Search Results

Search found 13542 results on 542 pages for 'python socketserver'.

Page 371/542 | < Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >

  • The truth value of an array with more than one element is ambigous when trying to index an array

    - by user1440194
    I am trying to put all elements of rbs into a new array if the elements in var(another numpy array) is =0 and <=.1 . However when I try the following code I get this error: ValueError: The truth value of an array with more than one element is ambiguous. Use a.any() or a.all() rbs = [ish[4] for ish in realbooks] for book in realbooks: var -= float(str(book[0]).replace(":", "")) bidsred = rbs[(var <= .1) and (var >=0)] any ideas on what I'm doing wrong?

    Read the article

  • Encoding with url and api

    - by user2950824
    So I have this web app set up and running and it works fine for any username that you request, but when i try http://mrcastelo.pythonanywhere.com/lol/euw/Nazaré, it simply doesnt work - the error that I get on the server is the following: iddata= getJSON(urllolbase+region+urlid+username) #SummonerID UnicodeDecodeError: 'ascii' codec can't decode byte 0xc3 in position 5: ordinal not in range(128) It is annoying me greatly, I've tried some other threads but none of them came to a fix. The api that I am using (www.legendaryapi.com) does accept this because this works. Any idea on how to fix this?

    Read the article

  • django test client trouble

    - by Anton Koval'
    I've got a problem... we're writing project using django, and i'm trying to use django.test.client with nose test-framework for tests. Our code is like this: from simplejson import loads from urlparse import urljoin from django.test.client import Client TEST_URL = "http://smakly.localhost:9090/" def test_register(): cln = Client() ref_data = {"email": "[email protected]", "name": "???????", "website": "http://hot.bear.com", "xhr": "true"} print urljoin(TEST_URL, "/accounts/register/") response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) print response["message"] and in nose output I catch: Traceback (most recent call last): File "/home/psih/work/svn/smakly/eggs/nose-0.11.1-py2.6.egg/nose/case.py", line 183, in runTest self.test(*self.arg) File "/home/psih/work/svn/smakly/src/smakly.tests/smakly/tests/frontend/test_profile.py", line 25, in test_register response = loads(cln.post(urljoin(TEST_URL, "/accounts/register/"), ref_data)) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 313, in post response = self.request(**r) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 225, in request response = self.handler(environ) File "/home/psih/work/svn/smakly/parts/django/django/test/client.py", line 69, in __call__ response = self.get_response(request) File "/home/psih/work/svn/smakly/parts/django/django/core/handlers/base.py", line 78, in get_response urlconf = getattr(request, "urlconf", settings.ROOT_URLCONF) File "/home/psih/work/svn/smakly/parts/django/django/utils/functional.py", line 273, in __getattr__ return getattr(self._wrapped, name) AttributeError: 'Settings' object has no attribute 'ROOT_URLCONF' My settings.py file does have this attribute. If I get the data from the server with standard urllib2.urllopen().read() it works in the proper way. Any ideas how I can solve this case?

    Read the article

  • How to use regular expressions to pull a substring? (screen scraping)

    - by Diego
    Hey guys, i'm really trying to understand regular expressions while scraping a site, i've been using it in my code enough to pull the following, but am stuck here. I need to quickly grab this: http://www.example.com/online/store/TitleDetail?detail&sku=123456789 from this: ('<a href="javascript:if(handleDoubleClick(this.id)){window.location=\'http://www.example.com/online/store/TitleDetail?detail&sku=123456789\';}" id="getTitleDetails_123456789">\r\n\t\t\t \tcheck store inventory\r\n\t\t\t </a>', 1) This is where I got confused. any ideas?

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • How to write data by dynamic parameter name

    - by Maxim Welikobratov
    I need to be able to write data to datastore of google-app-engine for some known entity. But I don't want write assignment code for each parameter of the entity. I meen, I don't want do like this val_1 = self.request.get('prop_1') val_2 = self.request.get('prop_2') ... val_N = self.request.get('prop_N') item.prop_1 = val_1 item.prop_2 = val_2 ... item.prop_N = val_N item.put() instead, I want to do something like this args = self.request.arguments() for prop_name in args: item.set(prop_name, self.request.get(prop_name)) item.put() dose anybody know how to do this trick?

    Read the article

  • App-Engine Parse a UrlFetch UTF-8 encoded stream

    - by Davidrd91
    I am trying to parse an XML from a URL using the xml.sax parser. I know there are other libraries to use but coming from Java this is the one I am most familiar with and seems the least complicated to me. The code I'm using to parse is as follows: parser = xml.sax.make_parser() handler = MangaHandler() parser.setContentHandler(handler) url = urlfetch.Fetch('http://www.mangapanda.com/alphabetical', allow_truncated = False, follow_redirects = False, deadline = False) xml.sax.parseString(url.content, handler) This returns a SaxException (invalid token) once the parser reaches the first & sign: SAXParseException: <unknown>:582:34: not well-formed (invalid token) Because urlfetch returns a string and not a stream I cannot use the parse() (which only works with streams) and am left to use parseString() instead. To see if parsing as a stream would fix this I tried: parser.parse(io.StringIO(url.content).encode('utf-8')) but this returns: TypeError: initial_value must be unicode or None, not str I have also tried to use the urllib2 libraries which do return a stream instead of urlfetch but the file is too large and is automatically truncated, leaving me with missing data. Any Sort of work-around for this would be greatly appreciated as I've spent days getting around one obstacle just to be stopped by another.

    Read the article

  • Increasing figure size in Matplotlib

    - by Anirudh
    I am trying to plot a graph from a distance matrix. The code words fine and gives me a image in 800 * 600 pixels. The image being too small, All the nodes are packed together. I want increase the size of the image. so I added the following line to my code - figure(num=None, figsize=(10, 10), dpi=80, facecolor='w', edgecolor='k') After this all I get is a blank 1000 * 1000 image file. My overall code - import networkx as nx import pickle import matplotlib.pyplot as plt print "Reading from pickle." p_file = open('pickles/names') Names = pickle.load(p_file) p_file.close() p_file = open('pickles/distance') Dist = pickle.load(p_file) p_file.close() G = nx.Graph() print "Inserting Nodes." for n in Names: G.add_node(n) print "Inserting Edges." for i in range(601): for j in range(601): G.add_edge(Names[i],Names[j],weight=Dist[i][j]) print "Drawing Graph." nx.draw(G) print "Saving Figure." #plt.figure(num=None, figsize=(10, 10)) plt.savefig('new.png') print "Success!"

    Read the article

  • Testing InlineFormset clean methods

    - by Rory
    I have a Django project, with 2 models, a Structure and Bracket, the Bracket has a ForeignKey to a Structure (i.e. one-to-many, one Structure has many Brackets). I created a TabularInline for the admin site, so that there would be a table of Brackets on the Structure. I added a custom formset with some a custom clean method to do some extra validation, you can't have a Bracket that conflicts with another Bracket on the same Structure etc. The admin looks like this: class BracketInline(admin.TabularInline): model = Bracket formset = BracketInlineFormset class StructureAdmin(admin.ModelAdmin): inlines = [ BracketInline ] admin.site.register(Structure, StructureAdmin) That all works, and the validation works. However now I want to write some unittest to test my complex formset validation logic. My first attempt to validate known-good values is: data = {'form-TOTAL_FORMS': '1', 'form-INITIAL_FORMS': '0', 'form-MAX_NUM_FORMS': '', 'form-0-field1':'good-value', … } formset = BracketInlineFormset(data) self.assertTrue(formset.is_valid()) However that doesn't work and raises the exception: ====================================================================== ERROR: testValid (appname.tests.StructureTestCase) ---------------------------------------------------------------------- Traceback (most recent call last): File "/paht/to/project/tests.py", line 494, in testValid formset = BracketInlineFormset(data) File "/path/to/django/forms/models.py", line 672, in __init__ self.instance = self.fk.rel.to() AttributeError: 'BracketInlineFormset' object has no attribute 'fk' ---------------------------------------------------------------------- The Django documentation (for formset validation) implies one can do this. How come this isn't working? How do I test the custom clean()/validation for my inline formset?

    Read the article

  • Django and mod_python intermittent error?

    - by Peter
    I have a Django site at http://sm.rutgers.edu/relive/af_api/index/. It is supposed to display "Home of the relive APIs". If you refresh this page many times, you can see different renderings. 1) The expected page. 2) Django "It worked!" page. 3) "ImportError at /index/" page. If you scroll down enough to ROOT_URLCONF part, you will see it says 'relive.urls'. But apparently, it should be 'af_api.urls', which is in my settings.py file. Since these results happen randomly, is it possible that either Django or mod_python is working unstably?

    Read the article

  • How to set a __str__ method for all ctype Structure classes?

    - by Reuben Thomas
    [Since asking this question, I've found: http://www.cs.unc.edu/~gb/blog/2007/02/11/ctypes-tricks/ which gives a good answer.] I just wrote a __str__ method for a ctype-generated Structure class 'foo' thus: def foo_to_str(self): s = [] for i in foo._fields_: s.append('{}: {}'.format(i[0], foo.\_\_getattribute__(self, i[0]))) return '\n'.join(s) foo.\_\_str__ = foo_to_str But this is a fairly natural way to produce a __str__ method for any Structure class. How can I add this method directly to the Structure class, so that all Structure classes generated by ctypes get it? (I am using the h2xml and xml2py scripts to auto-generate ctypes code, and this offers no obvious way to change the names of the classes output, so simply subclassing Structure, Union &c. and adding my __str__ method there would involve post-processing the output of xml2py.)

    Read the article

  • How to reload Django models without losing my locals in an interactive session?

    - by Gj
    I'm doing some research with an interactive shell and using a Django app (shell_plus) for storing data and browsing it using the convenient admin. Occasionally I add or change some of the app models, and run a syncdb (or South migration when changing a model). The changes to the models don't take effect in my interactive session even if I re-import the app models. Thus I'm forced to restart the shell_plus and lose my precious locals() in the process. Is there any way to reload the models during a session? Thanks!!

    Read the article

  • Installing twisted.mail.smtp

    - by user3506985
    I am using Ubuntu 14.04 and trying to install twisted.mail.smtp using the following commnands -sudo add-apt-repository ppa:jesstess/twisted-12.1-testing -sudo apt-get update There are no errors in the installation,but when I specify the command that is from twisted.mail.smtp import ESMTPSenderFactory I am getting the following error Error: ImportError: No module named mail.smtp Please help me out

    Read the article

  • How to make Universal Feed Parser only parse feeds?

    - by piquadrat
    I'm trying to get content from external feeds on my Django web site with Universal Feed Parser. I want to have some user error handling, e.g. if the user supplies a URL that is not a feed. When I tried how feedparser responds to faulty input, I was surprised to see that feedparser does not throw any Exceptions at all. E.g. on HTML content, it tries to parse some information from the HTML code, and on non-existing domains, it returns a mostly empty dictionary: {'bozo': 1, 'bozo_exception': URLError(gaierror(-2, 'Name or service not known'),), 'encoding': 'utf-8', 'entries': [], 'feed': {}, 'version': None} Other faulty input manifest themselves in the status_code or the namespaces values in the returned dictionary. So, what's the best approach to have sane error checking without resorting to an endless cascade of if .. elif .. elif ...?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • django on appengine

    - by aks
    I am impressed with django.Am am currenty a java developer.I want to make some cool websites for myself but i want to host it in some third pary environmet. Now the question is can i host the django application on appengine?If yes , how?? Are there any site built using django which are already hosted on appengine?

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • getting global name not defined error

    - by nashr rafeeg
    i have the following class class notify(): def __init__(self,server="localhost", port=23053): self.host = server self.port = port register = gntp.GNTPRegister() register.add_header('Application-Name',"SVN Monitor") register.add_notification("svnupdate",True) growl(register) def svn_update(self, author="Unknown", files=0): notice = gntp.GNTPNotice() notice.add_header('Application-Name',"SVN Monitor") notice.add_header('Notification-Name', "svnupdate") notice.add_header('Notification-Title',"SVN Commit") # notice.add_header('Notification-Icon',"") notice.add_header('Notification-Text',Msg) growl(notice) def growl(data): s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) s.connect((self.host,self.port)) s.send(data) response = gntp.parse_gntp(s.recv(1024)) print response s.close() but when ever i try to use this class via the follwoing code i get 'NameError: global name 'growl' is not defined' from growlnotify import * n = notify() n.svn_update() any one has an idea what is going on here ? cheers nash

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

< Previous Page | 367 368 369 370 371 372 373 374 375 376 377 378  | Next Page >