefix with sed or something #and then call the job server; jobserve E "$whatsleft"; and then I don't know how to get the difference between $todo and $isdone. I'd prefer using sort/uniq to something like a for loop with grep inside, but I'm not sure how to do it (pipes? temporary files?) As a bonus question, is there a way to do lookahead search in bash grep? To clarify: so the simplest way to do what i'm asking is (in pseudocode) for i in `/bin/ls *.xml` do replace xml suffix with txt if [that file exists] add to whatsleft list end done

    Read the article

< Previous Page | 363 364 365 366 367 368 369 370 371 372 373 374  | Next Page >