Search Results

Search found 27530 results on 1102 pages for 'write binary'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 38/1102 | < Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >

  • USB Permission - Write protection

    - by dekhadmai
    I have an external harddisk and my friends asked for it. The point is I don't trust in his anti-virus software. Is there anyway to allow some folders (I prepare hdd space for him) to write-able and all others is read-only ? or is there a software that can do like this ? And it would be great if I can have full access on my computer ONLY (may be with some specific software on my PC) and without having to modify anything. I don't ask for hdd-encryption since I only want to limit the area of write-able folder (and allow my friend to read through all my data), later I can scan for virus myself only in that area ... scanning entire hdd with 500gb/friend is not fun at all ! Sorry if this doesn't seems like the programming questions. Any help would be appreciate, Thank you.

    Read the article

  • Binary Search Tree in C

    - by heapzero
    Hi, I'm a Python guy. Learning C language and I've been trying to implement Binary Search Tree in C. I wrote down the code, and I've been trying from few hours but, not able to get the output as expected. Please help! Please correct me. #include<stdlib.h> #include<stdio.h> typedef int ElementType; typedef struct TreeNode { ElementType element; struct TreeNode *left, *right; } TreeNode; TreeNode *createTree(){ //Create the root of tree TreeNode *tempNode; tempNode = malloc(sizeof(TreeNode)); tempNode->element = 0; tempNode->left = NULL; tempNode->right = NULL; return tempNode; } TreeNode *createNode(ElementType X){ //Create a new leaf node and return the pointer TreeNode *tempNode; tempNode = malloc(sizeof(TreeNode)); tempNode->element = X; tempNode->left = NULL; tempNode->right = NULL; return tempNode; } TreeNode *insertElement(TreeNode *node, ElementType X){ //insert element to Tree if(node==NULL){ return createNode(X); } else{ if(X < node->element){ node->left = insertElement(node->left, X); } else if(X > node->element){ node->right = insertElement(node->right, X); } else if(X == node->element){ printf("Oops! the element is already present in the tree."); } } } TreeNode *displayTree(TreeNode *node){ //display the full tree if(node==NULL){ return; } displayTree(node->left); printf("| %d ", node->element); displayTree(node->right); } main(){ //pointer to root of tree #2 TreeNode *TreePtr; TreeNode *TreeRoot; TreeNode *TreeChild; //Create the root of tree TreePtr = createTree(); TreeRoot = TreePtr; TreeRoot->element = 32; printf("%d\n",TreeRoot->element); insertElement(TreeRoot, 8); TreeChild = TreeRoot->left; printf("%d\n",TreeChild->element); insertElement(TreeRoot, 2); insertElement(TreeRoot, 7); insertElement(TreeRoot, 42); insertElement(TreeRoot, 28); insertElement(TreeRoot, 1); insertElement(TreeRoot, 4); insertElement(TreeRoot, 5); // the output is not as expected :( displayTree(TreeRoot); }

    Read the article

  • Model Fit of Binary GLM with more than 1 or 2 predictors

    - by Salmo salar
    I am trying to predict a binary GLM with multiple predictors. I can do it fine with one predictor variable however struggle when I use multiple Sample data: structure(list(attempt = structure(c(1L, 2L, 1L, 2L, 1L, 1L, 1L, 2L, 1L, 2L, 1L, 1L, 1L, 2L, 1L, 2L, 1L, 2L, 1L, 1L, 1L, 1L, 2L, 1L, 2L, 1L, 1L, 2L, 1L, 1L, 1L, 1L, 1L, 2L, 1L, 2L, 1L, 1L, 1L, 2L, 1L, 1L, 2L, 1L, 1L, 2L, 1L, 2L, 1L, 1L, 2L, 1L, 2L), .Label = c("1", "2"), class = "factor"), searchtime = c(137, 90, 164, 32, 39, 30, 197, 308, 172, 48, 867, 117, 63, 1345, 38, 122, 226, 397, 0, 106, 259, 220, 170, 102, 46, 327, 8, 10, 23, 108, 315, 318, 70, 646, 69, 97, 117, 45, 31, 64, 125, 17, 240, 63, 549, 1651, 233, 406, 334, 168, 127, 47, 881), mean.search.flow = c(15.97766667, 14.226, 17.15724762, 14.7465, 39.579, 23.355, 110.2926923, 71.95709524, 72.73666667, 32.37466667, 50.34905172, 27.98471429, 49.244, 109.1759778, 77.71733333, 37.446875, 101.23875, 67.78534615, 21.359, 36.54257143, 34.13961111, 64.35253333, 80.98554545, 61.50857143, 48.983, 63.81072727, 26.105, 46.783, 23.0605, 33.61557143, 46.31042857, 62.37061905, 12.565, 42.31983721, 15.3982, 14.49625, 23.77425, 25.626, 74.62485714, 170.1547778, 50.67125, 48.098, 66.83644444, 76.564875, 80.63189189, 136.0573243, 136.3484, 86.68688889, 34.82169565, 70.00415385, 64.67233333, 81.72766667, 57.74522034), Pass = structure(c(1L, 2L, 1L, 2L, 2L, 2L, 1L, 1L, 1L, 2L, 2L, 2L, 1L, 2L, 1L, 2L, 1L, 2L, 2L, 2L, 2L, 1L, 1L, 1L, 2L, 2L, 1L, 2L, 2L, 2L, 2L, 2L, 1L, 2L, 1L, 1L, 2L, 1L, 1L, 1L, 2L, 1L, 2L, 2L, 1L, 2L, 1L, 2L, 2L, 1L, 2L, 1L, 2L), .Label = c("0", "1"), class = "factor")), .Names = c("attempt", "searchtime", "mean.search.flow", "Pass"), class = "data.frame", row.names = c(1L, 2L, 3L, 4L, 5L, 6L, 7L, 8L, 12L, 13L, 14L, 15L, 16L, 17L, 18L, 19L, 20L, 21L, 22L, 23L, 24L, 25L, 26L, 28L, 29L, 30L, 31L, 32L, 33L, 34L, 35L, 36L, 37L, 38L, 39L, 40L, 50L, 51L, 53L, 54L, 60L, 61L, 62L, 63L, 64L, 65L, 66L, 67L, 68L, 69L, 70L, 71L, 72L)) First model with single predictor M2 <- glm(Pass ~ searchtime, data = DF3, family = binomial) summary(M2) drop1(M2, test = "Chi") Plot works fine P1 <- predict(M2, newdata = MyData, type = "link", se = TRUE) plot(x=MyData$searchtime, exp(P1$fit) / (1+exp(P1$fit)), type = "l", ylim = c(0,1), xlab = "search time", ylab = "pobability of passage") lines(MyData$searchtime, exp(P1$fit+1.96*P1$se.fit)/ (1 + exp(P1$fit + 1.96 * P1$se.fit)), lty = 2) lines(MyData$searchtime, exp(P1$fit-1.96*P1$se.fit)/ (1 + exp(P1$fit - 1.96 * P1$se.fit)), lty = 2) points(DF3$searchtime, DF3$Search.and.pass) Second model M2a <- glm(Pass ~ searchtime + mean.search.flow+ attempt, data = DF3, family = binomial) summary(M2a) drop1(M2a, test = "Chi") How do I plot this with "dummy" data? I have tried along the lines of Model.matrix and expand.grid, as you would do with glmer, but fail straight away due to the two categorical variables along with factor(attempt)

    Read the article

  • Recommendations for a C++ polymorphic, seekable, binary I/O interface

    - by Trevor Robinson
    I've been using std::istream and ostream as a polymorphic interface for random-access binary I/O in C++, but it seems suboptimal in numerous ways: 64-bit seeks are non-portable and error-prone due to streampos/streamoff limitations; currently using boost/iostreams/positioning.hpp as a workaround, but it requires vigilance Missing operations such as truncating or extending a file (ala POSIX ftruncate) Inconsistency between concrete implementations; e.g. stringstream has independent get/put positions whereas filestream does not Inconsistency between platform implementations; e.g. behavior of seeking pass the end of a file or usage of failbit/badbit on errors Don't need all the formatting facilities of stream or possibly even the buffering of streambuf streambuf error reporting (i.e. exceptions vs. returning an error indicator) is supposedly implementation-dependent in practice I like the simplified interface provided by the Boost.Iostreams Device concept, but it's provided as function templates rather than a polymorphic class. (There is a device class, but it's not polymorphic and is just an implementation helper class not necessarily used by the supplied device implementations.) I'm primarily using large disk files, but I really want polymorphism so I can easily substitute alternate implementations (e.g. use stringstream instead of fstream for unit tests) without all the complexity and compile-time coupling of deep template instantiation. Does anyone have any recommendations of a standard approach to this? It seems like a common situation, so I don't want to invent my own interfaces unnecessarily. As an example, something like java.nio.FileChannel seems ideal. My best solution so far is to put a thin polymorphic layer on top of Boost.Iostreams devices. For example: class my_istream { public: virtual std::streampos seek(stream_offset off, std::ios_base::seekdir way) = 0; virtual std::streamsize read(char* s, std::streamsize n) = 0; virtual void close() = 0; }; template <class T> class boost_istream : public my_istream { public: boost_istream(const T& device) : m_device(device) { } virtual std::streampos seek(stream_offset off, std::ios_base::seekdir way) { return boost::iostreams::seek(m_device, off, way); } virtual std::streamsize read(char* s, std::streamsize n) { return boost::iostreams::read(m_device, s, n); } virtual void close() { boost::iostreams::close(m_device); } private: T m_device; };

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • c# write big files to blob sqlite

    - by brizjin-gmail-com
    I have c# application which write files to sqlite database. It uses entity fraemwork for modeling data. Write file to blob (entity byte[] varible) with this line: row.file = System.IO.File.ReadAllBytes(file_to_load.FileName); //row.file is type byte[] //row is entity class table All work correctly when files size is less. When size more 300Mb app throw exception: Exception of type 'System.OutOfMemoryException' was thrown. How I can write to blob direct, without memory varibles?

    Read the article

  • write c++ in latex, noob latex question

    - by voodoomsr
    maybe is a noob question but i can't find the solution in the web, i need to write C++ in Latex. I write C$++$ but the result is like crap, the signs are too big and there is too much space between C and the first plus sign. Previously i needed to write the sharp symbol for C#....c$\sharp$ it also looks like crap but with a escape character it looks nice, for the plus sign i can't do the same.

    Read the article

  • How does DataContractSerializer write to private fields?

    - by Eric
    I understand how XMLSerializer could work by using reflection to figure out what public read/write fields or properties it should be using to serialize or de-serialize XML. Yet XMLSerializer requires that the fields be public and read/write. However, DataContractSerializer is able to read or write to or from completely private fields in a class. So I'm wondering how this is even possible with out explicitly giving DataContractSerializer additional access rights to my class(es).

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Download binary file From SQL Server 2000

    - by kareemsaad
    I inserted binary files (images, PDF, videos..) and I want to retrieve this file to download it. I used generic handler page as this public void ProcessRequest (HttpContext context) { using (System.Data.SqlClient.SqlConnection con = Connection.GetConnection()) { String Sql = "Select BinaryData From ProductsDownload Where Product_Id = @Product_Id"; SqlCommand com = new SqlCommand(Sql, con); com.CommandType = System.Data.CommandType.Text; com.Parameters.Add(Parameter.NewInt("@Product_Id", context.Request.QueryString["Product_Id"].ToString())); SqlDataReader dr = com.ExecuteReader(); if (dr.Read() && dr != null) { Byte[] bytes; bytes = Encoding.UTF8.GetBytes(String.Empty); bytes = (Byte[])dr["BinaryData"]; context.Response.BinaryWrite(bytes); dr.Close(); } } } and this is my table CREATE TABLE [ProductsDownload] ( [ID] [bigint] IDENTITY (1, 1) NOT NULL , [Product_Id] [int] NULL , [Type_Id] [int] NULL , [Name] [nvarchar] (200) COLLATE Arabic_CI_AS NULL , [MIME] [varchar] (50) COLLATE Arabic_CI_AS NULL , [BinaryData] [varbinary] (4000) NULL , [Description] [nvarchar] (500) COLLATE Arabic_CI_AS NULL , [Add_Date] [datetime] NULL , CONSTRAINT [PK_ProductsDownload] PRIMARY KEY CLUSTERED ( [ID] ) ON [PRIMARY] , CONSTRAINT [FK_ProductsDownload_DownloadTypes] FOREIGN KEY ( [Type_Id] ) REFERENCES [DownloadTypes] ( [ID] ) ON DELETE CASCADE ON UPDATE CASCADE , CONSTRAINT [FK_ProductsDownload_Product] FOREIGN KEY ( [Product_Id] ) REFERENCES [Product] ( [Product_Id] ) ON DELETE CASCADE ON UPDATE CASCADE ) ON [PRIMARY] GO And use data list has label for file name and button to download file as <asp:DataList ID="DataList5" runat="server" DataSource='<%#GetData(Convert.ToString(Eval("Product_Id")))%>' RepeatColumns="1" RepeatLayout="Flow"> <ItemTemplate> <table width="100%" border="0" cellspacing="0" cellpadding="0"> <tr> <td class="spc_tab_hed_bg spc_hed_txt lm5 tm2 bm3"> <asp:Label ID="LblType" runat="server" Text='<%# Eval("TypeName", "{0}") %>'></asp:Label> </td> <td width="380" class="spc_tab_hed_bg"> &nbsp; </td> </tr> <tr> <td align="left" class="lm5 tm2 bm3"> <asp:Label ID="LblData" runat="server" Text='<%# Eval("Name", "{0}") %>'></asp:Label> </td> <td align="center" class=" tm2 bm3"> <a href='<%# "DownloadFile.aspx?Product_Id=" + DataBinder.Eval(Container.DataItem,"Product_Id") %>' > <img src="images/downloads_ht.jpg" width="11" height="11" border="0" /> </a> <%--<asp:ImageButton ID="ImageButton1" ImageUrl="images/downloads_ht.jpg" runat="server" OnClick="ImageButton1_Click1" />--%> </td> </tr> </table> </ItemTemplate> </asp:DataList> I tried more to solve this problem but I cannot please if any one has solve for this proplem please sent me thank you kareem saad programmer MCTS,MCPD Toshiba Company Egypt

    Read the article

  • Using Java PDFBox library to write Russian PDF

    - by Brad
    Hello , I am using a Java library called PDFBox trying to write text to a PDF. It works perfect for English text, but when i tried to write Russian text inside the PDF the letters appeared so strange. It seems the problem is in the font used, but i am not so sure about that, so i hope if anyone could guide me through this. Here is the important code lines : PDTrueTypeFont font = PDTrueTypeFont.loadTTF( pdfFile, new File( "fonts/VREMACCI.TTF" ) ); // Windows Russian font imported to write the Russian text. font.setEncoding( new WinAnsiEncoding() ); // Define the Encoding used in writing. // Some code here to open the PDF & define a new page. contentStream.drawString( "??????? ????????????" ); // Write the Russian text. The WinAnsiEncoding source code is : Click here --------------------- Edit on 18 November 2009 After some investigation, i am now sure it is an Encoding problem, this could be solved by defining my own Encoding using the helpful PDFBox class called DictionaryEncoding. I am not sure how to use it, but here is what i have tried until now : COSDictionary cosDic = new COSDictionary(); cosDic.setString( COSName.getPDFName("Ercyrillic"), "0420 " ); // Russian letter. font.setEncoding( new DictionaryEncoding( cosDic ) ); This does not work, as it seems i am filling the dictionary in a wrong way, when i write a PDF page using this it appears blank. The DictionaryEncoding source code is : Click here Thanks . . .

    Read the article

  • Using ServletOutputStream to write very large files in a Java servlet without memory issues

    - by Martin
    I am using IBM Websphere Application Server v6 and Java 1.4 and am trying to write large CSV files to the ServletOutputStream for a user to download. Files are ranging from a 50-750MB at the moment. The smaller files aren't causing too much of a problem but with the larger files it appears that it is being written into the heap which is then causing an OutOfMemory error and bringing down the entire server. These files can only be served out to authenticated users over https which is why I am serving them through a Servlet instead of just sticking them in Apache. The code I am using is (some fluff removed around this): resp.setHeader("Content-length", "" + fileLength); resp.setContentType("application/vnd.ms-excel"); resp.setHeader("Content-Disposition","attachment; filename=\"export.csv\""); FileInputStream inputStream = null; try { inputStream = new FileInputStream(path); byte[] buffer = new byte[1024]; int bytesRead = 0; do { bytesRead = inputStream.read(buffer, offset, buffer.length); resp.getOutputStream().write(buffer, 0, bytesRead); } while (bytesRead == buffer.length); resp.getOutputStream().flush(); } finally { if(inputStream != null) inputStream.close(); } The FileInputStream doesn't seem to be causing a problem as if I write to another file or just remove the write completly the memory usage doesn't appear to be a problem. What I am thinking is that the resp.getOutputStream().write is being stored in memory until the data can be sent through to the client. So the entire file might be read and stored in the resp.getOutputStream() causing my memory issues and crashing! I have tried Buffering these streams and also tried using Channels from java.nio, none of which seems to make any bit of difference to my memory issues. I have also flushed the outputstream once per iteration of the loop and after the loop, which didn't help.

    Read the article

  • How do i write this jpql query?

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • Write simple data to iphone sandbox?

    - by fuzzygoat
    I want to write a small bit of data from my app to the iphone so I can load it when the app next starts. I am going to write the data using NSCoding, but I don't know what I should be specifying as a path. I understand I would write the data to the application sandbox, just not sure how to specify that. gary

    Read the article

  • How do i write this jpql query? java

    - by Nitesh Panchal
    Hello, Say i have 5 tables, tblBlogs tblBlogPosts tblBlogPostComment tblUser tblBlogMember BlogId BlogPostsId BlogPostCommentId UserId BlogMemberId BlogTitle BlogId CommentText FirstName UserId PostTitle BlogPostsId BlogId BlogMemberId Now i want to retrieve only those blogs and posts for which blogMember has actually commented. So in short, how do i write this plain old sql :- Select b.BlogTitle, bp.PostTitle, bpc.CommentText from tblBlogs b Inner join tblBlogPosts bp on b.BlogId = bp.BlogId Inner Join tblBlogPostComment bpc on bp.BlogPostsId = bpc.BlogPostsId Inner Join tblBlogMember bm On bpc.BlogMemberId = bm.BlogMemberId Where bm.UserId = 1; As you can see, everything is Inner join, so only that row will be retrieved for which the user has commented on some post of some blog. So, suppose he has joined 3 blogs whose ids are 1,2,3 (The blogs which user has joined are in tblBlogMembers) but the user has only commented in blog 2 (of say BlogPostId = 1). So that row will be retrieved and 1,3 won't as it is Inner Join. How do i write this kind of query in jpql? In jpql, we can only write simple queries like say :- Select bm.blogId from tblBlogMember Where bm.UserId = objUser; Where objUser is supplied using :- em.find(User.class,1); Thus once we get all blogs(Here blogId represents a blog object) which user has joined, we can loop through and do all fancy things. But i don't want to fall in this looping business and write all this things in my java code. Instead, i want to leave that for database engine to do. So, how do i write the above plain sql into jpql? and what type of object the jpql query will return? because i am only selecting few fields from all table. In which class should i typecast the result to? I think i posted my requirement correctly, if i am not clear please let me know. Thanks in advance :).

    Read the article

  • .NET Single Line Logging (ala Trace.Write/WriteLine) using Instrumentation.Logging

    - by KnownColor
    Hello Everyone, My question is whether it is possible to get line/multiline (very unsure of correct term for this) behaviour of the Trace.Write and Trace.WriteLine methods but using the Microsoft Instrumentation Logging framework in .NET 2.0. Desired Output Hello World! Oh Hai. What I Currently Have Trace.Write("Hello "); Trace.WriteLine("World!"); Trace.Write("Oh Hai."); I would prefer to use instrumentation to log rather than writing to a log file using Debug.Trace. EDIT: By Instrumentation Logging I mean using a 'loggingConfiguration' block in my App.config and writing Log Entries using using Microsoft.Practices.EnterpriseLibrary.Logging.Logger.Write(LogEntry logEntry); Microsoft.Practices.EnterpriseLibrary.Logging.Configuration.FlatFileTraceListenerData, Microsoft.Practices.EnterpriseLibrary.Logging, Version=2.0.0.0 for example. Ta, KnownColor

    Read the article

  • Writing/Reading struct w/ dynamic array through pipe in C

    - by anrui
    I have a struct with a dynamic array inside of it: struct mystruct{ int count; int *arr; }mystruct_t; and I want to pass this struct down a pipe in C and around a ring of processes. When I alter the value of count in each process, it is changed correctly. My problem is with the dynamic array. I am allocating the array as such: mystruct_t x; x.arr = malloc( howManyItemsDoINeedToStore * sizeof( int ) ); Each process should read from the pipe, do something to that array, and then write it to another pipe. The ring is set up correctly; there's no problem there. My problem is that all of the processes, except the first one, are not getting a correct copy of the array. I initialize all of the values to, say, 10 in the first process; however, they all show up as 0 in the subsequent ones. for( j = 0; j < howManyItemsDoINeedToStore; j++ ){ x.arr[j] = 10; } Initally: 10 10 10 10 10 After Proc 1: 9 10 10 10 15 After Proc 2: 0 0 0 0 0 After Proc 3: 0 0 0 0 0 After Proc 4: 0 0 0 0 0 After Proc 5: 0 0 0 0 0 After Proc 1: 9 10 10 10 15 After Proc 2: 0 0 0 0 0 After Proc 3: 0 0 0 0 0 After Proc 4: 0 0 0 0 0 After Proc 5: 0 0 0 0 0 Now, if I alter my code to, say, struct mystruct{ int count; int arr[10]; }mystruct_t; everything is passed correctly down the pipe, no problem. I am using READ and WRITE, in C: write( STDOUT_FILENO, &x, sizeof( mystruct_t ) ); read( STDIN_FILENO, &x, sizeof( mystruct_t ) ); Any help would be appreciated. Thanks in advance!

    Read the article

  • Serial: write() throttling?

    - by damian
    Hi everyone, I'm working on a project sending serial data to control animation of LED lights, which need to stay in sync with a sound engine. There seems to be a large serial write buffer (OSX (POSIX) + FTDI chipset usb serial device), so without manually restricting the transmission rate, the animation system can get several seconds ahead of the serial transmission. Currently I'm manually restricting the serial write speed to the baudrate (8N1 = 10 bytes serial frame per 8 bytes data, 19200 bps serial - 1920 bytes per second max), but I am having a problem with the sound drifting out of sync over time - it starts fine, but after 10 minutes there's a noticeable (100ms+) lag between the sound and the lights. This is the code that's restricting the serial write speed (called once per animation frame, 'elapsed' is the duration of the current frame, 'baudrate' is the bps (19200)): void BufferedSerial::update( float elapsed ) { baud_timer += elapsed; if ( bytes_written > 1024 ) { // maintain baudrate float time_should_have_taken = (float(bytes_written)*10)/float(baudrate); float time_actually_took = baud_timer; // sleep if we have > 20ms lag between serial transmit and our write calls if ( time_should_have_taken-time_actually_took > 0.02f ) { float sleep_time = time_should_have_taken - time_actually_took; int sleep_time_us = sleep_time*1000.0f*1000.0f; //printf("BufferedSerial::update sleeping %i ms\n", sleep_time_us/1000 ); delayUs( sleep_time_us ); // subtract 128 bytes bytes_written -= 128; // subtract the time it should have taken to write 128 bytes baud_timer -= (float(128)*10)/float(baudrate); } } } Clearly there's something wrong, somewhere. A much better approach would be to be able to determine the number of bytes currently in the transmit queue, and try and keep that below a fixed threshold. Any advice appreciated.

    Read the article

  • Cannot write to SD card -- canWrite is returning false

    - by Fizz
    Sorry for the ambiguous title but I'm doing the following to write a simple string to a file: try { File root = Environment.getExternalStorageDirectory(); if (root.canWrite()){ System.out.println("Can write."); File def_file = new File(root, "default.txt"); FileWriter fw = new FileWriter(def_file); BufferedWriter out = new BufferedWriter(fw); String defbuf = "default"; out.write(defbuf); out.flush(); out.close(); } else System.out.println("Can't write."); }catch (IOException e) { e.printStackTrace(); } But root.canWrite() seems to be returning false everytime. I am not running this off of an emulator, I have my android Eris plugged into my computer via USB and running the app off of my phone via Eclipse. Is there a way of giving my app permission so this doesn't happen? Also, this code seems to be create the file default.txt but what if it already exists, will it ignore the creation and just open it to write or do I have to catch something like FileAlreadyExists(if such an exception exists) which then just opens it and writes? Thanks for any help guys.

    Read the article

  • how to check the read write status of storing media in python

    - by mukul sharma
    Hi All, How can i check the read/ write permission of the file storing media? ie assume i have to write some file inside a directory and that directory may be available on read only media like (cd or dvd)or etc. So how can i check that storing media ( cd, hard disk) having a read only or read write both permission. I am using windows xp os. Thanks.

    Read the article

  • Read and Write in the same file with different process

    - by muruga
    I have written the two program. One program is write the content to the text file simultaneously. Another program is read that content simultaneously. But both the program should run at the same time. For me the program is write the file is correctly. But another program is not read the file. I know that once the write process is completed than only the data will be stored in the hard disk. Then another process can read the data. But I want both read and write same time with different process in the single file. How can I do that? Please help me.

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 34 35 36 37 38 39 40 41 42 43 44 45  | Next Page >