Search Results

Search found 12039 results on 482 pages for 'job searching'.

Page 376/482 | < Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >

  • Testing warnings with doctest

    - by Eli Courtwright
    I'd like to use doctests to test the presence of certain warnings. For example, suppose I have the following module: from warnings import warn class Foo(object): """ Instantiating Foo always gives a warning: >>> foo = Foo() testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) >>> """ def __init__(self): warn("Boo!", UserWarning) If I run python -m doctest testdocs.py to run the doctest in my class and make sure that the warning is printed, I get: testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) ********************************************************************** File "testdocs.py", line 7, in testdocs.Foo Failed example: foo = Foo() Expected: testdocs.py:14: UserWarning: Boo! warn("Boo!", UserWarning) Got nothing ********************************************************************** 1 items had failures: 1 of 1 in testdocs.Foo ***Test Failed*** 1 failures. It looks like the warning is getting printed but not captured or noticed by doctest. I'm guessing that this is because warnings are printed to sys.stderr instead of sys.stdout. But this happens even when I say sys.stderr = sys.stdout at the end of my module. So is there any way to use doctests to test for warnings? I can find no mention of this one way or the other in the documentation or in my Google searching.

    Read the article

  • Cannot install XML::LibXML module on Windows

    - by Deepak Konidena
    I am trying to use XPath to extract some HTML tags and data and for that I need to use XML::LibXML module. I tried installing it from CPAN shell but it doesn't install. I followed the instructions from CPAN site about the installation, that we need to install libxml2, iconv and zlib wrappers before installing XML::LibXML and it didn't work out. Also, if there is any other simpler module that gets my task done, please let me know. The task at hand: I am searching for a specific <dd> tag on a html page which is really big ( around 5000 - 10000) <dd> and <dt> tags. So, I am writing a script which matches the content within <dd> tag and fetches the content within the corresponding (next) <dt> tag. I wish i could i have been a little more clearer. Any help is greatly appreciated.

    Read the article

  • MonoDevelop 2.8.2: Build failed. Illegal characters in path

    - by user1056607
    I have just installed MonoDevelop 2.8.2. After opening a new solution named test I attempted to run the project. I push f5 and all I see is a "Build failed. Illegal characters in path" error in the bottom left. I open up the Error List and see no errors. I have done some searching and only find solutions pertaining to projects that are beyond the scope of just the pre-generated code. This is the code: using System; namespace Test { class MainClass { public static void Main(string[] args) { Console.WriteLine("Hello World!"); } } } I have tried to uninstall/reinstall, cut out any spaces in the path to the program or the solution, and even opened VS2010 and just copy pasted that code over. I've looked over my options under tools, solution options under project, and the project's options. I am running MD 2.8.2 with GTK# and Microsoft's .NET runtime. Let me know if you need anymore information. Any help would be appreciated. Thank you for your time!

    Read the article

  • Free solution for automatic updates with a .NET/C# app?

    - by a2h
    Yes, from searching I can see this has been asked time and time again. Here's a backstory. I'm an individual hobbyist developer with zero budget. A program I've been developing has been in need of constant bugfixes, and me and users are getting tired of having to manually update. Me, because my current solution of Manually FTP to my website Update a file "newest.txt" with the newest version Update index.html with a link to the newest version Hope for people to see the "there's an update" message Have them manually download the update sucks, and whenever I screw up an update, I get pitchforks. Users, because, well, "Are you ever going to implement auto-update?" "Will there ever be an auto-update feature?" Over the past I have looked into: WinSparkle - No in-app updates, and the DLL is 500 KB. My current solution is a few KBs in the executable and has no in-app updates. http://windowsclient.net/articles/appupdater.aspx - I can't comprehend the documentation http://www.codeproject.com/KB/vb/Auto_Update_Revisited.aspx - Doesn't appear to support anything other than working with files that aren't in use wyUpdate - wyBuild isn't free, and the file specification is simply too complex. Maybe if I was under a company paying me I could spend the time, but then I may as well pay for wyBuild. http://www.kineticjump.com/update/default.aspx - Ditto the last sentence. ClickOnce - Workarounds for implementing launching on startup are massive, horrendous and not worth it for such a simple feature. Publishing is a pain; manual FTP and replace of all files is required for servers without FrontPage Extensions. I'm pretty much ready to throw in the towel right now and strangle myself. And then I think about Sparkle... EDIT: I came across SparkleDotNET just then. Looks good, though the DLL is 200 KB. Don't know if that's really that big of an issue, though.

    Read the article

  • video streaming over http in blackberry

    - by ysnky
    hi all, while i was searching video player over http, i found the article which is located at this url; http://www.blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/Stream ing_media_-_Start_to_finish.html?nodeid=2456737&ve rnum=0 i can run by adding ";deviceside=true" at the end of url. it works fine in the jde4.5 simulator. it gets 3gp videos from my local server. i tested with 580kb files and works fine. but when i get the same file from my server (not local, real server) i have problems with big files (e.g 580 kb). it plays 180kb files (but sometimes it does not play this file either) but not plays 580kb file. and also i deployed my application to my 9000 device it sometimes plays small file (180kb) but never plays big file (580kb). why it plays if it is on my local file, not play in real world? i ve stucked for days. hope you help me. and also the code at the url given below is not work, the only code i ve found is the above. blackberry.com/knowledgecenterpublic/livelink.exe/fetch/2000/348583/800332/1089414/How_To _-_Play_video_within_a_BlackBerry_smartphone_appli cation.html?nodeid=1383173&vernum=0 btw, there is no method such as resize(long param) of CircularByteBuffer class. so i comment relavent line (buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); as shown below. public void increaseBufferCapacity(int percent) { if(percent < 0){ log(0, "FAILED! SP.setBufferCapacity() - " + percent); throw new IllegalArgumentException("Increase factor must be positive.."); } synchronized(readLock){ synchronized(connectionLock){ synchronized(userSeekLock){ synchronized(mediaIStream){ log(0, "SP.setBufferCapacity() - " + percent); //buffer.resize(buffer.getSize() + (buffer.getSize() * percent / 100)); this.bufferCapacity = buffer.getSize(); } } } } } thanks in advance.

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • acts_as_solr isn't updating associated models in Rails

    - by Trey Bean
    I'm using acts_as_solr for searching in a project. Unfortunately, the index doesn't seem to be updated for the associated models when a model is saved. Example: I have three models: class Merchant < ActiveRecord::Base acts_as_solr :fields => [:name, :domain, :description], :include => [:coupons, :tags] ... end class Coupon < ActiveRecord::Base acts_as_solr :fields => [:store_name, :url, :code, :description] ... end class Tag < ActiveRecord::Base acts_as_solr :fields => [:name] ... end I use the following line to perform a search: Merchant.paginate_by_solr(params[:q], :per_page => PER_PAGE, :page => [(params[:page] || 1).to_i, 1].max) For some reason though, after I add a coupon that contains the word 'shoes' in the description, a query for 'shoes' doesn't return the merchant associated with the coupon. The association all work and if I run rake solr:reindex, the search then returns the new coupon. Do I need to update the index for Merchant each time a new coupon is created? Do I have to update the index for the whole class or can I just update the associated merchant? Shouldn't this be done automatically? Thanks for any input.

    Read the article

  • Open Source CMS (.Net vs Java)

    - by CmsAndDotNetKindaGuy
    I must say up-front that this is not a strictly programming-related question and a very opinionated one. I am the lead developer of the dominant .Net CMS in my country and I don't like my own product :). Managerial decisions over what is important or not and large chunks of legacy code done before I joined gives me headache every day I go for work. Anyway, having a vast amount of experience in web industry and a very good grasp of C# and programming practices I'm designing my own CMS the past few months. Now the problem is that I'm an open source kinda guy so I have a dilemma. Should I use C# and .Net which has crippled multi-platform support or should I drop .Net entirely and start learning Java where I can create a truly open-source and cross-platform CMS? Please don't answer that I should contribute to an existing open source CMS. I ruled that out after spending a great deal of time searching for something similar in structure to what I have in mind. I am not a native speaker, so feel free to correct my syntax or rephrase my question.

    Read the article

  • Creating nodes porgramatically in Drupal 6

    - by John
    Hey, I have been searching for how to create nodes in Drupal 6. I found some entries here on stackoverflow, but the questions seemed to either be for older versions or the solutions did not work for me. Ok, so here is my current process for trying to create $node = new stdClass(); $node->title = "test title"; $node->body = "test body"; $node->type= "story"; $node->created = time(); $node->changed = $node->created; $node->status = 1; $node->promote = 1; $node->sticky = 0; $node->format = 1; $node->uid = 1; node_save( $node ); When I execute this code, the node is created, but when I got the administration page, it throws the following errors: warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. user warning: Duplicate entry '36' for key 1 query: INSERT INTO node_comment_statistics (nid, last_comment_timestamp, last_comment_name, last_comment_uid, comment_count) VALUES (36, 1269980590, NULL, 1, 0) in C:\wamp\www\steelylib\sites\all\modules\nodecomment\nodecomment.module on line 409. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. warning: Invalid argument supplied for foreach() in C:\wamp\www\steelylib\includes\menu.inc on line 258. I've looked at different tutorials, and all seem to follow the same process. I'm not sure what I am doing wrong. I am using Drupal 6.15. When I roll back the database (to right before I made the changes) the errors are gone. Any help is appreciated!

    Read the article

  • Add new language to existing Xcode project localization

    - by leolobato
    Hey guys, I'm working on an existing Xcode 3.2.2 Universal iPhone OS project which is already localized for 4 languages (EN, IT, DE and FR). We are now adding a new language (JA) into this project. Each existing .lproj folder (en.lproj, it.lproj, de.lproj and fr.lproj) has almost 60 files - including PNGs, HTMLs and the Localizable.strings file. Each one of those files appear as localized groups inside Groups & Files in Xcode. They're spread all over the tree. If I right-click one of those groups (say, Localizable.strings) inside Xcode, Get Info, click on "Add Localization" and type "ja" - as the Xcode docs suggest, nothing happens. From what I read in this newgroup, it's possibly because of the way those folders are named. If they were named like English.lproj and Italian.lproj, this was supposed to work. So, for me to actually import a new language localized file into the existing group, I have to: Right-click the localized group file. Choose "Add Existing File". Select the corresponding file inside the ja.lproj folder. I'm about to get a new ja.lproj folder with those 60 localized files and would love to import them in the project in a way that doesn't involve searching for every single file in Groups & Trees and performing those steps... for every one of those 60 files. Is that possible? Is there a right (or better) way to import a new language into this Xcode project?

    Read the article

  • Sql Server Compact - Schema Management

    - by Richard B
    I've been searching for some time for a good solution to implement the idea of managing schema on a Sql Server Compact 3.5 db. I know of several ways of managing schema on Sql Express/std/enterprise, but Compact Edition doesn't support the necessary tools required to use the same methodology. Any suggestions/tips? I should expand this to say that it is for 100+ clients with wrapperware software. As the system changes, I need to publish update scripts alongside the new binaries to the client. I was looking for a decent method by which to publish this without having to just hand the client a script file and say "Run this in SSMSE". Most clients are not capable of doing such a beast. A buddy of mine disclosed a partial script on how to handle the SQL Server piece of my task, but never worked on Compact Edition... It looks like I'll be on my own for this. What I think that I've decided to do, and it's going to need a "geek week" to accomplish, is that I'm going to write some sort of tool much like how WiX and nAnt works, so that I can just write an overzealous Xml document to handle the work. If I think that it is worthwhile, I'll publish it on CodePlex and/or CodeProject because I've used both sites a bit to gain better understanding of concepts for jobs I've done in the past, and I think it is probably worthwhile to give back a little.

    Read the article

  • DjangoUnicodeDecodeError while storing pickle'd data.

    - by Jack M.
    I've got a simple dict object I'm trying to store in the database after it has been run through pickle. It seems that Django doesn't like trying to encode this error. I've checked with MySQL, and the query isn't even getting there before it is throwing the error, so I don't believe that is the problem. The dict I'm storing looks like this: { 'ordered': [ { 'value': u'First\xd1ame Last\xd1ame', 'label': u'Full Name' }, { 'value': u'123-456-7890', 'label': u'Phone Number' }, { 'value': u'[email protected]', 'label': u'Email Address' } ], 'cleaned_data': { u'Phone Number': u'123-456-7890', u'Full Name': u'First\xd1ame Last\xd1ame', u'Email Address': u'[email protected]' }, 'post_data': <QueryDict: { u'Phone Number': [u'1234567890'], u'Full Name_1': [u'Last\xd1ame'], u'Full Name_0': [u'First\xd1ame'], u'Email Address': [u'[email protected]'] }>, 'user': <User: itis> } The error that gets thrown is: 'utf8' codec can't decode bytes in position 52-53: invalid data. Position 52-53 is the first instance of \xd1 (Ñ) in the pickled data. So far, I've dug around StackOverflow and found a few questions where the database encoding for the objects was wrong. This doesn't help me because there is no MySQL query yet. This is happening before the database. Google also didn't help much when searching for unicode errors on pickled data. It is probably worth mentioning that if I don't use the Ñ, this code works fine.

    Read the article

  • Fuzzy Search on Material Descriptions including numerical sizes & general descriptions of material t

    - by Kyle
    We're looking to provide a fuzzy search on an electrical materials database (i.e. conduit, cable, etc.). The problem is that, because of a lack of consistency across all material types, we could not split sizes into separate fields from the text description because some materials are rated by things other than size. I've attempted a combination of a full text search & a SQL CLR implementation of the Levenshtein search algorithm (for assistance in ranking), but my results are a little funky (i.e. they are not sorting correctly due to improper ranking). For example, if the search term is "3/4" ABCD Conduit", I'll might get back several irrelevant results in the following order: 1/2" Conduit 1/4" X 3/4" Cable 1/4" Cable Ties 3/4" DFC Conduit Tees 3/4" ABCD Conduit 3/4" Conduit I believe I've nailed the problem down to the fact that these two search algorithms do not factor in the relevance of punctuation & numeric. That is, in such a search, I'd expect the size to take precedence over any fuzzy match on the rest of the description, but my results don't reflect that. My question is: Can anyone recommend better search algorithms or different approaches that may be better suited for searching a combination of alphanumerics & punctuation characters?

    Read the article

  • Hibernate: Dirty Checking and Only Update of Dirty Attributes?

    - by jens
    Hello Experts, in "good old JDBC days" I wrote a lot of SQL Queries that did very targeted updates of only the "attributes/members" that were actually changed: For Example having an object with the following members: public String name; public String address; public Date date; If only date was changed in some Business Method I would only issue an SQL UPDATE for the date member. ==It seems however (thats my "impression" of hibernate) that when working with a standard Hibernate mapping (mapping the full class), even updates of only one single member lead to a full update of the object in SQL Statements generated by Hibernate. My Questions are: 1.) Is this observation correct, that hibernate DOES NOT intelligently check (in a fully mapped class), what member(s) where changed and then only issue updates for the specific changed members, but rather always will update (in the generated SQL Update Statement) all mapped members (of a class), even if they were not changed (in case the object is dirty due to one member being dirty...) 2.) What can I do to make Hibernate only update those members, that have been changed? I am searching for a solution to have hibernate only update the member that actually changed. (I know hibernate does some big work on doing dirty-checking, but as far as I know this dirtychecking is only relevant to identify if the object as whole is dirty, not what single member is dirty.) Thank you very much! Jens

    Read the article

  • Rest WebService error handling.

    - by Pratik
    Hi there, I am using RestWebservice for few basic operations , like creating/searching. The request xml looks something like this <customer> <name/> ..... </customer> For a successful operation I return the same customer XML with extra fields populated in it(eg. systemId etc which we blank in the request) . with Response.Status=2000 For an unsuccessful operation i return something like this with different error codes . e.g Response.Status = 422(Unprocessable entity) Response.Status= 500(Internal Server Error) and few others.. <errors> <error> An exception occurred while creating the customer</error> <error> blah argument is not valid.</error> </errors> Now i am not sure , whether this is the correct way of sending the errors to the client. Maybe it should be present in the header of the response. I will really appreciate any help. Thanks!

    Read the article

  • Correct method to search for AD user by email address from .NET

    - by BrianLy
    I'm having some issues with code that is intended to find a user in Active Directory by searching on their email address. I have tried 2 methods but I'm sometimes finding that the FindOne() method will not return any results on some occasions. If I look up the user in the GAL in Outlook I see the SMTP email address listed. My end goal is to confirm that the user exists in AD. I only have the email address as search criteria, so no way to use first or last name. Method 1: Using mail property: DirectorySearcher search = new DirectorySearcher(entry); search.Filter = "(mail=" + email + ")"; search.PropertiesToLoad.Add("mail"); SearchResult result = search.FindOne(); Method 2: proxyAddresses property: DirectorySearcher search = new DirectorySearcher(entry); search.Filter = "(proxyAddresses=SMTP:" + email + ")"; // I've also tried with =smtp: search.PropertiesToLoad.Add("mail"); SearchResult result = search.FindOne(); I've tried changing the case of the email address input but it still does not return a result. Is there a problem here with case sensitivity? If so, what is the best way to resolve it?

    Read the article

  • SQL Server - Multi-Column substring matching

    - by hamlin11
    One of my clients is hooked on multi-column substring matching. I understand that Contains and FreeText search for words (and at least in the case of Contains, word prefixes). However, based upon my understanding of this MSDN book, neither of these nor their variants are capable of searching substrings. I have used LIKE rather extensively (Select * from A where A.B Like '%substr%') Sample table A: ID | Col1 | Col2 | Col3 | ------------------------------------- 1 | oklahoma | colorado | Utah | 2 | arkansas | colorado | oklahoma | 3 | florida | michigan | florida | ------------------------------------- The following code will give us row 1 and row 2: select * from A where Col1 like '%klah%' or Col2 like '%klah%' or Col3 like '%klah%' This is rather ugly, probably slow, and I just don't like it very much. Probably because the implementations that I'm dealing with have 10+ columns that need searched. The following may be a slight improvement as code readability goes, but as far as performance, we're still in the same ball park. select * from A where (Col1 + ' ' + Col2 + ' ' + Col3) like '%klah%' I have thought about simply adding insert, update, and delete triggers that simply add the concatenated version of the above columns into a separate table that shadows this table. Sample Shadow_Table: ID | searchtext | --------------------------------- 1 | oklahoma colorado Utah | 2 | arkansas colorado oklahoma | 3 | florida michigan florida | --------------------------------- This would allow us to perform the following query to search for '%klah%' select * from Shadow_Table where searchtext like '%klah%' I really don't like having to remember that this shadow table exists and that I'm supposed to use it when I am performing multi-column substring matching, but it probably yields pretty quick reads at the expense of write and storage space. My gut feeling tells me there there is an existing solution built into SQL Server 2008. However, I don't seem to be able to find anything other than research papers on the subject. Any help would be appreciated.

    Read the article

  • An implementation of Sharir's or Aurenhammer's deterministic algorithm for calculating the intersect

    - by RGrey
    The problem of finding the intersection/union of 'N' discs/circles on a flat plane was first proposed by M. I. Shamos in his 1978 thesis: Shamos, M. I. “Computational Geometry” Ph.D. thesis, Yale Univ., New Haven, CT 1978. Since then, in 1985, Micha Sharir presented an O(n log2n) time and O(n) space deterministic algorithm for the disc intersection/union problem (based on modified Voronoi diagrams): Sharir, M. Intersection and closest-pair problems for a set of planar discs. SIAM .J Comput. 14 (1985), pp. 448-468. In 1988, Franz Aurenhammer presented a more efficient O(n log n) time and O(n) space algorithm for circle intersection/union using power diagrams (generalizations of Voronoi diagrams): Aurenhammer, F. Improved algorithms for discs and balls using power diagrams. Journal of Algorithms 9 (1985), pp. 151-161. Earlier in 1983, Paul G. Spirakis also presented an O(n^2) time deterministic algorithm, and an O(n) probabilistic algorithm: Spirakis, P.G. Very Fast Algorithms for the Area of the Union of Many Circles. Rep. 98, Dept. Comput. Sci., Courant Institute, New York University, 1983. I've been searching for any implementations of the algorithms above, focusing on computational geometry packages, and I haven't found anything yet. As neither appear trivial to put into practice, it would be really neat if someone could point me in the right direction!

    Read the article

  • Which technology is best suited to store and query a huge readonly graph?

    - by asmaier
    I have a huge directed graph: It consists of 1.6 million nodes and 30 million edges. I want the users to be able to find all the shortest connections (including incoming and outgoing edges) between two nodes of the graph (via a web interface). At the moment I have stored the graph in a PostgreSQL database. But that solution is not very efficient and elegant, I basically need to store all the edges of the graph twice (see my question PostgreSQL: How to optimize my database for storing and querying a huge graph). It was suggested to me to use a GraphDB like neo4j or AllegroGraph. However the free version of AllegroGraph is limited to 50 million nodes and also has a very high-level API (RDF), which seems too powerful and complex for my problem. Neo4j on the other hand has only a very low level API (and the python interface is not mature yet). Both of them seem to be more suited for problems, where nodes and edges are frequently added or removed to a graph. For a simple search on a graph, these GraphDBs seem to be too complex. One idea I had would be to "misuse" a search engine like Lucene for the job, since I'm basically only searching connections in a graph. Another idea would be, to have a server process, storing the whole graph (500MB to 1GB) in memory. The clients could then query the server process and could transverse the graph very quickly, since the graph is stored in memory. Is there an easy possibility to write such a server (preferably in Python) using some existing framework? Which technology would you use to store and query such a huge readonly graph?

    Read the article

  • Combo-box values automatically update

    - by glinch
    Hi all, hopefully somebody can help The table structure is as follows: tblCompany: compID compName tblOffice: offID, compID, add1, add2, add3 etc... tblEmployee: empID Name, telNo, etc... offID I have a form that contains contact details for employees, all works ok using after update. A cascading combo box, cmbComp, allows me to select a company, and inturn select the appropriate office, cboOff, and updates the corresponding tblEmployee.offID field correctly. Fields are automatically updated for the address also cmbComp: RowSource SELECT DISTINCT tblOffice.compID, tblCompany.compID FROM tblCompany INNER JOIN AdjusterCompanyOffice ON tblCompany.compID=tblOffice.compID ORDER BY tblCompany.compName; cboOff: RowSource SELECT tblCompany.offID, tblCompany.Address1, tblCompany.Address2, tblCompany.Address3, tblCompany.Address4, tblCompany.Address5 FROM tblCompany ORDER BY tblCompany.Address1; The problem I am having is that when i load a new record how to retrieve the data and automatically load the cmbComp and text fields. The cboOff combo box loads correctly as the control source for this is the offID I imagine there must be a way of setting the value on opening the record? Not sure how though. I dont think I can set the controlsource cmbComp or text fields, or can I? Any help/point in the right direction appreciated, have been searching for a way to do this but cant get anywhere!

    Read the article

  • SEO on a Database Driven Website

    - by Ryan Giglio
    I have a question about a site I'm developing. It is a database driven directory site where people can make a profile and list themselves in one or many area codes and in one or many fields of work. When someone is looking for a person to hire, they enter one or more area codes to look in (or select them with checkboxes) and when the form submits, it saves these as a cookie so the site remembers what location you were searching in. You then narrow down your search by category and field (which are links) and get a listing of all the profiles that match your search. What I am concerned about is this: because a search engine can't type in or select area codes to search in, how is it going to find and index any of the profile pages? It doesn't allow the user to search for people without first selecting an area code, because there's no practical purpose to do so. There would also be no practical purpose from a user experience/usability standpoint of simply having a list of each area code as a link to the categories page, but as far as I know, isn't that the only way for search engines to see every person? How does a site like Facebook accomplish this? There isn't some sort of master directory with a link to ever single Facebook user's profile page, and yet they're often the #1 search result for a person's name.

    Read the article

  • Embedding a CMS in an MVC Web App

    - by Mr Snuffle
    I'm working on a website for searching for businesses, then displaying a listing page. We've been toying with the idea of letting the clients manage their listing page using an external CMS. I'm not sure how often this is done, or if it's even best practice. Ideally, we want to be able to setup a listing on our website, then give the clients access to an external CRM when they can manage their listing page. We then want to embed this custom page within our website, possibly using an iframe (which will come along with it's own set of complications). We'd like this integration to be as seamless as possible. I'd personally prefer it if we could directly inject the HTML into our own page and bypass an iframe all together, but I don't know of any CMS hosting services that provide the interface for such a thing. We've experimented a little with Squarespace, and we can get a fairly clean version of someone's page which would be well suited for an iframe. I'm wondering if anyone else has looked and integrating an external hosting CMS into a website (in this case, we're using ASP.NET MVC). We'd also want to automate the creation of accounts on this external CMS, so when a user signed up we could just point them to the website with some login details. I have no idea if anyone offers a service like this, but any recommendations would be greatly appreciated. We could host a service ourself too, but the aim is to have an external system that clients can use to manage their pages. Cheers, James

    Read the article

  • Adding a guideline to the editor in Visual Studio

    - by xsl
    Introduction I've always been searching for a way to make Visual Studio draw a line after a certain amount of characters: Below is a guide to enable these so called guidelines for various versions of Visual Studio. Visual Studio 2010 Install Paul Harrington's Editor Guidelines extension. Open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\10.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. Or install the Guidelines UI extension, which will add entries to the editor's context menu for adding/removing the entries without needing to edit the registry directly. The current disadvantage of this method is that you can't specify the column directly. Visual Studio 2008 and Other Versions If you are using Visual Studio 2008 open the registry at HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor and add a new string called Guides with the value RGB(100,100,100), 80. The first part specifies the color, while the other one (80) is the column the line will be displayed. The vertical line will appear, when you restart Visual Studio. This trick also works for various other version of Visual Studio, as long as you use the correct path: 2003: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\7.1\Text Editor 2005: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\8.0\Text Editor 2008: HKEY_CURRENT_USER\Software\Microsoft\VisualStudio\9.0\Text Editor 2008 Express: HKEY_CURRENT_USER\Software\Microsoft\VCExpress\9.0\Text Editor This also works in SQL Server 2005 and probably other versions.

    Read the article

  • Application passwords and SQLite security

    - by Bryan
    I have been searching on google for information regarding application passwords and SQLite security for some time, and nothing that I have found has really answered my questions. Here is what I am trying to figure out: 1) My application is going to have an optional password activity that will be called when the application is first opened. My questions for this are a) If I store the password via android preference or SQLite database, how can I ensure security and privacy for the password, and b) how should password recovery be handled? Regarding b) from above, I have thought about requiring an email address when the password feature is enabled, and also a password hint question for use when requesting password recovery. Upon successfully answering the hint question, the password is then emailed to the email address that was submitted. I am not completely confident in the security and privacy of the email method, especially if the email is sent when the user is connected to an open, public wireless network. 2) My application will be using an SQLite database, which will be stored on the SD card if the user has one. Regardless of whether it is stored on the phone or the SD card, what options do I have for data encryption, and how does that affect the application performance? Thanks in advance for time taken to answer these questions. I think that there may be other developers struggling with the same concerns.

    Read the article

< Previous Page | 372 373 374 375 376 377 378 379 380 381 382 383  | Next Page >