Search Results

Search found 40799 results on 1632 pages for 'type slicing'.

Page 378/1632 | < Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >

  • Blink-Data vs Instinct?

    - by Samantha.Y. Ma
    In his landmark bestseller Blink, well-known author and journalist Malcolm Gladwell explores how human beings everyday make seemingly instantaneous choices --in the blink of an eye--and how we “think without thinking.”  These situations actually aren’t as simple as they seem, he postulates; and throughout the book, Gladwell seeks answers to questions such as: 1.    What makes some people good at thinking on their feet and making quick spontaneous decisions?2.    Why do some people follow their instincts and win, while others consistently seem to stumble into error?3.    Why are some of the best decisions often those that are difficult to explain to others?In Blink, Gladwell introduces us to the psychologist who has learned to predict whether a marriage will last, based on a few minutes of observing a couple; the tennis coach who knows when a player will double-fault before the racket even makes contact with the ball; the antiquities experts who recognize a fake at a glance. Ultimately, Blink reveals that great decision makers aren't those who spend the most time deliberating or analyzing information, but those who focus on key factors among an overwhelming number of variables-- i.e., those who have perfected the art of "thin-slicing.” In Data vs. Instinct: Perfecting Global Sales Performance, a new report sponsored by Oracle, the Economist Intelligence Unit (EIU) explores the roles data and instinct play in decision-making by sales managers and discusses how sales executives can increase sales performance through more effective  territory planning and incentive/compensation strategies.If you are a sales executive, ask yourself this:  “Do you rely on knowledge (data) when you plan out your sales strategy?  If you rely on data, how do you ensure that your data sources are reliable, up-to-date, and complete?  With the emergence of social media and the proliferation of both structured and unstructured data, how do you know that you are applying your information/data correctly and in-context?  Three key findings in the report are:•    Six out of ten executives say they rely more on data than instinct to drive decisions. •    Nearly one half (48 percent) of incentive compensation plans do not achieve the desired results. •    Senior sales executives rely more on current and historical data than on forecast data. Strikingly similar to what Gladwell concludes in Blink, the report’s authors succinctly sum up their findings: "The best outcome is a combination of timely information, insightful predictions, and support data."Applying this insight is crucial to creating a sound sales plan that drives alignment and results.  In the area of sales performance management, “territory programs and incentive compensation continue to present particularly complex challenges in an increasingly globalized market," say the report’s authors. "It behooves companies to get a better handle on translating that data into actionable and effective plans." To help solve this challenge, CRM Oracle Fusion integrates forecasting, quotas, compensation, and territories into a single system.   For example, Oracle Fusion CRM provides a natural integration between territories, which define the sales targets (e.g., collection of accounts) for the sales force, and quotas, which quantify the sales targets. In fact, territory hierarchy is a core analytic dimension to slice and dice sales results, using sales analytics and alerts to help you identify where problems are occurring. This makes territoriesStart tapping into both data and instinct effectively today with Oracle Fusion CRM.   Here is a short video to provide you with a snapshot of how it can help you optimize your sales performance.  

    Read the article

  • Using CSS3 media queries in HTML 5 pages

    - by nikolaosk
    This is going to be the seventh post in a series of posts regarding HTML 5. You can find the other posts here , here , here, here , here and here. In this post I will provide a hands-on example on how to use CSS 3 Media Queries in HTML 5 pages. This is a very important feature since nowadays lots of users view websites through their mobile devices. Web designers were able to define media-specific style sheets for quite a while, but have been limited to the type of output. The output could only be Screen, Print .The way we used to do things before CSS 3 was to have separate CSS files and the browser decided which style sheet to use. Please have a look at the snippet below - HTML 4 media queries <link rel="stylesheet" type="text/css" media="screen" href="styles.css"> <link rel="stylesheet" type="text/css" media="print" href="print-styles.css"> ?he browser determines which style to use. With CSS 3 we can have all media queries in one stylesheet. Media queries can determine the resolution of the device, the orientation of the device, the width and height of the device and the width and height of the browser window.We can also include CSS 3 media queries in separate stylesheets. In order to be absolutely clear this is not (and could not be) a detailed tutorial on HTML 5. There are other great resources for that.Navigate to the excellent interactive tutorials of W3School. Another excellent resource is HTML 5 Doctor. Two very nice sites that show you what features and specifications are implemented by various browsers and their versions are http://caniuse.com/ and http://html5test.com/. At this times Chrome seems to support most of HTML 5 specifications.Another excellent way to find out if the browser supports HTML 5 and CSS 3 features is to use the Javascript lightweight library Modernizr. In this hands-on example I will be using Expression Web 4.0.This application is not a free application. You can use any HTML editor you like.You can use Visual Studio 2012 Express edition. You can download it here. Before I go on with the actual demo I will use the (http://www.caniuse.com) to see the support for CSS 3 Media Queries from the latest versions of modern browsers. Please have a look at the picture below. We see that all the latest versions of modern browsers support this feature. We can see that even IE 9 supports this feature.   Let's move on with the actual demo.  This is going to be a rather simple demo.I create a simple HTML 5 page. The markup follows and it is very easy to use and understand.This is a page with a 2 column layout. <!DOCTYPE html><html lang="en">  <head>    <title>HTML 5, CSS3 and JQuery</title>    <meta http-equiv="Content-Type" content="text/html;charset=utf-8" >    <link rel="stylesheet" type="text/css" href="style.css">       </head>  <body>    <div id="header">      <h1>Learn cutting edge technologies</h1>      <p>HTML 5, JQuery, CSS3</p>    </div>    <div id="main">      <div id="mainnews">        <div>          <h2>HTML 5</h2>        </div>        <div>          <p>            HTML5 is the latest version of HTML and XHTML. The HTML standard defines a single language that can be written in HTML and XML. It attempts to solve issues found in previous iterations of HTML and addresses the needs of Web Applications, an area previously not adequately covered by HTML.          </p>          <div class="quote">            <h4>Do More with Less</h4>            <p>             jQuery is a fast and concise JavaScript Library that simplifies HTML document traversing, event handling, animating, and Ajax interactions for rapid web development.             </p>            </div>          <p>            The HTML5 test(html5test.com) score is an indication of how well your browser supports the upcoming HTML5 standard and related specifications. Even though the specification isn't finalized yet, all major browser manufacturers are making sure their browser is ready for the future. Find out which parts of HTML5 are already supported by your browser today and compare the results with other browsers.                      The HTML5 test does not try to test all of the new features offered by HTML5, nor does it try to test the functionality of each feature it does detect. Despite these shortcomings we hope that by quantifying the level of support users and web developers will get an idea of how hard the browser manufacturers work on improving their browsers and the web as a development platform.</p>        </div>      </div>              <div id="CSS">        <div>          <h2>CSS 3 Intro</h2>        </div>        <div>          <p>          Cascading Style Sheets (CSS) is a style sheet language used for describing the presentation semantics (the look and formatting) of a document written in a markup language. Its most common application is to style web pages written in HTML and XHTML, but the language can also be applied to any kind of XML document, including plain XML, SVG and XUL.          </p>        </div>      </div>            <div id="CSSmore">        <div>          <h2>CSS 3 Purpose</h2>        </div>        <div>          <p>            CSS is designed primarily to enable the separation of document content (written in HTML or a similar markup language) from document presentation, including elements such as the layout, colors, and fonts.[1] This separation can improve content accessibility, provide more flexibility and control in the specification of presentation characteristics, enable multiple pages to share formatting, and reduce complexity and repetition in the structural content (such as by allowing for tableless web design).          </p>        </div>      </div>                </div>    <div id="footer">        <p>Feel free to google more about the subject</p>      </div>     </body>  </html>    The CSS code (style.css) follows  body{        line-height: 30px;        width: 1024px;        background-color:#eee;      }            p{        font-size:17px;    font-family:"Comic Sans MS"      }      p,h2,h3,h4{        margin: 0 0 20px 0;      }            #main, #header, #footer{        width: 100%;        margin: 0px auto;        display:block;      }            #header{        text-align: center;         border-bottom: 1px solid #000;         margin-bottom: 30px;      }            #footer{        text-align: center;         border-top: 1px solid #000;         margin-bottom: 30px;      }            .quote{        width: 200px;       margin-left: 10px;       padding: 5px;       float: right;       border: 2px solid #000;       background-color:#F9ACAE;      }            .quote :last-child{        margin-bottom: 0;      }            #main{        column-count:2;        column-gap:20px;        column-rule: 1px solid #000;        -moz-column-count: 2;        -webkit-column-count: 2;        -moz-column-gap: 20px;        -webkit-column-gap: 20px;        -moz-column-rule: 1px solid #000;        -webkit-column-rule: 1px solid #000;      } Now I view the page in the browser.Now I am going to write a media query and add some more rules in the .css file in order to change the layout of the page when the page is viewed by mobile devices. @media only screen and (max-width: 480px) {          body{            width: 480px;          }          #main{            -moz-column-count: 1;            -webkit-column-count: 1;          }        }   I am specifying that this media query applies only to screen and a max width of 480 px. If this condition is true, then I add new rules for the body element. I change the number of columns to one. This rule will not be applied unless the maximum width is 480px or less.  As I decrease the size-width of the browser window I see no change in the column's layout. Have a look at the picture below. When I resize the window and the width of the browser so the width is less than 480px, the media query and its respective rules take effect.We can scroll vertically to view the content which is a more optimised viewing experience for mobile devices. Have a look at the picture below Hope it helps!!!!

    Read the article

  • Windows XP - Security Update for Windows XP (KB923561) (KB946648) (KB956572) (KB958644)

    - by leeand00
    My father's computer has Windows XP, but when I try to install the service packs it always fails. What gives? Here are the errors that I get in the event log: Date: 2/6/2010 Time: 12:02:18 AM Type: Error User: N/A Computer: EVO Source: Windows Update Agent Category: Installation Event ID: 20 Installation Failure: Windows failed to install the following update with error 0x80070002: Security Update for Windows XP (KB946648). For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. 0000: 57 69 6e 33 32 48 52 65 Win32HRe 0008: 73 75 6c 74 3d 30 78 38 sult=0x8 0010: 30 30 37 30 30 30 32 20 0070002 0018: 55 70 64 61 74 65 49 44 UpdateID 0020: 3d 7b 38 33 44 31 41 44 ={83D1AD 0028: 46 35 2d 37 37 39 44 2d F5-779D- 0030: 34 30 31 36 2d 38 43 33 4016-8C3 0038: 31 2d 35 34 39 32 37 30 1-549270 0040: 46 36 37 42 33 46 7d 20 F67B3F} 0048: 52 65 76 69 73 69 6f 6e Revision 0050: 4e 75 6d 62 65 72 3d 31 Number=1 0058: 30 34 20 00 04 . Date: 2/6/2010 Time: 12:02:18 AM Type: Error User: N/A Computer: EVO Source: Windows Update Agent Catagory: Installation Event ID: 20 Installation Failure: Windows failed to install the following update with error 0x80070002: Security Update for Windows XP (KB956572). For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. 0000: 57 69 6e 33 32 48 52 65 Win32HRe 0008: 73 75 6c 74 3d 30 78 38 sult=0x8 0010: 30 30 37 30 30 30 32 20 0070002 0018: 55 70 64 61 74 65 49 44 UpdateID 0020: 3d 7b 44 46 32 46 30 41 ={DF2F0A 0028: 39 38 2d 36 45 33 35 2d 98-6E35- 0030: 34 33 37 39 2d 41 42 33 4379-AB3 0038: 33 2d 41 30 33 30 33 45 3-A0303E 0040: 46 37 34 42 32 41 7d 20 F74B2A} 0048: 52 65 76 69 73 69 6f 6e Revision 0050: 4e 75 6d 62 65 72 3d 31 Number=1 0058: 30 32 20 00 02 . Date: 2/6/2010 Time: 12:02:18 AM Type: Error User: N/A Computer EVO Source: Windows Update Agent Event ID: 20 Installation Failure: Windows failed to install the following update with error 0x80070002: Security Update for Windows XP (KB958644). For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. 0000: 57 69 6e 33 32 48 52 65 Win32HRe 0008: 73 75 6c 74 3d 30 78 38 sult=0x8 0010: 30 30 37 30 30 30 32 20 0070002 0018: 55 70 64 61 74 65 49 44 UpdateID 0020: 3d 7b 39 33 39 37 41 32 ={9397A2 0028: 31 46 2d 32 34 36 43 2d 1F-246C- 0030: 34 35 33 42 2d 41 43 30 453B-AC0 0038: 35 2d 36 35 42 46 34 46 5-65BF4F 0040: 43 36 42 36 38 42 7d 20 C6B68B} 0048: 52 65 76 69 73 69 6f 6e Revision 0050: 4e 75 6d 62 65 72 3d 31 Number=1 0058: 30 31 20 00 01 . Date: 2/6/2010 Time: 12:02:18 AM Type: Error User: N/A Computer: EVO Source: Windows Update Agent Category: Installation Event ID: 20 Installation Failure: Windows failed to install the following update with error 0x80070002: Security Update for Windows XP (KB923561). For more information, see Help and Support Center at http://go.microsoft.com/fwlink/events.asp. 0000: 57 69 6e 33 32 48 52 65 Win32HRe 0008: 73 75 6c 74 3d 30 78 38 sult=0x8 0010: 30 30 37 30 30 30 32 20 0070002 0018: 55 70 64 61 74 65 49 44 UpdateID 0020: 3d 7b 33 31 30 41 34 43 ={310A4C 0028: 30 38 2d 35 39 33 44 2d 08-593D- 0030: 34 31 41 33 2d 42 42 35 41A3-BB5 0038: 37 2d 38 33 42 33 38 36 7-83B386 0040: 44 37 37 33 42 35 7d 20 D773B5} 0048: 52 65 76 69 73 69 6f 6e Revision 0050: 4e 75 6d 62 65 72 3d 31 Number=1 0058: 30 33 20 00 03 . Thank you, Andrew

    Read the article

  • Wifi not working after a few minutes

    - by drtanz
    I'm using a few MacBooks and iPads connected to a router via WiFi. The problem is that a few minutes after they connect via WiFi the connection stops working. This happens on all devices. I went into the router settings by connecting via cable and everything seems in order. Connecting a laptop via cable to the router I can use internet as normal, the problem is only with WiFi. What can be the problem here? Here are the connected clients Connected Clients MAC Address Idle(s) RSSI(dBm) IP Addr Host Name Mode Speed (kbps) 14:10:9F:F3:48:D6 1 -36 192.168.0.5 Jeans-Air n 78000 14:99:E2:C6:41:10 1 -36 192.168.0.8 JeanGaleasiPad n 24000 Here's the router event log Mon Dec 30 04:12:30 2013 Notice (6) WiFi Interface [wl0] set to Channel 1 (Side-Band Channel:N/A)... Mon Dec 30 04:12:25 2013 Notice (6) WiFi Interface [wl0] set to Channel 1 (Side-Band Channel:5) -... Mon Dec 30 02:17:56 2013 Notice (6) WiFi Interface [wl0] set to Channel 40 (Side-Band Channel:36)... Mon Dec 30 02:16:04 2013 Notice (6) WiFi Interface [wl0] set to Channel 11 (Side-Band Channel:7) ... Mon Dec 30 01:59:26 2013 Notice (6) WiFi Interface [wl0] set to Channel 6 (Side-Band Channel:N/A)... Mon Dec 30 01:59:22 2013 Notice (6) WiFi Interface [wl0] set to Channel 6 (Side-Band Channel:2) -... Sun Dec 29 23:27:51 2013 Notice (6) WiFi Interface [wl0] set to Channel 1 (Side-Band Channel:N/A)... Sun Dec 29 23:27:49 2013 Notice (6) WiFi Interface [wl0] set to Channel 11 (Side-Band Channel:N/A... Sun Dec 29 14:32:55 2013 Critical (3) Started Unicast Maintenance Ranging - No Response received - ... Sat Dec 28 13:08:19 2013 Error (4) DHCP REBIND WARNING - Field invalid in response ;CM-MAC=1c:3e... Fri Dec 27 18:10:19 2013 Critical (3) Started Unicast Maintenance Ranging - No Response received - ... Fri Dec 27 16:08:55 2013 Error (4) Map Request Retry Timeout;CM-MAC=1c:3e:84:f1:6b:84;CMTS-MAC=0... Thu Dec 26 21:08:53 2013 Notice (6) WiFi Interface [wl0] set to Channel 11 (Side-Band Channel:7) ... Thu Dec 26 20:43:50 2013 Notice (6) WiFi Interface [wl0] set to Channel 11 (Side-Band Channel:N/A... Tue Dec 24 12:45:03 2013 Critical (3) Started Unicast Maintenance Ranging - No Response received - ... Tue Dec 24 04:55:52 2013 Error (4) Map Request Retry Timeout;CM-MAC=1c:3e:84:f1:6b:84;CMTS-MAC=0... Mon Dec 23 12:32:00 2013 Notice (6) TLV-11 - unrecognized OID;CM-MAC=1c:3e:84:f1:6b:84;CMTS-MAC=0... Mon Dec 23 12:32:00 2013 Error (4) Missing BP Configuration Setting TLV Type: 17.9;CM-MAC=1c:3e:... Mon Dec 23 12:32:00 2013 Error (4) Missing BP Configuration Setting TLV Type: 17.8;CM-MAC=1c:3e:... Mon Dec 23 12:32:00 2013 Warning (5) DHCP WARNING - Non-critical field invalid in response ;CM-MAC... Mon Dec 23 18:32:02 2013 Notice (6) Honoring MDD; IP provisioning mode = IPv4 Mon Dec 23 18:31:10 2013 Critical (3) No Ranging Response received - T3 time-out;CM-MAC=1c:3e:84:f1... Mon Dec 23 18:28:57 2013 Critical (3) Received Response to Broadcast Maintenance Request, But no Un... Mon Dec 23 18:28:25 2013 Critical (3) Started Unicast Maintenance Ranging - No Response received - ... Mon Dec 23 12:17:48 2013 Notice (6) TLV-11 - unrecognized OID;CM-MAC=1c:3e:84:f1:6b:84;CMTS-MAC=0... Mon Dec 23 12:17:48 2013 Error (4) Missing BP Configuration Setting TLV Type: 17.9;CM-MAC=1c:3e:... Mon Dec 23 12:17:48 2013 Error (4) Missing BP Configuration Setting TLV Type: 17.8;CM-MAC=1c:3e:... Mon Dec 23 12:17:48 2013 Warning (5) DHCP WARNING - Non-critical field invalid in response ;CM-MAC... Mon Dec 23 18:17:48 2013 Notice (6) Honoring MDD; IP provisioning mode = IPv4 Mon Dec 23 18:16:58 2013 Critical (3) No Ranging Response received - T3 time-out;CM-MAC=1c:3e:84:f1... Mon Dec 23 18:16:15 2013 Critical (3) Received Response to Broadcast Maintenance Request, But no Un... Mon Dec 23 18:15:43 2013 Critical (3) Started Unicast Maintenance Ranging - No Response received - ...

    Read the article

  • PPPTP VPN from Ubuntu cannot connect

    - by Andrea Polci
    I'm trying to configure under Linux (Kubuntu 9.10) a VPN I already use from Windows. I installed the network-manager-pptp package and added the vpn under Network Manager. These are the parameter under "advanced" button: Authentication Methods: PAP, CHAP, MSCHAP, SMCHAP2, EAP (I tried also with MSCHAP and MSCHAP2 only) Use MPPE Encryption: yes Crypto: Any Use stateful encryption: no Compression: Allow BSD compression: yes Allow Deflate compression: yes Allow TCP header compression: yes Send PPP echo packets: no When I try to connnect it doesn't work and this is what I get in the system log: 2010-04-08 13:53:47 pcelena NetworkManager <info> Starting VPN service 'org.freedesktop.NetworkManager.pptp'... 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN service 'org.freedesktop.NetworkManager.pptp' started (org.freedesktop.NetworkManager.pptp), PID 4931 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN service 'org.freedesktop.NetworkManager.pptp' just appeared, activating connections 2010-04-08 13:53:47 pcelena pppd[4932] Plugin /usr/lib/pppd/2.4.5//nm-pptp-pppd-plugin.so loaded. 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN plugin state changed: 3 2010-04-08 13:53:47 pcelena pppd[4932] pppd 2.4.5 started by root, uid 0 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN connection 'MYVPN' (Connect) reply received. 2010-04-08 13:53:47 pcelena NetworkManager SCPlugin-Ifupdown: devices added (path: /sys/devices/virtual/net/ppp0, iface: ppp0) 2010-04-08 13:53:47 pcelena NetworkManager SCPlugin-Ifupdown: device added (path: /sys/devices/virtual/net/ppp0, iface: ppp0): no ifupdown configuration found. 2010-04-08 13:53:47 pcelena pppd[4932] Using interface ppp0 2010-04-08 13:53:47 pcelena pppd[4932] Connect: ppp0 <--> /dev/pts/2 2010-04-08 13:53:47 pcelena pptp[4934] nm-pptp-service-4931 log[main:pptp.c:314]: The synchronous pptp option is NOT activated 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 7 'Outgoing-Call-Request' 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:858]: Received Outgoing Call Reply. 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:897]: Outgoing call established (call ID 1, peer's call ID 14800). 2010-04-08 13:53:48 pcelena pppd[4932] CHAP authentication succeeded 2010-04-08 13:53:48 pcelena pppd[4932] CHAP authentication succeeded 2010-04-08 13:53:48 pcelena pppd[4932] LCP terminated by peer 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:929]: Call disconnect notification received (call id 14800) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:788]: Received Stop Control Connection Request. 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 4 'Stop-Control-Connection-Reply' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[callmgr_main:pptp_callmgr.c:258]: Closing connection (shutdown) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 12 'Call-Clear-Request' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[callmgr_main:pptp_callmgr.c:258]: Closing connection (shutdown) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 12 'Call-Clear-Request' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[call_callback:pptp_callmgr.c:79]: Closing connection (call state) 2010-04-08 13:53:48 pcelena pppd[4932] Modem hangup 2010-04-08 13:53:48 pcelena pppd[4932] Connection terminated. 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin failed: 1 2010-04-08 13:53:48 pcelena NetworkManager SCPlugin-Ifupdown: devices removed (path: /sys/devices/virtual/net/ppp0, iface: ppp0) 2010-04-08 13:53:48 pcelena pppd[4932] Exit. 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin failed: 1 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin state changed: 6 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin state change reason: 0 2010-04-08 13:53:48 pcelena NetworkManager <WARN> connection_state_changed(): Could not process the request because no VPN connection was active. 2010-04-08 13:53:48 pcelena NetworkManager <info> Policy set 'Auto eth0' (eth0) as default for routing and DNS. 2010-04-08 13:54:01 pcelena NetworkManager <debug> [1270727641.001390] ensure_killed(): waiting for vpn service pid 4931 to exit 2010-04-08 13:54:01 pcelena NetworkManager <debug> [1270727641.001479] ensure_killed(): vpn service pid 4931 cleaned up Does anyone has suggestion on what can be the problem and how to make it work?

    Read the article

  • OpenSwan IPSec phase #2 complications

    - by XXL
    Phase #1 (IKE) succeeds without any problems (verified at the target host). Phase #2 (IPSec), however, is erroneous at some point (apparently due to misconfiguration on localhost). This should be an IPSec-only connection. I am using OpenSwan on Debian. The error log reads the following (the actual IP-addr. of the remote endpoint has been modified): pluto[30868]: "x" #2: initiating Quick Mode PSK+ENCRYPT+PFS+UP+IKEv2ALLOW+SAREFTRACK {using isakmp#1 msgid:5ece82ee proposal=AES(12)_256-SHA1(2)_160 pfsgroup=OAKLEY_GROUP_DH22} pluto[30868]: "x" #1: ignoring informational payload, type NO_PROPOSAL_CHOSEN msgid=00000000 pluto[30868]: "x" #1: received and ignored informational message pluto[30868]: "x" #1: the peer proposed: 0.0.0.0/0:0/0 - 0.0.0.0/0:0/0 pluto[30868]: "x" #3: responding to Quick Mode proposal {msgid:a4f5a81c} pluto[30868]: "x" #3: us: 192.168.1.76<192.168.1.76[+S=C] pluto[30868]: "x" #3: them: 222.222.222.222<222.222.222.222[+S=C]===10.196.0.0/17 pluto[30868]: "x" #3: transition from state STATE_QUICK_R0 to state STATE_QUICK_R1 pluto[30868]: "x" #3: STATE_QUICK_R1: sent QR1, inbound IPsec SA installed, expecting QI2 pluto[30868]: "x" #1: ignoring informational payload, type NO_PROPOSAL_CHOSEN msgid=00000000 pluto[30868]: "x" #1: received and ignored informational message pluto[30868]: "x" #3: next payload type of ISAKMP Hash Payload has an unknown value: 97 X pluto[30868]: "x" #3: malformed payload in packet pluto[30868]: | payload malformed after IV I am behind NAT and this is all coming from wlan2. Here are the details: default via 192.168.1.254 dev wlan2 proto static 169.254.0.0/16 dev wlan2 scope link metric 1000 192.168.1.0/24 dev wlan2 proto kernel scope link src 192.168.1.76 metric 2 Output of ipsec verify: Checking your system to see if IPsec got installed and started correctly: Version check and ipsec on-path [OK] Linux Openswan U2.6.37/K3.2.0-24-generic (netkey) Checking for IPsec support in kernel [OK] SAref kernel support [N/A] NETKEY: Testing XFRM related proc values [OK] [OK] [OK] Checking that pluto is running [OK] Pluto listening for IKE on udp 500 [OK] Pluto listening for NAT-T on udp 4500 [OK] Two or more interfaces found, checking IP forwarding [OK] Checking NAT and MASQUERADEing [OK] Checking for 'ip' command [OK] Checking /bin/sh is not /bin/dash [WARNING] Checking for 'iptables' command [OK] Opportunistic Encryption Support [DISABLED] This is what happens when I run ipsec auto --up x: 104 "x" #1: STATE_MAIN_I1: initiate 003 "x" #1: received Vendor ID payload [RFC 3947] method set to=109 106 "x" #1: STATE_MAIN_I2: sent MI2, expecting MR2 003 "x" #1: received Vendor ID payload [Cisco-Unity] 003 "x" #1: received Vendor ID payload [Dead Peer Detection] 003 "x" #1: ignoring unknown Vendor ID payload [502099ff84bd4373039074cf56649aad] 003 "x" #1: received Vendor ID payload [XAUTH] 003 "x" #1: NAT-Traversal: Result using RFC 3947 (NAT-Traversal): i am NATed 108 "x" #1: STATE_MAIN_I3: sent MI3, expecting MR3 004 "x" #1: STATE_MAIN_I4: ISAKMP SA established {auth=OAKLEY_PRESHARED_KEY cipher=aes_128 prf=oakley_sha group=modp1024} 117 "x" #2: STATE_QUICK_I1: initiate 010 "x" #2: STATE_QUICK_I1: retransmission; will wait 20s for response 010 "x" #2: STATE_QUICK_I1: retransmission; will wait 40s for response 031 "x" #2: max number of retransmissions (2) reached STATE_QUICK_I1. No acceptable response to our first Quick Mode message: perhaps peer likes no proposal 000 "x" #2: starting keying attempt 2 of at most 3, but releasing whack I have enabled NAT traversal in ipsec.conf accordingly. Here are the settings relative to the connection in question: version 2.0 config setup plutoopts="--perpeerlog" plutoopts="--interface=wlan2" dumpdir=/var/run/pluto/ nat_traversal=yes virtual_private=%v4:10.0.0.0/8,%v4:192.168.0.0/16,%v4:172.16.0.0/12 oe=off protostack=netkey conn x authby=secret pfs=yes auto=add phase2alg=aes256-sha1;dh22 keyingtries=3 ikelifetime=8h type=transport left=192.168.1.76 leftsubnet=192.168.1.0/24 leftprotoport=0/0 right=222.222.222.222 rightsubnet=10.196.0.0/17 rightprotoport=0/0 Here are the specs provided by the other end that must be met for Phase #2: encryption algorithm: AES (128 or 256 bit) hash algorithm: SHA local ident1 (addr/mask/prot/port): (10.196.0.0/255.255.128.0/0/0) local ident2 (addr/mask/prot/port): (10.241.0.0/255.255.0.0/0/0) remote ident (addr/mask/prot/port): (x.x.x.x/x.x.x.x/0/0) (internal network or localhost) Security association lifetime: 4608000 kilobytes/3600 seconds PFS: DH group2 So, finally, what might be the cause of the issue that I am experiencing? Thank you.

    Read the article

  • How to deploy custom MBean to Tomcat?

    - by Christian
    Hi, I'm trying to deploy a custom mbean to a tomcat. This mbean is not part of a webapp. It should be instantiated when tomcat starts. My problem is, I can't find any complete documentation about how to deploy such a mbean. I'm getting different exceptions, depending on my configuration. Has anyone hints, a complete documentation or has implemented a mbean by himself and can post an example? I configured tomcat to read a configuration from his conf directory: <Engine name="Catalina" defaultHost="localhost" mbeansFile="${catalina.base}/conf/mbeans-descriptors.xml"> The content is as follows: <?xml version="1.0"?> <!-- <!DOCTYPE mbeans-descriptors PUBLIC "-//Apache Software Foundation//DTD Model MBeans Configuration File" "http://jakarta.apache.org/commons/dtds/mbeans-descriptors.dtd"> --> <!-- Descriptions of JMX MBeans --> <mbeans-descriptors> <mbean name="Performance" description="Caculate JVM throughput" type="Performance"> <attribute name="throughput" description="calculated throughput (ratio between gc times and uptime of JVM)" type="double" writeable="false"/> </mbean> </mbeans-descriptors> When name in the xml file and class name match, I get this excption: SEVERE: Error creating mbean Performance javax.management.MalformedObjectNameException: Key properties cannot be empty at javax.management.ObjectName.construct(ObjectName.java:467) at javax.management.ObjectName.<init>(ObjectName.java:1403) at org.apache.tomcat.util.modeler.modules.MbeansSource.execute(MbeansSource.java:202) at org.apache.tomcat.util.modeler.modules.MbeansSource.load(MbeansSource.java:137) at org.apache.catalina.core.StandardEngine.readEngineMbeans(StandardEngine.java:517) at org.apache.catalina.core.StandardEngine.init(StandardEngine.java:321) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:411) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.commons.daemon.support.DaemonLoader.start(DaemonLoader.java:177) When changing the name attribute in the xml file to test.example:type=Performance, I get this exception: SEVERE: Error creating mbean test.example:type=Performance javax.management.NotCompliantMBeanException: MBean class must have public constructor at com.sun.jmx.mbeanserver.Introspector.testCreation(Introspector.java:127) at com.sun.jmx.interceptor.DefaultMBeanServerInterceptor.createMBean(DefaultMBeanServerInterceptor.java:284) at com.sun.jmx.interceptor.DefaultMBeanServerInterceptor.createMBean(DefaultMBeanServerInterceptor.java:199) at com.sun.jmx.mbeanserver.JmxMBeanServer.createMBean(JmxMBeanServer.java:393) at org.apache.tomcat.util.modeler.modules.MbeansSource.execute(MbeansSource.java:207) at org.apache.tomcat.util.modeler.modules.MbeansSource.load(MbeansSource.java:137) at org.apache.catalina.core.StandardEngine.readEngineMbeans(StandardEngine.java:517) at org.apache.catalina.core.StandardEngine.init(StandardEngine.java:321) at org.apache.catalina.core.StandardEngine.start(StandardEngine.java:411) at org.apache.catalina.core.StandardService.start(StandardService.java:519) at org.apache.catalina.core.StandardServer.start(StandardServer.java:710) at org.apache.catalina.startup.Catalina.start(Catalina.java:581) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.catalina.startup.Bootstrap.start(Bootstrap.java:289) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at org.apache.commons.daemon.support.DaemonLoader.start(DaemonLoader.java:177) The documentation from apache is not really helpful, as it just explains a small part. I'm aware of this question but it doesn't help me. The answer I gave worked just for a short time, after that I got some other exceptions. For additional info, the java interface public interface PerformanceMBean { public double getThroughput(); } and implementing class /* some import statements */ public class Performance implements PerformanceMBean { public double getThroughput() { ... } }

    Read the article

  • CakePhp on IIS: How can I Edit URL Rewrite module for SSL Redirects

    - by AdrianB
    I've not dealt much with IIS rewrites, but I was able to import (and edit) the rewrites found throughout the cake structure (.htaccess files). I'll explain my configuration a little, then get to the meat of the problem. So my Cake php framework is working well and made possible by the url rewrite module 2.0 which I have successfully installed and configured for the site. The way cake is set up, the webroot folder (for cake, not iis) is set as the default folder for the site and exists inside the following hierarchy inetpub -wwwroot --cakePhp root ---application ----models ----views ----controllers ----WEBROOT // *** HERE *** ---cake core --SomeOtherSite Folder For this implementation, the url rewrite module uses the following rules (from the web.config file) ... <rewrite> <rules> <rule name="Imported Rule 1" stopProcessing="true"> <match url="^(.*)$" ignoreCase="false" /> <conditions logicalGrouping="MatchAll"> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> </conditions> <action type="Rewrite" url="index.php?url={R:1}" appendQueryString="true" /> </rule> <rule name="Imported Rule 2" stopProcessing="true"> <match url="^$" ignoreCase="false" /> <action type="Rewrite" url="/" /> </rule> <rule name="Imported Rule 3" stopProcessing="true"> <match url="(.*)" ignoreCase="false" /> <action type="Rewrite" url="/{R:1}" /> </rule> <rule name="Imported Rule 4" stopProcessing="true"> <match url="^(.*)$" ignoreCase="false" /> <conditions logicalGrouping="MatchAll"> <add input="{REQUEST_FILENAME}" matchType="IsDirectory" negate="true" /> <add input="{REQUEST_FILENAME}" matchType="IsFile" negate="true" /> </conditions> <action type="Rewrite" url="index.php?url={R:1}" appendQueryString="true" /> </rule> </rules> </rewrite> I've Installed my SSL certificate and created a site binding so that if i use the https:// protocol, everything is working fine within the site. I fear that attempts I have made at creating a rewrite are too far off base to understand results. The rules need to switch protocol without affecting the current set of rules which pass along url components to index.php (which is cake's entry point). My goal is this- Create a couple of rewrite rules that will [#1] redirect all user pages (in this general form http://domain.com/users/page/param/param/?querystring=value ) to use SSL and then [#2} direct all other https requests to use http (is this is even necessary?). [e.g. http://domain.com/users/login , http://domain.com/users/profile/uid:12345 , http://domain.com/users/payments?firsttime=true] ] to all use SSL [e.g. https://domain.com/users/login , https://domain.com/users/profile/uid:12345 , https://domain.com/users/payments?firsttime=true] ] Any help would be greatly appreciated.

    Read the article

  • Xen kernel can't see 2 disks of 6 of 1TB, does it have a limitation?

    - by PartySoft
    Linux gentoo-xen 2.6.18-xen-r12 #3 SMP Tue Oct 5 09:28:53 PDT 2010 x86_64 Intel(R) Xeon(R) CPU E5506 @ 2.13GHz GenuineIntel GNU/Linux I have 6 disks of 1 TB and i can't see all of them only 4, can anyone give me an ideea what can i do ? Filesystem Size Used Avail Use% Mounted on rootfs 886G 4.4G 836G 1% / /dev/sda3 886G 4.4G 836G 1% / rc-svcdir 1.0M 44K 980K 5% /lib64/rc/init.d shm 7.9G 0 7.9G 0% /dev/shm /dev/sdb1 917G 200M 871G 1% /home2 /dev/sdc1 917G 200M 871G 1% /home3 /dev/sdd1 917G 200M 871G 1% /home4 The hardware is Dual xeon E5506 processors on a supermicro X8DTL mobo 4.346585] ata3.00: ATA-8, max UDMA/133, 1953525168 sectors: LBA48 NCQ (depth 0/32) [ 4.346588] ata3.00: ata3: dev 0 multi count 16 [ 4.352861] ata3.00: configured for UDMA/133 [ 4.352867] scsi3 : ata_piix [ 4.352875] PM: Adding info for No Bus:host3 [ 4.510584] ata4.00: ATA-8, max UDMA/133, 1953525168 sectors: LBA48 NCQ (depth 0/32) [ 4.510587] ata4.00: ata4: dev 0 multi count 16 [ 4.516848] ata4.00: configured for UDMA/133 [ 4.516861] PM: Adding info for No Bus:target2:0:0 [ 4.516905] Vendor: ATA Model: SAMSUNG HD103SJ Rev: 1AJ1 [ 4.516910] Type: Direct-Access ANSI SCSI revision: 05 [ 4.516920] PM: Adding info for scsi:2:0:0:0 [ 4.517452] SCSI device sde: 1953525168 512-byte hdwr sectors (1000205 MB) [ 4.517460] sde: Write Protect is off [ 4.517461] sde: Mode Sense: 00 3a 00 00 [ 4.517478] SCSI device sde: drive cache: write back [ 4.517514] SCSI device sde: 1953525168 512-byte hdwr sectors (1000205 MB) [ 4.517521] sde: Write Protect is off [ 4.517522] sde: Mode Sense: 00 3a 00 00 [ 4.517532] SCSI device sde: drive cache: write back [ 4.517534] sde: sde1 [ 4.524551] sd 2:0:0:0: Attached scsi disk sde [ 4.524855] sd 2:0:0:0: Attached scsi generic sg4 type 0 [ 4.524874] PM: Adding info for No Bus:target3:0:0 [ 4.524928] Vendor: ATA Model: SAMSUNG HD103SJ Rev: 1AJ1 [ 4.524933] Type: Direct-Access ANSI SCSI revision: 05 [ 4.524946] PM: Adding info for scsi:3:0:0:0 [ 4.525216] SCSI device sdf: 1953525168 512-byte hdwr sectors (1000205 MB) [ 4.525227] sdf: Write Protect is off [ 4.525228] sdf: Mode Sense: 00 3a 00 00 [ 4.525242] SCSI device sdf: drive cache: write back [ 4.525280] SCSI device sdf: 1953525168 512-byte hdwr sectors (1000205 MB) [ 4.525286] sdf: Write Protect is off [ 4.525289] sdf: Mode Sense: 00 3a 00 00 [ 4.525301] SCSI device sdf: drive cache: write back [ 4.525302] sdf: sdf1 [ 4.532691] sd 3:0:0:0: Attached scsi disk sdf [ 4.533010] sd 3:0:0:0: Attached scsi generic sg5 type 0 [ 4.977669] scsi: <fdomain> Detection failed (no card) [ 5.030479] GDT-HA: Storage RAID Controller Driver. Version: 3.05 [ 5.030635] GDT-HA: Found 0 PCI Storage RAID Controllers [ 5.372350] Fusion MPT base driver 3.04.01 [ 5.372358] Copyright (c) 1999-2005 LSI Logic Corporation [ 5.579176] Fusion MPT SPI Host driver 3.04.01 [ 5.881777] ieee1394: Initialized config rom entry `ip1394' [ 6.166745] ieee1394: sbp2: Driver forced to serialize I/O (serialize_io=1) [ 6.166748] ieee1394: sbp2: Try serialize_io=0 for better performance [ 6.428866] md: md driver 0.90.3 MAX_MD_DEVS=256, MD_SB_DISKS=27 [ 6.428872] md: bitmap version 4.39 [ 6.431518] md: raid0 personality registered for level 0 [ 6.495979] md: raid1 personality registered for level 1 [ 6.570270] raid5: automatically using best checksumming function: generic_sse [ 6.575523] generic_sse: 6608.000 MB/sec [ 6.575526] raid5: using function: generic_sse (6608.000 MB/sec) [ 6.596226] raid6: int64x1 1835 MB/s [ 6.613231] raid6: int64x2 1773 MB/s [ 6.630256] raid6: int64x4 1675 MB/s [ 6.647296] raid6: int64x8 1027 MB/s [ 6.664267] raid6: sse2x1 3578 MB/s [ 6.681268] raid6: sse2x2 4207 MB/s [ 6.698280] raid6: sse2x4 4625 MB/s [ 6.698281] raid6: using algorithm sse2x4 (4625 MB/s) [ 6.698285] md: raid6 personality registered for level 6 [ 6.698286] md: raid5 personality registered for level 5 [ 6.698288] md: raid4 personality registered for level 4 [ 6.781090] md: raid10 personality registered for level 10 [ 7.007043] Intel(R) PRO/1000 Network Driver - version 7.1.9-k4 [ 7.007046] Copyright (c) 1999-2006 Intel Corporation. [ 9.229465] kjournald starting. Commit interval 5 seconds [ 9.229476] EXT3-fs: mounted filesystem with ordered data mode.

    Read the article

  • Nginx error page with JSON response

    - by Waseem
    I'm trying to serve a maintenance page to clients making request to my application when it is under maintenance. Following is my nginx configuration for that purpose. server { recursive_error_pages on; listen 80; ... if (-f $document_root/maintenance.html) { return 503; } error_page 404 /404.html; error_page 500 502 504 /500.html; error_page 503 @503; location = /404.html { root $document_root; } location = /500.html { root $document_root; } location @503 { error_page 405 =/maintenance.html; if (-f $request_filename) { break; } rewrite ^(.*)$ /maintenance.html break; } } Lets say I have enabled maintenance of my site by creating a $document_root/maintenance.html. This file, correctly, is served when a user makes a request with with Accept header of text/html. $ curl http://server.com/ -i -v -X GET -H "Accept: text/html" * Adding handle: conn: 0xf89420 * Adding handle: send: 0 * Adding handle: recv: 0 * Curl_addHandleToPipeline: length: 1 * - Conn 0 (0xf89420) send_pipe: 1, recv_pipe: 0 * About to connect() to server.com port 80 (#0) * Trying xxx.xxx.xxx.xxx... * Connected to server.com (xxx.xxx.xxx.xxx) port 80 (#0) > GET / HTTP/1.1 > User-Agent: curl/7.33.0 > Host: server.com > Accept: text/html > < HTTP/1.1 503 Service Temporarily Unavailable HTTP/1.1 503 Service Temporarily Unavailable * Server nginx/1.1.19 is not blacklisted < Server: nginx/1.1.19 Server: nginx/1.1.19 < Date: Thu, 14 Nov 2013 11:16:16 GMT Date: Thu, 14 Nov 2013 11:16:16 GMT < Content-Type: text/html Content-Type: text/html < Content-Length: 27 Content-Length: 27 < Connection: keep-alive Connection: keep-alive < This is under maintenance. * Connection #0 to host server.com left intact Now some clients set Accept header to application/json. How do I send them a JSON response instead of maintenance.html? Following is the response that I get when setting Accept to application/json. $ curl http://server.com/ -i -v -X GET -H "Accept: application/json" * Adding handle: conn: 0x190c430 * Adding handle: send: 0 * Adding handle: recv: 0 * Curl_addHandleToPipeline: length: 1 * - Conn 0 (0x190c430) send_pipe: 1, recv_pipe: 0 * About to connect() to server.com port 80 (#0) * Trying xxx.xxx.xxx.xxx... * Connected to server.com (xxx.xxx.xxx.xxx) port 80 (#0) > GET / HTTP/1.1 > User-Agent: curl/7.33.0 > Host: server.com > Accept: application/json > < HTTP/1.1 503 Service Temporarily Unavailable HTTP/1.1 503 Service Temporarily Unavailable * Server nginx/1.1.19 is not blacklisted < Server: nginx/1.1.19 Server: nginx/1.1.19 < Date: Thu, 14 Nov 2013 11:15:50 GMT Date: Thu, 14 Nov 2013 11:15:50 GMT < Content-Type: text/html Content-Type: text/html < Content-Length: 27 Content-Length: 27 < Connection: keep-alive Connection: keep-alive < This is under maintenance. * Connection #0 to host server.com left intact

    Read the article

  • Windows 7 BSOD - ntoskrnl?

    - by Ken Mason
    2 new HP Pavilion notebooks with 7 Home Premium pre-loaded with Norton. My first act was to use the Norton Removal Tool and load ZoneAlarm free and AVG Free. Frequent random BSOD's ever since...I found my way into Debug and have had various reports regarding ntoskrnl, depending on the status of symbols. It's been many years since I played with (DOS 3.x) debug, so this has been a considerable fumble. Excerpts follow and any insights would be greatly appreciated, as I am not a developer: ADDITIONAL_DEBUG_TEXT: Use '!findthebuild' command to search for the target build information. If the build information is available, run '!findthebuild -s ; .reload' to set symbol path and load symbols. MODULE_NAME: nt FAULTING_MODULE: fffff8000305d000 nt DEBUG_FLR_IMAGE_TIMESTAMP: 4b88cfeb BUGCHECK_STR: 0x7f_8 CUSTOMER_CRASH_COUNT: 1 DEFAULT_BUCKET_ID: VISTA_DRIVER_FAULT CURRENT_IRQL: 0 LAST_CONTROL_TRANSFER: from fffff800030ccb69 to fffff800030cd600 STACK_TEXT: fffff80004d6fd28 fffff800030ccb69 : 000000000000007f 0000000000000008 0000000080050033 00000000000006f8 : nt+0x70600 fffff80004d6fd30 000000000000007f : 0000000000000008 0000000080050033 00000000000006f8 fffff80003095e58 : nt+0x6fb69 fffff80004d6fd38 0000000000000008 : 0000000080050033 00000000000006f8 fffff80003095e58 0000000000000000 : 0x7f fffff80004d6fd40 0000000080050033 : 00000000000006f8 fffff80003095e58 0000000000000000 0000000000000000 : 0x8 fffff80004d6fd48 00000000000006f8 : fffff80003095e58 0000000000000000 0000000000000000 0000000000000000 : 0x80050033 fffff80004d6fd50 fffff80003095e58 : 0000000000000000 0000000000000000 0000000000000000 0000000000000000 : 0x6f8 fffff80004d6fd58 0000000000000000 : 0000000000000000 0000000000000000 0000000000000000 0000000000000000 : nt+0x38e58 STACK_COMMAND: kb FOLLOWUP_IP: nt+70600 fffff800`030cd600 48894c2408 mov qword ptr [rsp+8],rcx SYMBOL_STACK_INDEX: 0 SYMBOL_NAME: nt+70600 FOLLOWUP_NAME: MachineOwner IMAGE_NAME: ntoskrnl.exe BUCKET_ID: WRONG_SYMBOLS Followup: MachineOwner ...................................................................... 0: kd !lmi nt Loaded Module Info: [nt] Module: ntkrnlmp Base Address: fffff8000305d000 Image Name: ntkrnlmp.exe Machine Type: 34404 (X64) Time Stamp: 4b88cfeb Sat Feb 27 00:55:23 2010 Size: 5dc000 CheckSum: 545094 Characteristics: 22 perf Debug Data Dirs: Type Size VA Pointer CODEVIEW 25, 19c65c, 19bc5c RSDS - GUID: {7E9A3CAB-6268-45DE-8E10-816E3080A3B7} Age: 2, Pdb: ntkrnlmp.pdb CLSID 4, 19c658, 19bc58 [Data not mapped] Image Type: FILE - Image read successfully from debugger. ntkrnlmp.exe Symbol Type: PDB - Symbols loaded successfully from symbol server. d:\debugsymbols\ntkrnlmp.pdb\7E9A3CAB626845DE8E10816E3080A3B72\ntkrnlmp.pdb Load Report: public symbols , not source indexed d:\debugsymbols\ntkrnlmp.pdb\7E9A3CAB626845DE8E10816E3080A3B72\ntkrnlmp.pdb 0: kd !analyze -v * Bugcheck Analysis * * UNEXPECTED_KERNEL_MODE_TRAP (7f) This means a trap occurred in kernel mode, and it's a trap of a kind that the kernel isn't allowed to have/catch (bound trap) or that is always instant death (double fault). The first number in the bugcheck params is the number of the trap (8 = double fault, etc) Consult an Intel x86 family manual to learn more about what these traps are. Here is a portion of those codes: If kv shows a taskGate use .tss on the part before the colon, then kv. Else if kv shows a trapframe use .trap on that value Else .trap on the appropriate frame will show where the trap was taken (on x86, this will be the ebp that goes with the procedure KiTrap) Endif kb will then show the corrected stack. Arguments: Arg1: 0000000000000008, EXCEPTION_DOUBLE_FAULT Arg2: 0000000080050033 Arg3: 00000000000006f8 Arg4: fffff80003095e58 Debugging Details: BUGCHECK_STR: 0x7f_8 CUSTOMER_CRASH_COUNT: 1 DEFAULT_BUCKET_ID: VISTA_DRIVER_FAULT PROCESS_NAME: System CURRENT_IRQL: 2 LAST_CONTROL_TRANSFER: from fffff800030ccb69 to fffff800030cd600 STACK_TEXT: fffff80004d6fd28 fffff800030ccb69 : 000000000000007f 0000000000000008 0000000080050033 00000000000006f8 : nt!KeBugCheckEx fffff80004d6fd30 fffff800030cb032 : 0000000000000000 0000000000000000 0000000000000000 0000000000000000 : nt!KiBugCheckDispatch+0x69 fffff80004d6fe70 fffff80003095e58 : 0000000000000000 0000000000000000 0000000000000000 0000000000000000 : nt!KiDoubleFaultAbort+0xb2 fffff880089efc60 0000000000000000 : 0000000000000000 0000000000000000 0000000000000000 0000000000000000 : nt!SeAccessCheckFromState+0x58 STACK_COMMAND: kb FOLLOWUP_IP: nt!KiDoubleFaultAbort+b2 fffff800`030cb032 90 nop SYMBOL_STACK_INDEX: 2 SYMBOL_NAME: nt!KiDoubleFaultAbort+b2 FOLLOWUP_NAME: MachineOwner MODULE_NAME: nt IMAGE_NAME: ntkrnlmp.exe DEBUG_FLR_IMAGE_TIMESTAMP: 4b88cfeb FAILURE_BUCKET_ID: X64_0x7f_8_nt!KiDoubleFaultAbort+b2 BUCKET_ID: X64_0x7f_8_nt!KiDoubleFaultAbort+b2 Followup: MachineOwner I tried running Rootkit Revealer but I don't think it works on x64 systems. Similarly Blacklight seems to have aged off. I'm running Sophos Anti-Rootkit now. So far so good...

    Read the article

  • Upgraded Ubuntu, all drives in one zpool marked unavailable

    - by Matt Sieker
    I just upgraded Ubuntu 14.04, and I had two ZFS pools on the server. There was some minor issue with me fighting with the ZFS driver and the kernel version, but that's worked out now. One pool came online, and mounted fine. The other didn't. The main difference between the tool is one was just a pool of disks (video/music storage), and the other was a raidz set (documents, etc) I've already attempted exporting and re-importing the pool, to no avail, attempting to import gets me this: root@kyou:/home/matt# zpool import -fFX -d /dev/disk/by-id/ pool: storage id: 15855792916570596778 state: UNAVAIL status: One or more devices contains corrupted data. action: The pool cannot be imported due to damaged devices or data. see: http://zfsonlinux.org/msg/ZFS-8000-5E config: storage UNAVAIL insufficient replicas raidz1-0 UNAVAIL insufficient replicas ata-SAMSUNG_HD103SJ_S246J90B134910 UNAVAIL ata-WDC_WD10EARS-00Y5B1_WD-WMAV51422523 UNAVAIL ata-WDC_WD10EARS-00Y5B1_WD-WMAV51535969 UNAVAIL The symlinks for those in /dev/disk/by-id also exist: root@kyou:/home/matt# ls -l /dev/disk/by-id/ata-SAMSUNG_HD103SJ_S246J90B134910* /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51* lrwxrwxrwx 1 root root 9 May 27 19:31 /dev/disk/by-id/ata-SAMSUNG_HD103SJ_S246J90B134910 -> ../../sdb lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-SAMSUNG_HD103SJ_S246J90B134910-part1 -> ../../sdb1 lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-SAMSUNG_HD103SJ_S246J90B134910-part9 -> ../../sdb9 lrwxrwxrwx 1 root root 9 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51422523 -> ../../sdd lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51422523-part1 -> ../../sdd1 lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51422523-part9 -> ../../sdd9 lrwxrwxrwx 1 root root 9 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51535969 -> ../../sde lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51535969-part1 -> ../../sde1 lrwxrwxrwx 1 root root 10 May 27 19:15 /dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51535969-part9 -> ../../sde9 Inspecting the various /dev/sd* devices listed, they appear to be the correct ones (The 3 1TB drives that were in a raidz array). I've run zdb -l on each drive, dumping it to a file, and running a diff. The only difference on the 3 are the guid fields (Which I assume is expected). All 3 labels on each one are basically identical, and are as follows: version: 5000 name: 'storage' state: 0 txg: 4 pool_guid: 15855792916570596778 hostname: 'kyou' top_guid: 1683909657511667860 guid: 8815283814047599968 vdev_children: 1 vdev_tree: type: 'raidz' id: 0 guid: 1683909657511667860 nparity: 1 metaslab_array: 33 metaslab_shift: 34 ashift: 9 asize: 3000569954304 is_log: 0 create_txg: 4 children[0]: type: 'disk' id: 0 guid: 8815283814047599968 path: '/dev/disk/by-id/ata-SAMSUNG_HD103SJ_S246J90B134910-part1' whole_disk: 1 create_txg: 4 children[1]: type: 'disk' id: 1 guid: 18036424618735999728 path: '/dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51422523-part1' whole_disk: 1 create_txg: 4 children[2]: type: 'disk' id: 2 guid: 10307555127976192266 path: '/dev/disk/by-id/ata-WDC_WD10EARS-00Y5B1_WD-WMAV51535969-part1' whole_disk: 1 create_txg: 4 features_for_read: Stupidly, I do not have a recent backup of this pool. However, the pool was fine before reboot, and Linux sees the disks fine (I have smartctl running now to double check) So, in summary: I upgraded Ubuntu, and lost access to one of my two zpools. The difference between the pools is the one that came up was JBOD, the other was zraid. All drives in the unmountable zpool are marked UNAVAIL, with no notes for corrupted data The pools were both created with disks referenced from /dev/disk/by-id/. Symlinks from /dev/disk/by-id to the various /dev/sd devices seems to be correct zdb can read the labels from the drives. Pool has already been attempted to be exported/imported, and isn't able to import again. Is there some sort of black magic I can invoke via zpool/zfs to bring these disks back into a reasonable array? Can I run zpool create zraid ... without losing my data? Is my data gone anyhow?

    Read the article

  • PPTP VPN from Ubuntu cannot connect

    - by Andrea Polci
    I'm trying to configure under Linux (Kubuntu 9.10) a VPN I already use from Windows. I installed the network-manager-pptp package and added the VPN under Network Manager. These are the parameters under "advanced" button: Authentication Methods: PAP, CHAP, MSCHAP, MSCHAP2, EAP (I also tried "MSCHAP, MSCHAP2") Use MPPE Encryption: yes Crypto: Any Use stateful encryption: no Allow BSD compression: yes Allow Deflate compression: yes Allow TCP header compression: yes Send PPP echo packets: no When I try to connnect it doesn't work and this is what I get in the system log: 2010-04-08 13:53:47 pcelena NetworkManager <info> Starting VPN service 'org.freedesktop.NetworkManager.pptp'... 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN service 'org.freedesktop.NetworkManager.pptp' started (org.freedesktop.NetworkManager.pptp), PID 4931 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN service 'org.freedesktop.NetworkManager.pptp' just appeared, activating connections 2010-04-08 13:53:47 pcelena pppd[4932] Plugin /usr/lib/pppd/2.4.5//nm-pptp-pppd-plugin.so loaded. 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN plugin state changed: 3 2010-04-08 13:53:47 pcelena pppd[4932] pppd 2.4.5 started by root, uid 0 2010-04-08 13:53:47 pcelena NetworkManager <info> VPN connection 'MYVPN' (Connect) reply received. 2010-04-08 13:53:47 pcelena NetworkManager SCPlugin-Ifupdown: devices added (path: /sys/devices/virtual/net/ppp0, iface: ppp0) 2010-04-08 13:53:47 pcelena NetworkManager SCPlugin-Ifupdown: device added (path: /sys/devices/virtual/net/ppp0, iface: ppp0): no ifupdown configuration found. 2010-04-08 13:53:47 pcelena pppd[4932] Using interface ppp0 2010-04-08 13:53:47 pcelena pppd[4932] Connect: ppp0 <--> /dev/pts/2 2010-04-08 13:53:47 pcelena pptp[4934] nm-pptp-service-4931 log[main:pptp.c:314]: The synchronous pptp option is NOT activated 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 7 'Outgoing-Call-Request' 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:858]: Received Outgoing Call Reply. 2010-04-08 13:53:47 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:897]: Outgoing call established (call ID 1, peer's call ID 14800). 2010-04-08 13:53:48 pcelena pppd[4932] CHAP authentication succeeded 2010-04-08 13:53:48 pcelena pppd[4932] CHAP authentication succeeded 2010-04-08 13:53:48 pcelena pppd[4932] LCP terminated by peer 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:929]: Call disconnect notification received (call id 14800) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_disp:pptp_ctrl.c:788]: Received Stop Control Connection Request. 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 4 'Stop-Control-Connection-Reply' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[callmgr_main:pptp_callmgr.c:258]: Closing connection (shutdown) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 12 'Call-Clear-Request' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[callmgr_main:pptp_callmgr.c:258]: Closing connection (shutdown) 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[ctrlp_rep:pptp_ctrl.c:251]: Sent control packet type is 12 'Call-Clear-Request' 2010-04-08 13:53:48 pcelena pptp[4927] nm-pptp-service-4918 log[call_callback:pptp_callmgr.c:79]: Closing connection (call state) 2010-04-08 13:53:48 pcelena pppd[4932] Modem hangup 2010-04-08 13:53:48 pcelena pppd[4932] Connection terminated. 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin failed: 1 2010-04-08 13:53:48 pcelena NetworkManager SCPlugin-Ifupdown: devices removed (path: /sys/devices/virtual/net/ppp0, iface: ppp0) 2010-04-08 13:53:48 pcelena pppd[4932] Exit. 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin failed: 1 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin state changed: 6 2010-04-08 13:53:48 pcelena NetworkManager <info> VPN plugin state change reason: 0 2010-04-08 13:53:48 pcelena NetworkManager <WARN> connection_state_changed(): Could not process the request because no VPN connection was active. 2010-04-08 13:53:48 pcelena NetworkManager <info> Policy set 'Auto eth0' (eth0) as default for routing and DNS. 2010-04-08 13:54:01 pcelena NetworkManager <debug> [1270727641.001390] ensure_killed(): waiting for vpn service pid 4931 to exit 2010-04-08 13:54:01 pcelena NetworkManager <debug> [1270727641.001479] ensure_killed(): vpn service pid 4931 cleaned up The error that sticks out here is "pppd[4932] LCP terminated by peer". Does anyone has suggestion on what can be the problem and how to make it work?

    Read the article

  • Incorrect gzipping of http requests, can't find who's doing it

    - by Ned Batchelder
    We're seeing some very strange mangling of HTTP responses, and we can't figure out what is doing it. We have an app server handling JSON requests. Occasionally, the response is returned gzipped, but with incorrect headers that prevent the browser from interpreting it correctly. The problem is intermittent, and changes behavior over time. Yesterday morning it seemed to fail 50% of the time, and in fact, seemed tied to one of our two load-balanced servers. Later in the afternoon, it was failing only 20 times out of 1000, and didn't correlate with an app server. The two app servers are running Apache 2.2 with mod_wsgi and a Django app stack. They have identical Apache configs and source trees, and even identical packages installed on Red Hat. There's a hardware load balancer in front, I don't know the make or model. Akamai is also part of the food chain, though we removed Akamai and still had the problem. Here's a good request and response: * Connected to example.com (97.7.79.129) port 80 (#0) > POST /claim/ HTTP/1.1 > User-Agent: curl/7.19.7 (x86_64-pc-linux-gnu) libcurl/7.19.7 OpenSSL/0.9.8k zlib/1.2.3.3 libidn/1.15 > Host: example.com > Accept: */* > Referer: http://example.com/apps/ > Accept-Encoding: gzip,deflate > Content-Length: 29 > Content-Type: application/x-www-form-urlencoded > } [data not shown] < HTTP/1.1 200 OK < Server: Apache/2 < Content-Language: en-us < Content-Encoding: identity < Content-Length: 47 < Content-Type: application/x-javascript < Connection: keep-alive < Vary: Accept-Encoding < { [data not shown] * Connection #0 to host example.com left intact * Closing connection #0 {"msg": "", "status": "OK", "printer_name": ""} And here's a bad one: * Connected to example.com (97.7.79.129) port 80 (#0) > POST /claim/ HTTP/1.1 > User-Agent: curl/7.19.7 (x86_64-pc-linux-gnu) libcurl/7.19.7 OpenSSL/0.9.8k zlib/1.2.3.3 libidn/1.15 > Host: example.com > Accept: */* > Referer: http://example.com/apps/ > Accept-Encoding: gzip,deflate > Content-Length: 29 > Content-Type: application/x-www-form-urlencoded > } [data not shown] < HTTP/1.1 200 OK < Server: Apache/2 < Content-Language: en-us < Content-Encoding: identity < Content-Type: application/x-javascript < Content-Encoding: gzip < Content-Length: 59 < Connection: keep-alive < Vary: Accept-Encoding < X-N: S < { [data not shown] * Connection #0 to host example.com left intact * Closing connection #0 ?V?-NW?RPR?QP*.I,)-???A??????????T??Z? ??/ There are two things to notice about the bad response: It has two Content-Encoding headers, and the browsers seem to use the first. So they see an identity encoding header, and gzipped content, so they can't interpret the response. The bad response has an extra "X-N: S" header. Perhaps if I could find out what intermediary adds "X-N: S" headers to responses, I could track down the culprit...

    Read the article

  • Why my laptop sends ARP request to itself ?

    - by user58859
    I have just started to learn about protocols. While studying the packets in wireshark, I came across a ARP request sent by my machine to my own IP. Here is the details of the packet : No. Time Source Destination Protocol Info 15 1.463563 IntelCor_aa:aa:aa Broadcast ARP Who has 192.168.1.34? Tell 0.0.0.0 Frame 15: 42 bytes on wire (336 bits), 42 bytes captured (336 bits) Arrival Time: Jan 7, 2011 18:51:43.886089000 India Standard Time Epoch Time: 1294406503.886089000 seconds [Time delta from previous captured frame: 0.123389000 seconds] [Time delta from previous displayed frame: 0.123389000 seconds] [Time since reference or first frame: 1.463563000 seconds] Frame Number: 15 Frame Length: 42 bytes (336 bits) Capture Length: 42 bytes (336 bits) [Frame is marked: False] [Frame is ignored: False] [Protocols in frame: eth:arp] [Coloring Rule Name: ARP] [Coloring Rule String: arp] Ethernet II, Src: IntelCor_aa:aa:aa (aa:aa:aa:aa:aa:aa), Dst: Broadcast (ff:ff:ff:ff:ff:ff) Destination: Broadcast (ff:ff:ff:ff:ff:ff) Address: Broadcast (ff:ff:ff:ff:ff:ff) .... ...1 .... .... .... .... = IG bit: Group address (multicast/broadcast) .... ..1. .... .... .... .... = LG bit: Locally administered address (this is NOT the factory default) Source: IntelCor_aa:aa:aa (aa:aa:aa:aa:aa:aa) Address: IntelCor_aa:aa:aa (aa:aa:aa:aa:aa:aa) .... ...0 .... .... .... .... = IG bit: Individual address (unicast) .... ..0. .... .... .... .... = LG bit: Globally unique address (factory default) Type: ARP (0x0806) Address Resolution Protocol (request) Hardware type: Ethernet (0x0001) Protocol type: IP (0x0800) Hardware size: 6 Protocol size: 4 Opcode: request (0x0001) [Is gratuitous: False] Sender MAC address: IntelCor_aa:aa:aa (aa:aa:aa:aa:aa:aa) Sender IP address: 0.0.0.0 (0.0.0.0) Target MAC address: 00:00:00_00:00:00 (00:00:00:00:00:00) Target IP address: 192.168.1.34 (192.168.1.34) Here the sender's mac address is mine(Here I have hiden my mac address). target IP is mine. Why my machine is sending ARP request to itself? I found 3 packets of this type. There was no ARP reply for these packets. Can anybody explain me why it is? (My operating system is windows-7. I am directly connected to a wifi modem. I got these packets as soon as I started my connection.) I want one suggestion also. many places I read that RFC's are enough for study about protocols. I studied the RFC 826 on ARP. I personally feel that is not enough at all. Any suggestion regarding this? Is there more then 1 RFC for a protocol? I want to study about the protocols in very detail. Can anybody guide me for this? Thanks in advance.

    Read the article

  • obtaining nimbuzz server certificate for nmdecrypt expert in NetMon

    - by lurscher
    I'm using Network Monitor 3.4 with the nmdecrypt expert. I'm opening a nimbuzz conversation node in the conversation window and i click Expert- nmDecrpt - run Expert that shows up a window where i have to add the server certificate. I am not sure how to retrieve the server certificate for nimbuzz XMPP chat service. Any idea how to do this? this question is a follow up question of this one. Edit for some background so it might be that this is encrypted with the server pubkey and i cannot retrieve the message, unless i debug the native binary and try to intercept the encryption code. I have a test client (using agsXMPP) that is able to connect with nimbuzz with no problems. the only thing that is not working is adding invisible mode. It seems this is some packet sent from the official client during login which i want to obtain. any suggestions to try to grab this info would be greatly appreciated. Maybe i should get myself (and learn) IDA pro? This is what i get inspecting the TLS frames on Network Monitor: Frame: Number = 81, Captured Frame Length = 769, MediaType = ETHERNET + Ethernet: Etype = Internet IP (IPv4),DestinationAddress:[...],SourceAddress:[....] + Ipv4: Src = ..., Dest = 192.168.2.101, Next Protocol = TCP, Packet ID = 9939, Total IP Length = 755 - Tcp: Flags=...AP..., SrcPort=5222, DstPort=3578, PayloadLen=715, Seq=4101074854 - 4101075569, Ack=1127356300, Win=4050 (scale factor 0x0) = 4050 SrcPort: 5222 DstPort: 3578 SequenceNumber: 4101074854 (0xF4716FA6) AcknowledgementNumber: 1127356300 (0x4332178C) + DataOffset: 80 (0x50) + Flags: ...AP... Window: 4050 (scale factor 0x0) = 4050 Checksum: 0x8841, Good UrgentPointer: 0 (0x0) TCPPayload: SourcePort = 5222, DestinationPort = 3578 TLSSSLData: Transport Layer Security (TLS) Payload Data - TLS: TLS Rec Layer-1 HandShake: Server Hello.; TLS Rec Layer-2 HandShake: Certificate.; TLS Rec Layer-3 HandShake: Server Hello Done. - TlsRecordLayer: TLS Rec Layer-1 HandShake: ContentType: HandShake: - Version: TLS 1.0 Major: 3 (0x3) Minor: 1 (0x1) Length: 42 (0x2A) - SSLHandshake: SSL HandShake ServerHello(0x02) HandShakeType: ServerHello(0x02) Length: 38 (0x26) - ServerHello: 0x1 + Version: TLS 1.0 + RandomBytes: SessionIDLength: 0 (0x0) TLSCipherSuite: TLS_RSA_WITH_AES_256_CBC_SHA { 0x00, 0x35 } CompressionMethod: 0 (0x0) - TlsRecordLayer: TLS Rec Layer-2 HandShake: ContentType: HandShake: - Version: TLS 1.0 Major: 3 (0x3) Minor: 1 (0x1) Length: 654 (0x28E) - SSLHandshake: SSL HandShake Certificate(0x0B) HandShakeType: Certificate(0x0B) Length: 650 (0x28A) - Cert: 0x1 CertLength: 647 (0x287) - Certificates: CertificateLength: 644 (0x284) - X509Cert: Issuer: nimbuzz.com,Nimbuzz,NL, Subject: nimbuzz.com,Nimbuzz,NL + SequenceHeader: - TbsCertificate: Issuer: nimbuzz.com,Nimbuzz,NL, Subject: nimbuzz.com,Nimbuzz,NL + SequenceHeader: + Tag0: + Version: (2) + SerialNumber: -1018418383 + Signature: Sha1WithRSAEncryption (1.2.840.113549.1.1.5) - Issuer: nimbuzz.com,Nimbuzz,NL - RdnSequence: nimbuzz.com,Nimbuzz,NL + SequenceOfHeader: 0x1 + Name: NL + Name: Nimbuzz + Name: nimbuzz.com + Validity: From: 02/22/10 20:22:32 UTC To: 02/20/20 20:22:32 UTC + Subject: nimbuzz.com,Nimbuzz,NL - SubjectPublicKeyInfo: RsaEncryption (1.2.840.113549.1.1.1) + SequenceHeader: + Algorithm: RsaEncryption (1.2.840.113549.1.1.1) - SubjectPublicKey: - AsnBitStringHeader: - AsnId: BitString type (Universal 3) - LowTag: Class: (00......) Universal (0) Type: (..0.....) Primitive TagValue: (...00011) 3 - AsnLen: Length = 141, LengthOfLength = 1 LengthType: LengthOfLength = 1 Length: 141 bytes BitString: + Tag3: + Extensions: - SignatureAlgorithm: Sha1WithRSAEncryption (1.2.840.113549.1.1.5) - SequenceHeader: - AsnId: Sequence and SequenceOf types (Universal 16) + LowTag: - AsnLen: Length = 13, LengthOfLength = 0 Length: 13 bytes, LengthOfLength = 0 + Algorithm: Sha1WithRSAEncryption (1.2.840.113549.1.1.5) - Parameters: Null Value - Sha1WithRSAEncryption: Null Value + AsnNullHeader: - Signature: - AsnBitStringHeader: - AsnId: BitString type (Universal 3) - LowTag: Class: (00......) Universal (0) Type: (..0.....) Primitive TagValue: (...00011) 3 - AsnLen: Length = 129, LengthOfLength = 1 LengthType: LengthOfLength = 1 Length: 129 bytes BitString: + TlsRecordLayer: TLS Rec Layer-3 HandShake:

    Read the article

  • Converting string to datetime object in python

    - by Gussi
    Given this string: "Fri, 09 Apr 2010 14:10:50 +0000" how does one convert it to a datetime object? After doing some reading I feel like this should work, but it doesn't... >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50 +0000' >>> fmt = '%a, %d %b %Y %H:%M:%S %z' >>> datetime.strptime(str, fmt) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "/usr/lib64/python2.6/_strptime.py", line 317, in _strptime (bad_directive, format)) ValueError: 'z' is a bad directive in format '%a, %d %b %Y %H:%M:%S %z' It should be noted that this works without a problem >>> from datetime import datetime >>> >>> str = 'Fri, 09 Apr 2010 14:10:50' >>> fmt = '%a, %d %b %Y %H:%M:%S' >>> datetime.strptime(str, fmt) datetime.datetime(2010, 4, 9, 14, 10, 50) But I'm stuck with "Fri, 09 Apr 2010 14:10:50 +0000", I would prefer to convert exactly that without changing (or slicing) that string in any way.

    Read the article

  • Pairs from single list

    - by Apalala
    Often enough, I've found the need to process a list by pairs. I was wondering which would be the pythonic and efficient way to do it, and found this on Google: pairs = zip(t[::2], t[1::2]) I thought that was pythonic enough, but after a recent discussion involving idioms versus efficiency, I decided to do some tests: import time from itertools import islice, izip def pairs_1(t): return zip(t[::2], t[1::2]) def pairs_2(t): return izip(t[::2], t[1::2]) def pairs_3(t): return izip(islice(t,None,None,2), islice(t,1,None,2)) A = range(10000) B = xrange(len(A)) def pairs_4(t): # ignore value of t! t = B return izip(islice(t,None,None,2), islice(t,1,None,2)) for f in pairs_1, pairs_2, pairs_3, pairs_4: # time the pairing s = time.time() for i in range(1000): p = f(A) t1 = time.time() - s # time using the pairs s = time.time() for i in range(1000): p = f(A) for a, b in p: pass t2 = time.time() - s print t1, t2, t2-t1 These were the results on my computer: 1.48668909073 2.63187503815 1.14518594742 0.105381965637 1.35109519958 1.24571323395 0.00257992744446 1.46182489395 1.45924496651 0.00251388549805 1.70076990128 1.69825601578 If I'm interpreting them correctly, that should mean that the implementation of lists, list indexing, and list slicing in Python is very efficient. It's a result both comforting and unexpected. Is there another, "better" way of traversing a list in pairs? Note that if the list has an odd number of elements then the last one will not be in any of the pairs. Which would be the right way to ensure that all elements are included? I added these two suggestions from the answers to the tests: def pairwise(t): it = iter(t) return izip(it, it) def chunkwise(t, size=2): it = iter(t) return izip(*[it]*size) These are the results: 0.00159502029419 1.25745987892 1.25586485863 0.00222492218018 1.23795199394 1.23572707176 Results so far Most pythonic and very efficient: pairs = izip(t[::2], t[1::2]) Most efficient and very pythonic: pairs = izip(*[iter(t)]*2) It took me a moment to grok that the first answer uses two iterators while the second uses a single one. To deal with sequences with an odd number of elements, the suggestion has been to augment the original sequence adding one element (None) that gets paired with the previous last element, something that can be achieved with itertools.izip_longest().

    Read the article

  • Few Basic Questions in Overriding

    - by Dahlia
    I have few problems with my basic and would be thankful if someone can clear this. What does it mean when I say base *b = new derived; Why would one go for this? We very well separately can create objects for class base and class derived and then call the functions accordingly. I know that this base *b = new derived; is called as Object Slicing but why and when would one go for this? I know why it is not advisable to convert the base class object to derived class object (because base class is not aware of the derived class members and methods). I even read in other StackOverflow threads that if this is gonna be the case then we have to change/re-visit our design. I understand all that, however, I am just curious, Is there any way to do this? class base { public: void f(){cout << "In Base";} }; class derived:public base { public: void f(){cout << "In Derived";} }; int _tmain(int argc, _TCHAR* argv[]) { base b1, b2; derived d1, d2; b2 = d1; d2 = reinterpret_cast<derived*>(b1); //gives error C2440 b1.f(); // Prints In Base d1.f(); // Prints In Derived b2.f(); // Prints In Base d1.base::f(); //Prints In Base d2.f(); getch(); return 0; } In case of my above example, is there any way I could call the base class f() using derived class object? I used d1.base()::f() I just want to know if there any way without using scope resolution operator? Thanks a lot for your time in helping me out!

    Read the article

  • How do you use stl's functions like for_each?

    - by thomas-gies
    I started using stl containers because they came in very handy when I needed functionality of a list, set and map and had nothing else available in my programming environment. I did not care much about the ideas behind it. STL documentations were only interesting up to the point where it came to functions, etc. Then I skipped reading and just used the containers. But yesterday, still being relaxed from my holidays, I just gave it a try and wanted to go a bit more the stl way. So I used the transform function (can I have a little bit of applause for me, thank you). From an academic point of view it really looked interesting and it worked. But the thing that boroughs me is that if you intensify the use of those functions, you need 10ks of helper classes for mostly everything you want to do in your code. The hole logic of the program is sliced in tiny pieces. This slicing is not the result of god coding habits. It's just a technical need. Something, that makes my life probably harder not easier. And I learned the hard way, that you should always choose the simplest approach that solves the problem at hand. And I can't see what, for example, the for_each function is doing for me that justifies the use of a helper class over several simple lines of code that sit inside a normal loop so that everybody can see what is going on. I would like to know, what you are thinking about my concerns? Did you see it like I do when you started working this way and have changed your mind when you got used to it? Are there benefits that I overlooked? Or do you just ignore this stuff as I did (and will go an doing it, probably). Thanks. PS: I know that there is a real for_each loop in boost. But I ignore it here since it is just a convenient way for my usual loops with iterators I guess.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Using "from __future__ import division" in my program, but it isn't loaded with my program

    - by Sara Fauzia
    I wrote the following program in Python 2 to do Newton's method computations for my math problem set, and while it works perfectly, for reasons unbeknownst to me, when I initially load it in ipython with %run -i NewtonsMethodMultivariate.py, the Python 3 division is not imported. I know this because after I load my Python program, entering x**(3/4) gives "1". After manually importing the new division, then x**(3/4) remains x**(3/4), as expected. Why is this? # coding: utf-8 from __future__ import division from sympy import symbols, Matrix, zeros x, y = symbols('x y') X = Matrix([[x],[y]]) tol = 1e-3 def roots(h,a): def F(s): return h.subs({x: s[0,0], y: s[1,0]}) def D(s): return h.jacobian(X).subs({x: s[0,0], y: s[1,0]}) if F(a) == zeros(2)[:,0]: return a else: while (F(a)).norm() > tol: a = a - ((D(a))**(-1))*F(a) print a.evalf(10) I would use Python 3 to avoid this issue, but my Linux distribution only ships SymPy for Python 2. Thanks to the help anyone can provide. Also, in case anyone was wondering, I haven't yet generalized this script for nxn Jacobians, and only had to deal with 2x2 in my problem set. Additionally, I'm slicing the 2x2 zero matrix instead of using the command zeros(2,1) because SymPy 0.7.1, installed on my machine, complains that "zeros() takes exactly one argument", though the wiki suggests otherwise. Maybe this command is only for the git version.

    Read the article

  • Python lists/arrays: disable negative indexing wrap-around

    - by wim
    While I find the negative number wraparound (i.e. A[-2] indexing the second-to-last element) extremely useful in many cases, there are often use cases I come across where it is more of an annoyance than helpful, and I find myself wishing for an alternate syntax to use when I would rather disable that particular behaviour. Here is a canned 2D example below, but I have had the same peeve a few times with other data structures and in other numbers of dimensions. import numpy as np A = np.random.randint(0, 2, (5, 10)) def foo(i, j, r=2): '''sum of neighbours within r steps of A[i,j]''' return A[i-r:i+r+1, j-r:j+r+1].sum() In the slice above I would rather that any negative number to the slice would be treated the same as None is, rather than wrapping to the other end of the array. Because of the wrapping, the otherwise nice implementation above gives incorrect results at boundary conditions and requires some sort of patch like: def ugly_foo(i, j, r=2): def thing(n): return None if n < 0 else n return A[thing(i-r):i+r+1, thing(j-r):j+r+1].sum() I have also tried zero-padding the array or list, but it is still inelegant (requires adjusting the lookup locations indices accordingly) and inefficient (requires copying the array). Am I missing some standard trick or elegant solution for slicing like this? I noticed that python and numpy already handle the case where you specify too large a number nicely - that is, if the index is greater than the shape of the array it behaves the same as if it were None.

    Read the article

  • Top n items in a List ( including duplicates )

    - by Krishnan
    Trying to find an efficient way to obtain the top N items in a very large list, possibly containing duplicates. I first tried sorting & slicing, which works. But this seems unnnecessary. You shouldn't need to sort a very large list if you just want the top 20 members. So I wrote a recursive routine which builds the top-n list. This also works, but is very much slower than the non-recursive one! Question: Which is my second routine (elite2) so much slower than elite, and how do I make it faster ? My code is attached below. Thanks. import scala.collection.SeqView import scala.math.min object X { def elite(s: SeqView[Int, List[Int]], k:Int):List[Int] = { s.sorted.reverse.force.slice(0,min(k,s.size)) } def elite2(s: SeqView[Int, List[Int]], k:Int, s2:List[Int]=Nil):List[Int] = { if( k == 0 || s.size == 0) s2.reverse else { val m = s.max val parts = s.force.partition(_==m) val whole = if( parts._1.size > 1) parts._1.tail:::parts._2 else parts._2 elite2( whole.view, k-1, m::s2 ) } } def main(args:Array[String]) = { val N = 1000000/3 val x = List(N to 1 by -1).flatten.map(x=>List(x,x,x)).flatten.view println(elite2(x,20)) println(elite(x,20)) } }

    Read the article

  • Using jQuery and SPServices to Display List Items

    - by Bil Simser
    I had an interesting challenge recently that I turned to Marc Anderson’s wonderful SPServices project for. If you haven’t already seen or used SPServices, please do. It’s a jQuery library that does primarily two things. First, it wraps up all of the SharePoint web services in a nice little AJAX wrapper for use in JavaScript. Second, it enhances the form editing of items in SharePoint so you’re not hacking up your List Form pages. My challenge was simple but interesting. The user wanted to display a SharePoint item page (DispForm.aspx, which already had some customization on it to display related items via this blog post from Codeless Solutions for SharePoint) but launch from an external application using the value of one of the fields in the SharePoint list. For simplicity let’s say my list is a list of customers and the related list is a list of orders for that customer. It would look something like this (click on the item to see the full image): Your first thought might be, that’s easy! Display the customer information using a DataView Web Part and filter the item using a query string to match the customer number. However there are a few problems with this idea: You’ll need to build a custom page and then attach that related orders view to it. This is a bit of a problem because the solution from Codeless Solutions relies on the Title field on the page to be displayed. On a custom page you would have to recreate all of the elements found on the DispForm.aspx page so the related view would work. The DataView Web Part doesn’t look *exactly* like what the out of the box display form page does. Not a huge problem and can be overcome with some CSS style overrides but still, more work. A DVWP showing a single record doesn’t have the same toolbar that you would using the DispForm.aspx. Not a show-stopper and you can rebuild the toolbar but it’s going to potentially require code and then there’s the security trimming, etc. that you have to get right. DVWPs are not automatically updated if you add a column to the list like DispForm.aspx is. Work, work, work. For these reasons I thought it would be easier to take the already existing (modified) DispForm.aspx page and just add some jQuery magic to the page to find the item. Why do we need to find it? DispForm.aspx relies on a querystring parameter called “ID” which then displays whatever that item ID number is in the list. Trouble is, when you’re coming in from an external app via a link, you don’t know what that internal ID is (and frankly shouldn’t). I don’t like exposing internal SharePoint IDs to the outside world for the same reason I don’t do it with database IDs. They’re internal and while it’s find to use on the site itself you don’t want external links using it. It’s volatile and can change (delete one item then re-add it back with the same data and watch any ID references break). The next thought might be to call a SharePoint web service with a CAML query to get the item ID number using some criteria (in this case, the customer number). That’s great if you have that ability but again we had an existing application we were just adding a link to. The last thing I wanted to do was to crack open the code on that sucker and start calling web services (primarily because it’s Java, but really I’m a lazy geek). However if you’re doing this and have access to call a web service that would be an option. Back to this problem, how do I a) find a SharePoint List Item based on some field value other than ID and b) make it low impact so I can just construct a URL to it? That’s where jQuery and SPServices came to the rescue. After spending a few hours of emails back and forth with Marc and a couple of phone calls (and updating jQuery to the latest version, duh!) it was a simple answer. First we need a reference to a) jQuery b) SPServices and c) our script. I just dropped a Content Editor Web Part, the Swiss Army Knives of Web Parts, onto the DispForm.aspx page and added these lines: <script type="text/javascript" src="http://intranet/JavaScript/jquery-1.4.2.min.js"></script> <script type="text/javascript" src="http://intranet/JavaScript/jquery.SPServices-0.5.3.min.js"></script> <script type="text/javascript" src="http://intranet/JavaScript/RedirectToID.js"> </script> Update it to point to where you keep your scripts located. I prefer to keep them all in Document Libraries as I can make changes to them without having to remote into the server (and on a multiple web front end, that’s just a PITA), it provides me with version control of sorts, and it’s quick to add new plugins and scripts. Now we can look at our RedirectToID.js script. This invokes the SPServices Library to call the GetListItems method of the Lists web service and then rewrites the URL to DispForm.aspx to use the correct SharePoint ID (the internal one). $(document).ready(function(){ var queryStringValues = $().SPServices.SPGetQueryString(); var id = queryStringValues["ID"]; if(id == "0") { var customer = queryStringValues["CustomerNumber"]; var query = "<Query><Where><Eq><FieldRef Name='CustomerNumber'/><Value Type='Text'>" + customer + "</Value></Eq></Where></Query>"; var url = window.location; $().SPServices({ operation: "GetListItems", listName: "Customers", async: false, CAMLQuery: query, completefunc: function (xData, Status) { $(xData.responseXML).find("[nodeName=z:row]").each(function(){ id = $(this).attr("ows_ID"); url = $().SPServices.SPGetCurrentSite() + "/Lists/Customers/DispForm.aspx?ID=" + id; window.location = url; }); } }); } }); What’s happening here? Line 3: We call SPServices.SPGetQueryString to get an array of query string values (a handy function in the library as I had 15 lines of code to do this which is now gone). Line 4: Extract the ID value from the query string Line 6: If we pass in “0” it means we’re looking up a field value. This allows DispForm.aspx to work like normal with SharePoint lists but lookup our values when invoked. Why ID at all? DispForm.aspx doesn’t work unless you pass in something and “0” is a *magic* number that will invoke the page but not lookup a value in the database. Line 8-15: Extract the CustomerNumber query string value, build a CAML query to find it then call the GetListitems method using SPServices Line 16: Process the results in our completefunc to iterate over all the rows (there should only be one) and extract the real ID of the item Line 17-20: Build a new URL based on the site (using a call to SPGetCurrentSite) and append our real ID to redirect to the DispForm.aspx page As you can see, it dynamically creates a CAML query for the call to the web service using the passed in value. You could even make this generic to take in different query strings, one for the field name to search for and the other for the value to find. That way it could be used for any field you want. For example you could bring up the correct item on the DispForm.aspx page based on customer name with something like this: http://myserver/Lists/Customers/DispForm.aspx?ID=0&FilterId=CustomerName&FilterValue=Sony Use your imagination. Some people would opt for building a custom page with a DVWP but if you want to leverage all the functionality of DispForm.aspx this might come in handy if you don’t want to rely on internal SharePoint IDs.

    Read the article

< Previous Page | 374 375 376 377 378 379 380 381 382 383 384 385  | Next Page >