Search Results

Search found 2200 results on 88 pages for 'human factors'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 38/88 | < Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >

  • MVC and conditional formatting - strategies for implementation

    - by Extrakun
    Right now I am writing a simulation program which output is formatted according to certain factors. The question is in a MVC architecture, where is the conditional formatting to be taken place? What are some strategies for implement this feature? FYI, The platform I am using is rather bare-bone in its GUI/front-end execution. To change color and formatting, it requires a change to the formatting state (much like OpenGL).

    Read the article

  • Prevent windows from presenting any dialog on native code unhandled exception

    - by Lucas Meijer
    Our buildserver compiles and runs testsuites for many different c++ programs. From time to time the programs are buggy, and can crash. When they crash, Windows7 will always throw this modal dialog: Which has to be clicked away by a human being, causing the buildserver to sit idle. Is there a way to at a system level prevent this from happening? I know I can do it from within the process itself, but I'd love to be able to do it across the entire system.

    Read the article

  • Sorting a list of colors in one dimension?

    - by Ptah- Opener of the Mouth
    I would like to sort a one-dimensional list of colors so that colors that a typical human would perceive as "like" each other are near each other. Obviously this is a difficult or perhaps impossible problem to get "perfectly", since colors are typically described with three dimensions, but that doesn't mean that there aren't some sorting methods that look obviously more natural than others. For example, sorting by RGB doesn't work very well, as it will sort in the following order, for example: (1) R=254 G=0 B=0 (2) R=254 G=255 B=0 (3) R=255 G=0 B=0 (4) R=255 G=255 B=0 That is, it will alternate those colors red, yellow, red, yellow, with the two "reds" being essentially imperceivably different than each other, and the two yellows also being imperceivably different from each other. But sorting by HLS works much better, generally speaking, and I think HSL even better than that; with either, the reds will be next to each other, and the yellows will be next to each other. But HLS/HSL has some problems, too; things that people would perceive as "black" could be split far apart from each other, as could things that people would perceive as "white". Again, I understand that I pretty much have to accept that there will be some splits like this; I'm just wondering if anyone has found a better way than HLS/HSL. And I'm aware that "better" is somewhat arbitrary; I mean "more natural to a typical human". For example, a vague thought I've had, but have not yet tried, is perhaps "L is the most important thing if it is very high or very low", but otherwise it is the least important. Has anyone tried this? Has it worked well? What specifically did you decide "very low" and "very high" meant? And so on. Or has anyone found anything else that would improve upon HSL? I should also note that I am aware that I can define a space-filling curve through the cube of colors, and order them one-dimensionally as they would be encountered while travelling along that curve. That would eliminate perceived discontinuities. However, it's not really what I want; I want decent overall large-scale groupings more than I want perfect small-scale groupings. Thanks in advance for any help.

    Read the article

  • What makes a sexy UI?

    - by nimo
    I'm in the progress of remaking one our products user interface to be more modern and apealing aswell as user friendly. It's a web based application that is used by all types of people. My question for you is what do you think are the key factors of a sexy interface? An interface that is appealing and leave the user with a WOW feeling?

    Read the article

  • Does Google punish content duplication across multiple country domains?

    - by Logan Koester
    I like the way Google handles internationalization, with domains such as google.co.uk, google.nl, google.de etc. I'd like to do this for my own site, but I'm concerned that Google will interpret this as content duplication, particularly across countries that speak the same human language, as there won't be any translation to hint that the content is different. My site is a web application, not a content farm, so is this a legitimate concern? Would I be better off with subdomains of my .com? Directories?

    Read the article

  • How do I distinguish files and folders on an FTP server

    - by soulmerge
    I want to list all files on an FTP server using PHP. According to RFC 959 the FTP command LIST is allowed to print arbitrary human-readable information on files/folders, which seems to make it impossible to determine the file type correctly. But how do other FTP clients manage to distinguish files and folders? Is there an unwritten standard or such?

    Read the article

  • warcraft3 packet infromation [closed]

    - by ajay009ajay
    Hello All, I have made a program which is fetching data from server to and game to server. I want to keep these record in my file. But my problem is this is not in good format that i can read easily. I am reading all data as "Byte" (from java). Can anybody explain header or data info of packet. so I can read it in human manner Huh thanks.

    Read the article

  • When should I use MySQL compressed protocol?

    - by ento
    I've learned that MySQL can compress communication between servers and clients. Compression is used if both client and server support zlib compression, and the client requests compression. (from MySQL Forge Wiki) The most obvious pros and cons are pros: Reduced payload size cons: Increased computation time So, is compressed protocol something I should enable whenever I can afford servers with adequate specs? Are there other factors I should consider?

    Read the article

  • get pure text form odt file in console

    - by naugtur
    I am looking for a small linux tool that would be able to extract text from odt file. It just needs to be human-readable and it can have problems with complicated objects etc. It's almost a duplicate of this question but I need it to be small and have no dependencies on OpenOffice or X server I remember having a 1MB MS-DOS program that could render .doc files quite readibly (with some weird markup getting through from time to time), so i expect it to be possible in the linux world too ;)

    Read the article

  • Why are there so many DB management Systems ?

    - by mr.bio
    Hi there , i always asked myself. Why are there so many DB management systems? I am not an DB expert and i never thought about using another DB than mysql. Programming languages offer different paradigms, so there it makes sense to choose a specific language for your purpose. What are factors to choose a specific DB management system ?

    Read the article

  • Is it possible to programmatically edit a sound file based on frequency?

    - by K-RAN
    Just wondering if it's possible to go through a flac, mp3, wav, etc file and edit portions, or the entire file by removing sections based on a specific frequency range? So for example, I have a recording of a friend reciting a poem with a few percussion instruments in the background. Could I write a C program that goes through the entire file and cuts out everything except the vocals (human voice frequency ranges from 85-255 Hz, from what I've been reading)? Thanks in advance for any ideas!

    Read the article

  • Captcha replacement

    - by portoalet
    Hi, I stumbled upon http://www.kettletime.com.au/chance where the user needs to drag and drop a box with a number into another box to prove that he is human. How do you implement this? Any free library to do this? Thanks

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • Write easily readable XML in Python

    - by dutch
    Is there any way other than creating a method myself to write XML using python which are easily readable? xMLFile.write(xmlDom.toxml()) does create proper xml but reading them is pretty difficult. I tried toprettyxml but doesn't seem like it does much. e.g. following is what I would consider a human readable xml:

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >