Search Results

Search found 13542 results on 542 pages for 'python socketserver'.

Page 371/542 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • Is multi-level polymorphism possible in SQLAlchemy?

    - by Jace
    Is it possible to have multi-level polymorphism in SQLAlchemy? Here's an example: class Entity(Base): __tablename__ = 'entities' id = Column(Integer, primary_key=True) created_at = Column(DateTime, default=datetime.utcnow, nullable=False) entity_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_on': entity_type} class File(Entity): __tablename__ = 'files' id = Column(None, ForeignKey('entities.id'), primary_key=True) filepath = Column(Unicode(255), nullable=False) file_type = Column(Unicode(20), nullable=False) __mapper_args__ = {'polymorphic_identity': u'file', 'polymorphic_on': file_type) class Image(File): __mapper_args__ = {'polymorphic_identity': u'image'} __tablename__ = 'images' id = Column(None, ForeignKey('files.id'), primary_key=True) width = Column(Integer) height = Column(Integer) When I call Base.metadata.create_all(), SQLAlchemy raises the following error: NotImplementedError: Can't generate DDL for the null type IntegrityError: (IntegrityError) entities.entity_type may not be NULL. This error goes away if I remove the Image model and the polymorphic_on key in File. What gives? (Edited: the exception raised was wrong.)

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • Is there a way to control how pytest-xdist runs tests in parallel?

    - by superselector
    I have the following directory layout: runner.py lib/ tests/ testsuite1/ testsuite1.py testsuite2/ testsuite2.py testsuite3/ testsuite3.py testsuite4/ testsuite4.py The format of testsuite*.py modules is as follows: import pytest class testsomething: def setup_class(self): ''' do some setup ''' # Do some setup stuff here def teardown_class(self): '''' do some teardown''' # Do some teardown stuff here def test1(self): # Do some test1 related stuff def test2(self): # Do some test2 related stuff .... .... .... def test40(self): # Do some test40 related stuff if __name__=='__main()__' pytest.main(args=[os.path.abspath(__file__)]) The problem I have is that I would like to execute the 'testsuites' in parallel i.e. I want testsuite1, testsuite2, testsuite3 and testsuite4 to start execution in parallel but individual tests within the testsuites need to be executed serially. When I use the 'xdist' plugin from py.test and kick off the tests using 'py.test -n 4', py.test is gathering all the tests and randomly load balancing the tests among 4 workers. This leads to the 'setup_class' method to be executed every time of each test within a 'testsuitex.py' module (which defeats my purpose. I want setup_class to be executed only once per class and tests executed serially there after). Essentially what I want the execution to look like is: worker1: executes all tests in testsuite1.py serially worker2: executes all tests in testsuite2.py serially worker3: executes all tests in testsuite3.py serially worker4: executes all tests in testsuite4.py serially while worker1, worker2, worker3 and worker4 are all executed in parallel. Is there a way to achieve this in 'pytest-xidst' framework? The only option that I can think of is to kick off different processes to execute each test suite individually within runner.py: def test_execute_func(testsuite_path): subprocess.process('py.test %s' % testsuite_path) if __name__=='__main__': #Gather all the testsuite names for each testsuite: multiprocessing.Process(test_execute_func,(testsuite_path,))

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • How to generate lots of redundant ajax elements like checkboxes and pulldowns in Django?

    - by iJames
    Hello folks. I've been getting lots of answers from stackoverflow now that I'm in Django just be searching. Now I hope my question will also create some value for everybody. In choosing Django, I was hoping there was some similar mechanism to the way you can do partials in ROR. This was going to help me in two ways. One was in generating repeating indexed forms or form elements, and also in rendering only a piece of the page on the round trip. I've done a little bit of that by using taconite with a simple URL click but now I'm trying to get more advanced. This will focus on the form issue which boils down to how to iterate over a secondary object. If I have a list of photo instances, each of which has a couple of parameters, let's say a size and a quantity. I want to generate form elements for each photo instance separately. But then I have two lists I want to iterate on at the same time. Context: photos : Photo.objects.all() and forms = {} for photo in photos: forms[photo.id] = PhotoForm() In other words we've got a list of photo objects and a dict of forms based on the photo.id. Here's an abstraction of the template: {% for photo in photos %} {% include "photoview.html" %} {% comment %} So here I want to use the photo.id as an index to get the correct form. So that each photo has its own form. I would want to have a different action and each form field would be unique. Is that possible? How can I iterate on that? Thanks! {% endcomment %} Quantity: {{ oi.quantity }} {{ form.quantity }} Dimensions: {{ oi.size }} {{ form.size }} {% endfor %} What can I do about this simple case. And how can I make it where every control is automatically updating the server instead of using a form at all? Thanks! James

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Trying to output a list using class

    - by captain morgan
    Am trying to get the moving average of a price..but i keep getting an attribute error in my Moving_Average class. ('Moving_Average' object has no attribute 'days'). Here is what I have: class Moving_Average: def calculation(self, alist:list,days:int): m = self.days prices = alist[1::2] average = [0]* len(prices) signal = ['']* len(prices) for m in range(0,len(prices)-days+1): average[m+2] = sum(prices[m:m+days])/days if prices[m+2] < average[m+2]: signal[m+2]='SELL' elif prices[m+2] > average[m+2] and prices[m+1] < average[m+1]: signal[m+2]='BUY' else: signal[m+2] ='' return average,signal def print_report(symbol:str,strategy:str): print('SYMBOL: ', symbol) print('STRATEGY: ', strategy) print('Date Closing Strategy Signal') def user(): strategy = ''' Which of the following strategy would you like to use? * Simple Moving Average [S] * Directional Indicator[D] Please enter your choice: ''' if signal_strategy in 'Ss': days = input('Please enter the number of days for the average') days = int(days) strategy = 'Simple Moving Average {}-days'.format(str(days)) m = Moving_Average() ma = m.calculation(gg, days) print(ma) gg is an list that contains date and prices. [2013-10-01,60,2013-10-02,60] The output is supposed to look like: Date Price Average Signal 2013-10-01 60.0 2013-10-02 60.0 60.00 BUY

    Read the article

  • Is django orm & templates thread safe?

    - by Piotr Czapla
    I'm using django orm and templates to create a background service that is ran as management command. Do you know if django is thread safe? I'd like to use threads to speed up processing. The processing is blocked by I/O not CPU so I don't care about performance hit caused by GIL.

    Read the article

  • Matplotlib autodatelocator custom date formatting?

    - by jawonlee
    I'm using Matplotlib to dynamically generate .png charts from a database. The user may set as the x-axis any given range of datetimes, and I need to account for all of it. While Matplotlib has the dates.AutoDateLocator(), I want the datetime format printed on the chart to be context-specific - e.g. if the user is charting from 3 p.m. to 5 p.m., the year/month/day information doesn't need to be displayed. Right now, I'm manually creating Locator and Formatter objects thusly: def get_ticks(start, end): from datetime import timedelta as td delta = end - start if delta <= td(minutes=10): loc = mdates.MinuteLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(minutes=30): loc = mdates.MinuteLocator(byminute=range(0,60,5)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=1): loc = mdates.MinuteLocator(byminute=range(0,60,15)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(hours=6): loc = mdates.HourLocator() fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=1): loc = mdates.HourLocator(byhour=range(0,24,3)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(days=3): loc = mdates.HourLocator(byhour=range(0,24,6)) fmt = mdates.DateFormatter('%I:%M %p') elif delta <= td(weeks=2): loc = mdates.DayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=12): loc = mdates.WeekdayLocator() fmt = mdates.DateFormatter('%b %d') elif delta <= td(weeks=52): loc = mdates.MonthLocator() fmt = mdates.DateFormatter('%b') else: loc = mdates.MonthLocator(interval=3) fmt = mdates.DateFormatter('%b %Y') return loc,fmt Is there a better way of doing this?

    Read the article

  • How to use regular expressions to pull a substring? (screen scraping)

    - by Diego
    Hey guys, i'm really trying to understand regular expressions while scraping a site, i've been using it in my code enough to pull the following, but am stuck here. I need to quickly grab this: http://www.example.com/online/store/TitleDetail?detail&sku=123456789 from this: ('<a href="javascript:if(handleDoubleClick(this.id)){window.location=\'http://www.example.com/online/store/TitleDetail?detail&sku=123456789\';}" id="getTitleDetails_123456789">\r\n\t\t\t \tcheck store inventory\r\n\t\t\t </a>', 1) This is where I got confused. any ideas?

    Read the article

  • PostgreSQL pgdb driver raises "can't rollback" exception

    - by David Parunakian
    Hello, for some reason I'm experiencing the Operational Error with "can't rollback" message when I attempt to roll back my transaction in the following context: try: cursors[instance].execute("lock revision, app, timeout IN SHARE MODE") cursors[instance].execute("insert into app (type, active, active_revision, contents, z) values ('session', true, %s, %s, 0) returning id", (cRevision, sessionId)) sAppId = cursors[instance].fetchone()[0] cursors[instance].execute("insert into revision (app_id, type) values (%s, 'active')", (sAppId,)) cursors[instance].execute("insert into timeout (app_id, last_seen) values (%s, now())", (sAppId,)) connections[instance].commit() except pgdb.DatabaseError, e: connections[instance].rollback() return "{status: 'error', errno:4, errmsg: \"%s\"}"%(str(e).replace('\"', '\\"').replace('\n', '\\n').replace('\r', '\\r')) The driver in use is PGDB. What is fundamentally wrong here?

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • How to inject a key string to andoid device through ADB?

    - by Nandi
    Hi, Can somebody help me for the following. I want to select a perticular string in the list displayed in android phone. If i take example of phone book. i want to pass a person name to the device using adb interface and that name should get highlighted in the list. I tried all adb commands for this but could pass string and key events to the screen but not able to select the respective string. please help. Thanks in advance.

    Read the article

  • Setting up relations/mappings for a SQLAlchemy many-to-many database

    - by Brent Ramerth
    I'm new to SQLAlchemy and relational databases, and I'm trying to set up a model for an annotated lexicon. I want to support an arbitrary number of key-value annotations for the words which can be added or removed at runtime. Since there will be a lot of repetition in the names of the keys, I don't want to use this solution directly, although the code is similar. My design has word objects and property objects. The words and properties are stored in separate tables with a property_values table that links the two. Here's the code: from sqlalchemy import Column, Integer, String, Table, create_engine from sqlalchemy import MetaData, ForeignKey from sqlalchemy.orm import relation, mapper, sessionmaker from sqlalchemy.ext.declarative import declarative_base engine = create_engine('sqlite:///test.db', echo=True) meta = MetaData(bind=engine) property_values = Table('property_values', meta, Column('word_id', Integer, ForeignKey('words.id')), Column('property_id', Integer, ForeignKey('properties.id')), Column('value', String(20)) ) words = Table('words', meta, Column('id', Integer, primary_key=True), Column('name', String(20)), Column('freq', Integer) ) properties = Table('properties', meta, Column('id', Integer, primary_key=True), Column('name', String(20), nullable=False, unique=True) ) meta.create_all() class Word(object): def __init__(self, name, freq=1): self.name = name self.freq = freq class Property(object): def __init__(self, name): self.name = name mapper(Property, properties) Now I'd like to be able to do the following: Session = sessionmaker(bind=engine) s = Session() word = Word('foo', 42) word['bar'] = 'yes' # or word.bar = 'yes' ? s.add(word) s.commit() Ideally this should add 1|foo|42 to the words table, add 1|bar to the properties table, and add 1|1|yes to the property_values table. However, I don't have the right mappings and relations in place to make this happen. I get the sense from reading the documentation at http://www.sqlalchemy.org/docs/05/mappers.html#association-pattern that I want to use an association proxy or something of that sort here, but the syntax is unclear to me. I experimented with this: mapper(Word, words, properties={ 'properties': relation(Property, secondary=property_values) }) but this mapper only fills in the foreign key values, and I need to fill in the other value as well. Any assistance would be greatly appreciated.

    Read the article

  • How to get to the key name of a referenced entity property from an entity instance without a datastore read in google app engine?

    - by Sumeet Pareek
    Consider I have the following models - class Team(db.Model): # say I have just 5 teams name = db.StringProperty() class Player(db.Model): # say I have thousands of players name = db.StringProperty() team = db.ReferenceProperty(Team, collection_name="player_set") Key name for each Team entity = 'team_' , and for each Player entity = 'player_' By some prior arrangement I have a Team entity's (key_name, name) mapping available to me. For example (team_01, United States Of America), (team_02, Russia) etc I have to show all the players and their teams on a page. One way of doing this would be - players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(player.team.name) #This is a total of 1x1000 = 1000 DB reads That is a 1001 DB reads for a silly thing. The interesting part is that when I do a db.to_dict() on players, it shows that for every player in that list there is 'name' of the player and there is the 'key_name' of the team available too. So how can I do the below ?? players = Player.all().fetch(1000) # This is 1 DB read for player in players: # This will iterate 1000 times self.response.out.write(player.name) # This is obviously not a DB read self.response.out.write(team_list[player.<SOME WAY OF GETTING TEAM KEY NAME>]) # Here 'team_list' already has (key_name, name) for all 5 teams I have been struggling with this for a long time. Have read every available documentation. I could just hug the person that can help me here :-) Disclaimer: The above problem description is not a real scenario. It is a simplified arrangement that represents my problem exactly. I have run into it in a rater complex and big GAE appication.

    Read the article

  • converting a treebank of vertical trees to s-expressions

    - by Andreas
    I need to preprocess a treebank corpus of sentences with parse trees. The input format is a vertical representation of trees, like so: S =NP ==(DT +def) the == (N +ani) man =VP ==V walks ...and I need it like: (S (NP (DT the) (N man)) (VP (V walks))) I have code that almost does it, but not quite. There's always a missing paren somewhere. Should I use a proper parser, maybe a CFG? The current code is at http://github.com/andreasvc/eodop/blob/master/arbobanko.py The code also contains real examples from the treebank.

    Read the article

  • Django: Is there any way to have "unique for date range"?

    - by tomwolber
    If my model for Items is: class Item(models.Model): name = models.CharField(max_length=500) startDate = models.DateField("Start Date", unique="true") endDate = models.DateField("End Date") Each Item needs to have a unique date range. for example, if i create an Item that has a date range of June 1st to June 8th, how can I keep and Item with a date range of June 3rd to June 5th from being created (or render an error with template logic)?

    Read the article

  • Search for a String and replace it with a variable

    - by chrissygormley
    Hello, I am trying to use regular expression to search a document fo a UUID number and replace the end of it with a new number. The code I have so far is: read_file = open('test.txt', 'r+') write_file = open('test.txt', 'w') r = re.compile(r'(self.uid\s*=\s*5EFF837F-EFC2-4c32-A3D4\s*)(\S+)') for l in read_file: m1 = r.match(l) if m1: new=(str,m1.group(2)) new?????? This where I get stuck. The file test.txt has the below UUID stored in it: self.uid = '5EFF837F-EFC2-4c32-A3D4-D15C7F9E1F22' I want to replace the part D15C7F9E1F22. I have also tried this: r = re.compile(r'(self.uid\s*=\s*)(\S+)') for l in fp: m1 = r.match(l) new=map(int,m1.group(2).split("-") new[4]='RHUI5345JO' But I cannot seem to match the string. Thanks in advance for any help.

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >