Search Results

Search found 24117 results on 965 pages for 'write'.

Page 379/965 | < Previous Page | 375 376 377 378 379 380 381 382 383 384 385 386  | Next Page >

• Getting the Assembly Qualified Name of a class in Visual Studio

  - by Alex Marshall

  Hello, I'm writing a customized reflective library for some specialized custom domain logic, and that library is going to use XML configuration files that will dynamically resolve System.Type objects at runtime. However, when writing the XML configuration files, it's a bit of a pain to write the types because they need to be fully qualified assembly names for Type.GetType() to resolve them. Is there a way to find out the AssemblyQualifiedName of an object in Visual Studio without resorting to writing a program to print them out to a file or standard out or anything like that ?

  Read the article

• Good practice : compare a value with a boolean?

  - by NLemay

  Most of the time, I prefer to write this : if(isWelcome() == true){} if(isWelcome() == false){} instead of this if(isWelcome()){} if(!isWelcome()){} Because I feel that it is easier to read (but I do understand that it doesn't make sense). I would like to know if there is a common agreement about this practice. What most developer do? And I'm wondering if the compiler is doing the extra comparaison, or if it understand that it is useless.

  Read the article

• PHPUnit+ZendFramework ::How I can test multu users session in the same time?

  - by Yosef

  Hi, How I can create test for testing multi users sessions in the same time? (PHPUnit+ZendFramework) basic tests examples that I thinking to do (I am not QA - I soory if i wrong): users logins in the same time users buy process - only 1 user can write and the rest only read. How much session the server can handle in the same time. etc.. Thanks

  Read the article

• Matching strings

  - by Joy

  Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

  Read the article

• t-sql Common function for getting max(id)

  - by tanmay

  Hi All, In my application many I time we use MAX(). How can I write a common function where I can pass table name and column name and get MAX(). I mean single function for any table/field. Thanks, Tanmay.

  Read the article

• rails, activerecord callbacks not saving

  - by Joseph Silvashy

  I have a model with a callback that runs after_update: after_update :set_state protected def set_state if self.valid? self.state = 'complete' else self.state = 'in_progress' end end But it doesn't actually save those values, why not? Regardless of if the model is valid or not it won't even write anything, even if i remove the if self.valid? condition, I can't seem to save the state. Um, this might sound dumb, do I need to run save on it?

  Read the article

• Writing direct to disk with php

  - by Jurander

  I would like to create an upload script that doesn't fall under the php upload limit. There might be an occasion where I need to upload a 2GB, or larger file and I don't want to have to change the whole server execution to above 32MB. Is there a way to write direct to disk from php? What method might you propose someone would use to accomplish this? I have read around stack overflow but haven't quite found what I am looking to do.

  Read the article

• How do you pipe output from a Ruby script to 'head' without getting a broken pipe error

  - by dan

  I have a simple Ruby script that looks like this require 'csv' while line = STDIN.gets array = CSV.parse_line(line) puts array[2] end But when I try using this script in a Unix pipeline like this, I get 10 lines of output, followed by an error: ruby lib/myscript.rb < data.csv | head 12080450 12080451 12080517 12081046 12081048 12081050 12081051 12081052 12081054 lib/myscript.rb:4:in `write': Broken pipe - <STDOUT> (Errno::EPIPE) Is there a way to write the Ruby script in a way that prevents the broken pipe exception from being raised?

  Read the article

• Read media stream from servlet in a webpage?

  - by khue

  Hi, I have a servlet that construct response to a media file request by reading the file from server: File uploadFile = new File("C:\TEMP\movie.mov"); FileInputStream in = new FileInputStream(uploadFile); Then write that stream to the response stream. My question is how do I play the media file in the webpage using or tag to read the media stream from the response. Thank you very much. Regards K.

  Read the article

• problem in allocating kernel memory by malloc() from user space?

  - by sagar

  Is there any protection provided by kernel? Because when we tried to allocate memory using an malloc() from user space, the kernel allowed to allocated around 124 MB of memory, and when we try to write into it, the kernel crashed. If there was protection of kernel memory area, this wouldn't have happened

  Read the article

• Why writing writing to unconnected socket sends SIGPIPE first?

  - by Lukasz Lew

  There are so many possible errors in POSIX environement. Why some of them (write to unconnected socket in particular) get special treatment in form of signals?

  Read the article

• Jquery timeout on each

  - by pingu

  Hi guys, I'm trying to write a jQuery function to change out href of a link, but I'm not quite sure how to do it. I've implemented a slider, but I have a link which lives outside of the slider (outsideLink) which needs to change as the slider changes. I'm trying to achieve the following: for each link in sliderList get currentLink.href outsideLink.href = currentLink.href wait 3 seconds repeat end I'm not sure how to implement the delay when I'm going through a list of items though.

  Read the article

• .NET Generate email text in Outlook from Word

  - by Chapso

  I am attempting to generate the body of an email in Outlook 2007 from the text of a Word 2007 document in VB. I have access to both the Word and Outlook object libraries, and I can read from the Word document to get a string and write it to Outlook, but I need to keep the formatting from the Word document intact. The purpose will be to allow users to edit the word document and always have the emails my program generates be in sync with the document. Does anyone know how to do this?

  Read the article

• ITaskbarList3 undeclared?

  - by Zenox

  I'm trying to write some c++ code to use the ITaskbarList3, but I'm getting that error. I have confirmed that I am including shobjidl.h (but I checked and this file only defines up to ITaskbarList2). I have Visual Studios 2008 (SP1) and I have Microsoft Windows SDK for Windows Server 2008 installed. Does anyone know what I am missing?

  Read the article

• PHP - How can I check if the current date/time is past a set date/time ?

  - by Ben

  I'm trying to write a script that will check if the current date/time is past the 05/15/2010 at 4PM How can I use PHP's date() function to perform this check? I can't think of a neat way to do it .<

  Read the article

• Tools For Code Performance in .Net And C#

  - by hosseinsinohe

  Hi All For Example You know foreach loop is heavy And if we use for loop is Better. What Tools Can Help me to Write Code With Best Performance In C Sharp net,And Check My Code for this? Please Help me

  Read the article

• How can I integrate Java with .Net?

  - by Luke

  I have one SDK that is available in Java and another SDK that is available for .Net and would like to write a single application that interfaces with both of them. I imagine I will need to use a cross platform communication framework that can support named pipes (or other in memory communication), what is the best choice? After some more research I found Hessian -- does anyone know anything about the maturity of this project?

  Read the article

• How to compute the dot product?

  - by WizardOfOdds

  I have the following piece of pseudo-C/Java/C# code: int a[]= { 30, 20 }; int b[] = { 40, 50 }; int c[] = {12, 12}; How do I compute the sign of the dot-product AB . AC? I'm only interested in the sign, so I have: boolean signABxAC = ? Now concretely what do I write to get the sign of the dot-product AB . AC?

  Read the article

• How to find out whether sql server login has any user mapped to using SMO.

  - by Ybbest

  I need to write a function to delete the login in the database if it does not have any users to map to using SQL Server Management Objects (SMO). How can I achieve this ?

  Read the article

• Playing a .WAV file in .NET

  - by Mori

  I'm trying to write a SAMPLER program, where each key has a different sound (a WAV file). Can someone explain to me or give me a link to an explanation where i can learn how to play the WAV files? If it matters, I'm working with Microsoft Visual C# and using WinForms.

  Read the article

• Detect certain characters in a text field

  - by Craig

  What is the easiest way to detect a character in a text field? I want to be able to detect a certain character and replace that character with another specific character. So If I write in a text field... "zyxw" I want it to be replaced with "abcd". I'm a newbie and don't really know where to start with this or how to go about it. If anyone has any methods of doing this, I would really appreciate it.

  Read the article

• Sharepoint, ajax and page title

  - by drax

  Hi, I have strange problem with sharepoint and ajax functionality. We have an UpdatePanel placed inside webpart. When partial postback occurs, page title gets missing. We have found that temporary partial solution is to write title element into one line and not use any spaces or controls inside it..not even a literal control. But we need some way to provide sommon title for all pages, so title would look like this: My default title - Current page title Any ideas how to solve this?

  Read the article

• Regular expression to validate name n language other then english like Spanish..

  - by BT

  Hi, how can i write a regular expression to validate name field in a multilingual web application, i want to validate the name field for non-English languages e.g. Spanish or German, and we need to make sure that no one enter digits or special characters. I'm using .NET. I believe we can't use expression as below for non-English language. ^[a-zA-Z]{1,20}$ Any help will be highly appreciated!

  Read the article

• populating each character to std::vector <char *> from console application.

  - by john

  Hi, I am trying to write a C++ Console based application which collects and populates each characters typed in the console to a std::vector asynchronously without blocking the user Can anyone help me in how to populate each char entered in std::vector . John

  Read the article

• How to download file from particular url???

  - by greshi gupta

  NSURL * url = @"http://192.168.100.161/UploadWhiteB/wh.txt"; NSData * data = [NSData dataWithContentsOfURL:url]; if (data != nil) { NSLog(@"\nis not nil"); NSString *readdata = [[NSString alloc] initWithContentsOfURL:(NSData *)data ]; I write this code to download a file from given url... but i get an error on line NSData * data = [NSData dataWithContentsOfURL:url]; uncaught exception....so please help me out..

  Read the article

< Previous Page | 375 376 377 378 379 380 381 382 383 384 385 386  | Next Page >