Search Results

Search found 15380 results on 616 pages for 'man with python'.

Page 372/616 | < Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • Django: Applying Calculations To A Query Set

    - by TheLizardKing
    I have a QuerySet that I wish to pass to a generic view for pagination: links = Link.objects.annotate(votes=Count('vote')).order_by('-created')[:300] This is my "hot" page which lists my 300 latest submissions (10 pages of 30 links each). I want to now sort this QuerySet by an algorithm that HackerNews uses: (p - 1) / (t + 2)^1.5 p = votes minus submitter's initial vote t = age of submission in hours Now because applying this algorithm over the entire database would be pretty costly I am content with just the last 300 submissions. My site is unlikely to be the next digg/reddit so while scalability is a plus it is required. My question is now how do I iterate over my QuerySet and sort it by the above algorithm? For more information, here are my applicable models: class Link(models.Model): category = models.ForeignKey(Category, blank=False, default=1) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) modified = models.DateTimeField(auto_now=True) url = models.URLField(max_length=1024, unique=True, verify_exists=True) name = models.CharField(max_length=512) def __unicode__(self): return u'%s (%s)' % (self.name, self.url) class Vote(models.Model): link = models.ForeignKey(Link) user = models.ForeignKey(User) created = models.DateTimeField(auto_now_add=True) def __unicode__(self): return u'%s vote for %s' % (self.user, self.link) Notes: I don't have "downvotes" so just the presence of a Vote row is an indicator of a vote or a particular link by a particular user.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Programmatically sync the db in Django

    - by Attila Oláh
    I'm trying to sync my db from a view, something like this: from django import http from django.core import management def syncdb(request): management.call_command('syncdb') return http.HttpResponse('Database synced.') The issue is, it will block the dev server by asking for user input from the terminal. How can I pass it the '--noinput' option to prevent asking me anything? I have other ways of marking users as super-user, so there's no need for the user input, but I really need to call syncdb (and flush) programmatically, without logging on to the server via ssh. Any help is appreciated.

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • How to retrieve view of MultiIndex DataFrame

    - by Henry S. Harrison
    This question was inspired by this question. I had the same problem, updating a MultiIndex DataFrame by selection. The drop_level=False solution in Pandas 0.13 will allow me to achieve the same result, but I am still wondering why I cannot get a view from the MultiIndex DataFrame. In other words, why does this not work?: >>> sat = d.xs('sat', level='day', copy=False) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "C:\Python27\lib\site-packages\pandas\core\frame.py", line 2248, in xs raise ValueError('Cannot retrieve view (copy=False)') ValueError: Cannot retrieve view (copy=False) Of course it could be only because it is not implemented, but is there a reason? Is it somehow ambiguous or impossible to implement? Returning a view is more intuitive to me than returning a copy then later updating the original. I looked through the source and it seems this situation is checked explicitly to raise an error. Alternatively, is it possible to get the same sort of view from any of the other indexing methods? I've experimented but have not been successful. [edit] Some potential implementations are discussed here. I guess with the last question above I'm wondering what the current best solution is to index into arbitrary multiindex slices and cross-sections.

    Read the article

  • basic unique ModelForm field for Google App Engine

    - by Alexander Vasiljev
    I do not care about concurrency issues. It is relatively easy to build unique form field: from django import forms class UniqueUserEmailField(forms.CharField): def clean(self, value): self.check_uniqueness(super(UniqueUserEmailField, self).clean(value)) def check_uniqueness(self, value): same_user = users.User.all().filter('email', value).get() if same_user: raise forms.ValidationError('%s already_registered' % value) so one could add users on-the-fly. Editing existing user is tricky. This field would not allow to save user having other user email. At the same time it would not allow to save a user with the same email. What code do you use to put a field with uniqueness check into ModelForm?

    Read the article

  • Error handling in the RequestHandler without embedding in URI

    - by hyn
    When a user sends a filled form, I want to print an error message in case there is an input error. One of the GAE sample codes does this by embedding the error message in the URI. Inside the form handler (get): self.redirect('/compose?error_message=%s' % message) and in the handler (get) of redirected URI, gets the message from request: values = { 'error_message': self.request.get('error_message'), ... Is there a way to accomplish the same without embedding the message in the URI?

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • Tkinter Gui to read in csv file and generate buttons based on the entries in the first row

    - by Thomas Jensen
    I need to write a gui in Tkinter that can choose a csv file, read it in and generate a sequence of buttons based on the names in the first row of the csv file (later the data in the csv file should be used to run a number of simulations). So far I have managed to write a Tkinter gui that will read the csv file, but I am stomped as to how I should proceed: from Tkinter import * import tkFileDialog import csv class Application(Frame): def __init__(self, master = None): Frame.__init__(self,master) self.grid() self.createWidgets() def createWidgets(self): top = self.winfo_toplevel() self.menuBar = Menu(top) top["menu"] = self.menuBar self.subMenu = Menu(self.menuBar) self.menuBar.add_cascade(label = "File", menu = self.subMenu) self.subMenu.add_command( label = "Read Data",command = self.readCSV) def readCSV(self): self.filename = tkFileDialog.askopenfilename() f = open(self.filename,"rb") read = csv.reader(f, delimiter = ",") app = Application() app.master.title("test") app.mainloop() Any help is greatly appreciated!

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • [Django] How to find out whether a model's column is a foreign key?

    - by codethief
    I'm dynamically storing information in the database depending on the request: // table, id and column are provided by the request table_obj = getattr(models, table) record = table_obj.objects.get(pk=id) setattr(record, column, request.POST['value']) The problem is that request.POST['value'] sometimes contains a foreign record's primary key (i.e. an integer) whereas Django expects the column's value to be an object of type ForeignModel: Cannot assign "u'122'": "ModelA.b" must be a "ModelB" instance. Now, is there an elegant way to dynamically check whether b is a column containing foreign keys and what model these keys are linked to? (So that I can load the foreign record by it's primary key and assign it to ModelA?) Or doesn't Django provide information like this to the programmer so I really have to get my hands dirty and use isinstance() on the foreign-key column?

    Read the article

  • SQLAlchemy declarative syntax with autoload in Pylons

    - by Juliusz Gonera
    I would like to use autoload to use an existings database. I know how to do it without declarative syntax (model/_init_.py): def init_model(engine): """Call me before using any of the tables or classes in the model""" t_events = Table('events', Base.metadata, schema='events', autoload=True, autoload_with=engine) orm.mapper(Event, t_events) Session.configure(bind=engine) class Event(object): pass This works fine, but I would like to use declarative syntax: class Event(Base): __tablename__ = 'events' __table_args__ = {'schema': 'events', 'autoload': True} Unfortunately, this way I get: sqlalchemy.exc.UnboundExecutionError: No engine is bound to this Table's MetaData. Pass an engine to the Table via autoload_with=<someengine>, or associate the MetaData with an engine via metadata.bind=<someengine> The problem here is that I don't know where to get the engine from (to use it in autoload_with) at the stage of importing the model (it's available in init_model()). I tried adding meta.Base.metadata.bind(engine) to environment.py but it doesn't work. Anyone has found some elegant solution?

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • matplotlib.pyplot, preserve aspect ratio of the plot

    - by Headcrab
    Assuming we have a polygon coordinates as polygon = [(x1, y1), (x2, y2), ...], the following code displays the polygon: import matplotlib.pyplot as plt plt.fill(*zip(*polygon)) plt.show() By default it is trying to adjust the aspect ratio so that the polygon (or whatever other diagram) fits inside the window, and automatically changing it so that it fits even after resizing. Which is great in many cases, except when you are trying to estimate visually if the image is distorted. How to fix the aspect ratio to be strictly 1:1? (Not sure if "aspect ratio" is the right term here, so in case it is not - I need both X and Y axes to have 1:1 scale, so that (0, 1) on both X and Y takes an exact same amount of screen space. And I need to keep it 1:1 no matter how I resize the window.)

    Read the article

  • Convert object to DateRange

    - by user655832
    I'm querying an underlying PostgreSQL database using Pandas 0.8. Pandas is returning the DataFrame properly but the underlying timestamp column in my database is being returned as a generic "object" type in Pandas. As I would eventually like to seasonal normalization of my data I am curious as to how to convert this generic "object" column to something that is appropriate for analysis. Here is my current code to retrieve the data: # get records from db example import pandas.io.sql as psql import psycopg2 # define query to get all subs created this year QRY = """ select i i, i * random() f, case when random() > 0.5 then true else false end t, (current_date - (i*random())::int)::timestamp with time zone tsz from generate_series(1,1000) as s(i) order by 4 ; """ CONN_STRING = "host='localhost' port=5432 dbname='postgres' user='postgres'" # connect to db conn = psycopg2.connect(CONN_STRING) # get some data set index on relid column df = psql.frame_query(QRY, con=conn) print "Row count retrieved: %i" % (len(df),) Thanks for any help you can render. M

    Read the article

  • django-uni-form helpers and CSRF tags over POST

    - by linked
    Hi, I'm using django-uni-forms to display my fields, with a rather rudimentary example straight out of their book. When I render the form fields using <form>{%csrf_tag%} {%form|as_uni_form%}</form>, everything works as expected. However, django-uni-form Helpers allow you to generate the form tag (and other helper-related content) using the following syntax -- {% with form.helper as helper %}{% uni_form form helper%}{%endwith%} -- This creates the <form> tag for me, so there's nowhere to embed my own CSRF_token. When I try to use this syntax, the form renders perfectly, but without a CSRF token, and so submitting the form fails every time. Does anyone have experience with this? Is there an established way to add the token? I much prefer the second syntax, for re-use reasons. Thanks!

    Read the article

< Previous Page | 368 369 370 371 372 373 374 375 376 377 378 379  | Next Page >