Search Results

Search found 13542 results on 542 pages for 'python socketserver'.

Page 371/542 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • How to set the size of a wx.aui.AuiManager Pane that is centered?

    - by aF
    Hello, I have three panes with the InfoPane center option. I want to know how to set their size. Using this code: import wx import wx.aui class MyFrame(wx.Frame): def __init__(self, parent, id=-1, title='wx.aui Test', pos=wx.DefaultPosition, size=(800, 600), style=wx.DEFAULT_FRAME_STYLE): wx.Frame.__init__(self, parent, id, title, pos, size, style) self._mgr = wx.aui.AuiManager(self) # create several text controls text1 = wx.TextCtrl(self, -1, 'Pane 1 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text2 = wx.TextCtrl(self, -1, 'Pane 2 - sample text', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) text3 = wx.TextCtrl(self, -1, 'Main content window', wx.DefaultPosition, wx.Size(200,150), wx.NO_BORDER | wx.TE_MULTILINE) # add the panes to the manager self._mgr.AddPane(text1, wx.CENTER) self._mgr.AddPane(text2, wx.CENTER) self._mgr.AddPane(text3, wx.CENTER) # tell the manager to 'commit' all the changes just made self._mgr.Update() self.Bind(wx.EVT_CLOSE, self.OnClose) def OnClose(self, event): # deinitialize the frame manager self._mgr.UnInit() # delete the frame self.Destroy() app = wx.App() frame = MyFrame(None) frame.Show() app.MainLoop() I want to know what is called when we change the size of the panes. If you tell me that, I can do the rest by myself :)

    Read the article

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • App-Engine Parse a UrlFetch UTF-8 encoded stream

    - by Davidrd91
    I am trying to parse an XML from a URL using the xml.sax parser. I know there are other libraries to use but coming from Java this is the one I am most familiar with and seems the least complicated to me. The code I'm using to parse is as follows: parser = xml.sax.make_parser() handler = MangaHandler() parser.setContentHandler(handler) url = urlfetch.Fetch('http://www.mangapanda.com/alphabetical', allow_truncated = False, follow_redirects = False, deadline = False) xml.sax.parseString(url.content, handler) This returns a SaxException (invalid token) once the parser reaches the first & sign: SAXParseException: <unknown>:582:34: not well-formed (invalid token) Because urlfetch returns a string and not a stream I cannot use the parse() (which only works with streams) and am left to use parseString() instead. To see if parsing as a stream would fix this I tried: parser.parse(io.StringIO(url.content).encode('utf-8')) but this returns: TypeError: initial_value must be unicode or None, not str I have also tried to use the urllib2 libraries which do return a stream instead of urlfetch but the file is too large and is automatically truncated, leaving me with missing data. Any Sort of work-around for this would be greatly appreciated as I've spent days getting around one obstacle just to be stopped by another.

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • How to save and load an array of complex numbers using numpy.savetxt?

    - by ptomato
    I want to use numpy.savetxt() to save an array of complex numbers to a text file. Problems: If you save the complex array with the default format string, the imaginary part is discarded. If you use fmt='%s', then numpy.loadtxt() can't load it unless you specify dtype=complex, converters={0: lambda s: complex(s)}. Even then, if there are NaN's in the array, loading still fails. It looks like someone has inquired about this multiple times on the Numpy mailing list and even filed a bug, but has not gotten a response. Before I put something together myself, is there a canonical way to do this?

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • PostgreSQL pgdb driver raises "can't rollback" exception

    - by David Parunakian
    Hello, for some reason I'm experiencing the Operational Error with "can't rollback" message when I attempt to roll back my transaction in the following context: try: cursors[instance].execute("lock revision, app, timeout IN SHARE MODE") cursors[instance].execute("insert into app (type, active, active_revision, contents, z) values ('session', true, %s, %s, 0) returning id", (cRevision, sessionId)) sAppId = cursors[instance].fetchone()[0] cursors[instance].execute("insert into revision (app_id, type) values (%s, 'active')", (sAppId,)) cursors[instance].execute("insert into timeout (app_id, last_seen) values (%s, now())", (sAppId,)) connections[instance].commit() except pgdb.DatabaseError, e: connections[instance].rollback() return "{status: 'error', errno:4, errmsg: \"%s\"}"%(str(e).replace('\"', '\\"').replace('\n', '\\n').replace('\r', '\\r')) The driver in use is PGDB. What is fundamentally wrong here?

    Read the article

  • How to separate comma separeted data from csv file?

    - by Rahul
    I have opened a csv file and I want to sort each string which is comma separeted and are in same line: ex:: file : name,sal,dept tom,10000,it o/p :: each string in string variable I have a file which is already open, so I can not use "open" API, I have to use "csv.reader" which have to read one line at a time.

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • Iterate with binary structure over numpy array to get cell sums

    - by Curlew
    In the package scipy there is the function to define a binary structure (such as a taxicab (2,1) or a chessboard (2,2)). import numpy from scipy import ndimage a = numpy.zeros((6,6), dtype=numpy.int) a[1:5, 1:5] = 1;a[3,3] = 0 ; a[2,2] = 2 s = ndimage.generate_binary_structure(2,2) # Binary structure #.... Calculate Sum of result_array = numpy.zeros_like(a) What i want is to iterate over all cells of this array with the given structure s. Then i want to append a function to the current cell value indexed in a empty array (example function sum), which uses the values of all cells in the binary structure. For example: array([[0, 0, 0, 0, 0, 0], [0, 1, 1, 1, 1, 0], [0, 1, 2, 1, 1, 0], [0, 1, 1, 0, 1, 0], [0, 1, 1, 1, 1, 0], [0, 0, 0, 0, 0, 0]]) # The array a. The value in cell 1,2 is currently one. Given the structure s and an example function such as sum the value in the resulting array (result_array) becomes 7 (or 6 if the current cell value is excluded). Someone got an idea?

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >