Search Results

Search found 10838 results on 434 pages for 'adf task flow'.

Page 380/434 | < Previous Page | 376 377 378 379 380 381 382 383 384 385 386 387  | Next Page >

  • Supersede users need to press enter after inputting a string in python 3.0

    - by Cimex
    I've been attempting to create a simple Rock, Paper, Scissors game in python 3.0 -- very standard task for anybody learning programming. But, as I finish up to a point, I think,"wow, that'd be awesome", or,"it'd be cool to do this!" So anyways, I keep building upon the project... I've developed a menu, a single player game vs the computer, and just finished the multiplayer game. But, I've realized, that the multiplayer game isn't very effective. It just dosen't work like the analog version of the game. Currently, it'll ask for player1's input, then player2's input, compare them, and spit out the result and the current score. What I'd rather have happen is that the program asks for both players input at the same time and both players input their choice at the same time. I understand that I can easily do that by just grabbing the index of the first and second answer and compare the 2 inputs -- easy. But what I'd rather have happen is that after both players enter their one character answers at the same time (r for rock, p for paper, or s for scissors), then the program will auto enter the input. Not needing someone to press enter. The input would be dictated by the fact that 2 characters have been entered. I guess my question is: Is there any way to dictate what can be used as an input for 'enter'?

    Read the article

  • Best way to migrate export/import from SQL Server to oracle

    - by matao
    Hi guys! I'm faced with needing access for reporting to some data that lives in Oracle and other data that lives in a SQL Server 2000 database. For various reasons these live on different sides of a firewall. Now we're looking at doing an export/import from sql server to oracle and I'd like some advice on the best way to go about it... The procedure will need to be fully automated and run nightly, so that excludes using the SQL developer tools. I also can't make a live link between databases from our (oracle) side as the firewall is in the way. The data needs to be transformed in the process from a star schema to a de-normalised table ready for reporting. What I'm thinking about is writing a monster query for SQL Server (which I mostly have already) that will denormalise and read out the data from SQL Server into a flat file using the sql server equivalent of sqlplus as a scheduled task, dump into a Well Known Location, then on the oracle side have a cron job that copies down the file and loads it with sql loader and rebuilds indexes etc. This is all doable, but very manual. Is there one or a combination of FOSS or standard oracle/SQL Server tools that could automate this for me? the Irreducible complexity is the query on one side and building indexes on the other, but I would love to not have to write the CSV dumping detail or the SQL loader script, just say dump this view out to CSV on one side, and on the other truncate and insert into this table from CSV and not worry about mapping column names and all other arcane sqlldr voodoo... best practices? thoughts? comments? edit: I have about 50+ columns all of varying types and lengths in my dataset, which is why I'd prefer to not have to write out how to generate and map each single column...

    Read the article

  • Why might my PHP log file not entirely be text?

    - by Fletcher Moore
    I'm trying to debug a plugin-bloated Wordpress installation; so I've added a very simple homebrew logger that records all the callbacks, which are basically listed in a single, ultimately 250+ row multidimensional array in Wordpress (I can't use print_r() because I need to catch them right before they are called). My logger line is $logger->log("\t" . $callback . "\n"); The logger produces a dandy text file in normal situations, but at two points during this particular task it is adding something which causes my log file to no longer be encoded properly. Gedit (I'm on Ubuntu) won't open the file, claiming to not understand the encoding. In vim, the culprit corrupt callback (which I could not find in the debugger, looking at the array) is about in the middle and printed as ^@lambda_546 and at the end of file there's this cute guy ^M. The ^M and ^@ are blue in my vim, which has no color theme set for .txt files. I don't know what it means. I tried adding an is_string($callback) condition, but I get the same results. Any ideas?

    Read the article

  • How to exclude tags folder from triggering build in Teamcity?

    - by Jaya mareedu
    Hello, I recently installed Teamcity 5.0.3. I am trying to setup automated build for a .NET 2.0 VS2005 project. I use NAnt and MSBuild task to perform the build. The project structure is a typical SVN structure svn://localhost/ITools is my repository and the project structure is VisualTrack trunk branches tags I created a new project in Teamcity and then created a build configuration for that project. I asked it to kick off a build everytime there is a change detected in SVN VisualTrack VCS. I also configured it to create a label in VisualTrack/tags for every successful build. The problem I am running into is that the build is getting trigerred everytime teamcity is creating a new label under tags. I only want the build to be triggered if some developer commits his or her changes into trunk. Next step I took was to create a build trigger rule to exclude the tags path by specifying a trigger pattern as -:VisualTrack/tags/**, but looks like its not working. I believe the pattern I specified is not correct. Can someone please help me resolve this issue? Thanks, Jaya.

    Read the article

  • What's the correct place to share application logic in CakePHP?

    - by Pichan
    I guess simple answer to the question would be a component. Although I agree, I feel weird having to write a component for something so specific. For example, let's say I have a table of users. When a user is created, it should form a chain reaction of events, initiating different kinds of data related to the user all around the database. I figured it would be best to avoid directly manipulating the database from different controllers and instead pack all that neatly in a method. However since some logic needs to be accesed separately, I really can't have the whole package in a single method. Instead I thought it would be logical to break it up to smaller pieces(like $userModelOrController->createNew() and $candyStorageModelOrController->createNew()) that only interact with their respective database table. Now, if the logic is put to the model, it works great until I need to use other models. Of course it's possible, but when compared to loading models in a controller, it's not that simple. It's like a Cake developer telling me "Sure, it's possible if you want to do it that way but that's not how I would do it". Then, if the logic is put to the controller, I can access other models really easy through $this->loadModel(), but that brings me back to the previously explained situation since I need to be able to continue the chain reaction indefinitely. Accessing other controllers from a controller is possible, but again there doesn't seem to be any direct way of doing so, so I'm guessing I'm still not doing it right. By using a component this problem could be solved easily, since components are available to every controller I want. But like I wrote at the beginning, it feels awkward to create a component specifically for this one task. To me, components seem more like packages of extra functionality(like the core components) and not something to share controller-specific logic. Since I'm new to this whole MVC thing, I could've completely misunderstood the concept. Once again, I would be thankful if someone pointed me to the right direction :)

    Read the article

  • Cocoa - calling a VIEW method from the CONTROLLER

    - by eemerge
    Hello everyone, Got a little problem i asked about it before but maybe i didnt ask properly. I have a cocoa application, which amongst other things, must do the following task: - load some images from the disk, store them in an array and display them in a custom view. In the Interface Builder i have a CustomView and an OBJECT that points to TexturesController.h The custom view is a custom class, TextureBrowser. Below is the code for the controller and view: TexturesController #import <Cocoa/Cocoa.h> @class TextureBrowser; @interface TexturesController : NSObject { IBOutlet NSTextField *logWindow; IBOutlet TextureBrowser *textureView; NSMutableArray *textureList; } @property textureView; -(IBAction)loadTextures:(id)sender; -(IBAction)showTexturesInfo:(id)sender; @end TextureBrowser @interface TextureBrowser : NSView { NSMutableArray *textures; } @property NSMutableArray *textures; -(void)loadTextureList:(NSMutableArray *)source; @end These are just the headers. Now , what i need to do is: when loadTextures from the TexturesController is called, after i load the images i want to send this data to the view (TextureBrowser), for example, store it in the NSMutableArray *textures. I tried using the -(void)loadTextureList:(NSMutableArray*)source method from the view, but in the TextureController.m i get a warning : No -loadTextureList method found This is how i call the method : [textureView loadTextureList: textureList]; And even if i run it with the warning left there, the array in the view class doesnt get initialised. Maybe im missing something...maybe someone can give a simple example of what i need to do and how to do it (code). Thanks in advance.

    Read the article

  • Cross-platform general purpose C++ RPC library

    - by iUm
    Here's the task: Imagine, we have an applications and a plug-in for it (dynamic library). Interface between the application and the plug-in is completely defined. Now I need to run the application and the plug-in on different computers. I wrote a stub for the plug-in on a computer where the real applications is running. And the application loads it and calls its functions like if it were a native plug-in. On the other computer there's a stub instead of the real application, which loads the native plug-in. Now I need to organize RPCs between my stubs over the network, regardless the very transport. Usually, it's not difficult. But there're some restrictions: Application-plug-in interaction can be reenterable (e.g. application calls f1() from plug-in, in f1() plug-in calls g1() from application, in g1() application calls f2() from plug-in and so on...) Any such reenteration should be executed exactly by the same thread, which started the sequence Where can I find a cross-platform C++ RPC library with such features?

    Read the article

  • Findbugs and comparing

    - by Rob Goodwin
    I recently started using the findbugs static analysis tool in a java build I was doing. The first report came back with loads of High Priority warnings. Being the obsessive type of person, I was ready to go knock them all out. However, I must be missing something. I get most of the warnings when comparing things. Such as the following code: public void setSpacesPerLevel(int value) { if( value >= 0) { ... produces a high priority warning at the if statement that reads. File: Indenter.java, Line: 60, Type: BIT_AND_ZZ, Priority: High, Category: CORRECTNESS Check to see if ((...) & 0) == 0 in sample.Indenter.setSpacesPerLevel(int) I am comparing an int to an int, seems like a common thing. I get quite a few of that type of error with similar simple comparisons. I have alot of other high priority warnings on what appears to be simple code blocks. Am I missing something here? I realize that static analysis can produce false positives, but the errors I am seeing seem too trivial of a case to be a false positive. This one has me scratching my head as well. for(int spaces = 0;spaces < spacesPerLevel;spaces++){... Which gives the following findbugs warning: File: Indenter.java, Line: 160, Type: IL_INFINITE_LOOP, Priority: High, Category: CORRECTNESS There is an apparent infinite loop in sample.Indenter.indent() This loop doesn't seem to have a way to terminate (other than by perhaps throwing an exception). Any ideas? So basically I have a handful of files and 50-60 high priority warnings similar to the ones above. I am using findbugs 1.3.9 and calling it from the findbugs ant task

    Read the article

  • is it possible to write a program which prints its own source code utilizing a "sequence-generating-

    - by guest
    is it possible to write a program which prints its own source code utilizing a "sequence-generating-function"? what i call a sequence-generating-function is simply a function which returns a value out of a specific interval (i.e. printable ascii-charecters (32-126)). the point now is, that this generated sequence should be the programs own source-code. as you see, implementing a function which returns an arbitrary sequence is really trivial, but since the returned sequence must contain the implementation of the function itself it is a highly non-trivial task. this is how such a program (and its corresponding output) could look like #include <stdio.h> int fun(int x) { ins1; ins2; ins3; . . . return y; } int main(void) { int i; for ( i=0; i<size of the program; i++ ) { printf("%c", fun(i)); } return 0; } i personally think it is not possible, but since i don't know very much about the underlying matter i posted my thoughts here. i'm really looking forward to hear some opinions!

    Read the article

  • What's the most efficient way to load data from a file to a collection on-demand?

    - by Dan
    I'm working on a java project that will allows users to parse multiple files with potentially thousands of lines. The information parsed will be stored in different objects, which then will be added to a collection. Since the GUI won't require to load ALL these objects at once and keep them in memory, I'm looking for an efficient way to load/unload data from files, so that data is only loaded into the collection when a user requests it. I'm just evaluation options right now. I've also thought of the case where, after loading a subset of the data into the collection, and presenting it on the GUI, the best way to reload the previously observed data. Re-run the parser/Populate collection/Populate GUI? or probably find a way to keep the collection into memory, or serialize/deserialize the collection itself? I know that loading/unloading subsets of data can get tricky if some sort of data filtering is performed. Let's say that I filter on ID, so my new subset will contain data from two previous analyzed subsets. This would be no problem is I keep a master copy of the whole data in memory. I've read that google-collections are good and efficient when handling big amounts of data, and offer methods that simplify lots of things so this might offer an alternative to allow me to keep the collection in memory. This is just general talking. The question on what collection to use is a separate and complex thing. Do you know what's the general recommendation on this type of task? I'd like to hear what you've done with similar scenarios. I can provide more specifics if needed.

    Read the article

  • SQL problem - select accross multiple tables (user groups)

    - by morpheous
    I have a db schema which looks something like this: create table user (id int, name varchar(32)); create table group (id int, name varchar(32)); create table group_member (foobar_id int, user_id int, flag int); I want to write a query that allows me to so the following: Given a valid user id (UID), fetch the ids of all users that are in the same group as the specified user id (UID) AND have group_member.flag=3. Rather than just have the SQL. I want to learn how to think like a Db programmer. As a coder, SQL is my weakest link (since I am far more comfortable with imperative languages than declarative ones) - but I want to change that. Anyway here are the steps I have identified as necessary to break down the task. I would be grateful if some SQL guru can demonstrate the simple SQL statements - i.e. atomic SQL statements, one for each of the identified subtasks below, and then finally, how I can combine those statements to make the ONE statement that implements the required functionality. Here goes (assume specified user_id [UID] = 1): //Subtask #1. Fetch list of all groups of which I am a member Select group.id from user inner join group_member where user.id=group_member.user_id and user.id=1 //Subtask #2 Fetch a list of all members who are members of the groups I am a member of (i.e. groups in subtask #1) Not sure about this ... select user.id from user, group_member gm1, group_member gm2, ... [Stuck] //Subtask #3 Get list of users that satisfy criteria group_member.flag=3 Select user.id from user inner join group_member where user.id=group_member.user_id and user.id=1 and group_member.flag=3 Once I have the SQL for subtask2, I'd then like to see how the complete SQL statement is built from these subtasks (you dont have to use the SQL in the subtask, it just a way of explaining the steps involved - also, my SQL may be incorrect/inefficient, if so, please feel free to correct it, and point out what was wrong with it). Thanks

    Read the article

  • Migrate Data and Schema from MySQL to SQL Server

    - by colithium
    Are there any free solutions for automatically migrating a database from MySQL to SQL Server Server that "just works"? I've been attempting this simple (at least I thought so) task all day now. I've tried: SQL Server Management Studio's Import Data feature Create an empty database Tasks - Import Data... .NET Framework Data Provider for Odbc Valid DSN (verified it connects) Copy data from one or more tables or views Check 1 VERY simple table Click Preview Get Error: The preview data could not be retrieved. ADDITIONAL INFORMATION: ERROR [42000] [MySQL][ODBC 5.1 Driver][mysqld-5.1.45-community]You have an error in your SQL syntax; check the manual that corresponds to your MySQL server version for the right syntax to use near '"table_name"' at line 1 (myodbc5.dll) A similar error occurs if I go through the rest of the wizard and perform the operation. The failed step is "Setting Source Connection" the error refers to retrieving column information and then lists the above error. It can retrieve column information just fine when I modify column mappings so I really don't know what the issue is. I've also tried getting various MySql tools to output ddl statements that SQL Server understand but haven't succeeded. I've tried with MySQL v5.1.11 to SQL Server 2005 and with MySQL v5.1.45 to SQL Server 2008 (with ODBC drivers 3.51.27.00 and 5.01.06.00 respectively)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • Oracle 10.1 and 11.2 produce different XML using the same statement

    - by MindFyer
    I am migrating a database from Oracle 10.1 to 11.2 and I have the following problem. The statement SELECT '<?xml version="1.0" encoding="utf-8" ?>' || (Xml).getClobVal() AS XmlClob FROM ( SELECT XmlElement( "Element1", ( SELECT XmlAgg(tpx.Xml) FROM ( SELECT XmlElement("Element3",XmlForest('content' as Element4)) AS Xml FROM dual ) tpx ) AS "Element2" ) AS Xml FROM dual ) On the original 10.1 database produces XML like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element2> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element2> </Element1> On the new 11.2 system it looks like this... <?xml version="1.0" encoding="utf-8"?> <Element1> <Element3> <ELEMENT4>content</ELEMENT4> </Element3> </Element1> Is there some environmental variable I am missing that tells Oracle how to format its XML. There are hundreds of thousands of lines of PL/SQL in the database; it would be a mammoth task to rewrite if it turned out they had changed they way Oracle formats XML between versions. Hopefully someone has come accross this before. Thanks

    Read the article

  • How to reference var from frame on timeline in an object class

    - by brybam
    I'm using Flash Professional cs5/AS3 I'll try and describe this the best I can. I'm new to ActionScript. So, in my timeline I have a var on a frame that represents "lives" and i have some code in the timeline that takes down the number of lives depending on certain events, which all works great. so, now i wanted to make a constructor class that I could reuse for a bunch of movie clip objects and I only want these objects to be able to move if the lives variable is greater than certain number. So now, building my constructor class for these objects i just wanted put an if statement that is looking to see if the lives are greater than a certain number, which if it is then should make these objects do what i want...But, when i run the project I get "1120: Access of undefined property lives." lives is the var I made obviously like I said, and it works fine being referenced everyone else except when I make a new .as file for these objects then try and reference it. I get the same error when I try and establish "lives" in the main project class too. I'm not sure where I should put this var or how I can make it so i can reference it from an object class. I'm not really sure how to word or describe my issue which has made it hard to search for a tutorial. Any suggestions i'm sure this has to be a simple task.

    Read the article

  • PendingIntent in Widget + TaskKiller

    - by YaW
    Hi, I've developed an Application (called Instant Buttons) and the app has a widget feature. This widget uses PendingIntent for the onClick of the widget. My PendingIntent code is something like this: Intent active = new Intent(context, InstantWidget.class); active.setAction(String.valueOf(appWidgetId)); active.putExtra("blabla", blabla); //Some data PendingIntent actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); actionPendingIntent.cancel(); actionPendingIntent = PendingIntent.getBroadcast(context, 0, active, 0); remoteViews.setOnClickPendingIntent(R.id.button, actionPendingIntent); The onReceive gets the intent and do some stuff with the MediaPlayer class to reproduce a sound. I have reports from some users that the widgets stop working after a while and with some research i've discovered is because the Task Killers. It seems that when you kill the app in the TaskKiller, the PendingIntent is erased from memory, so when you click the widget, it doesn't know what to do. Is there any solution for this? Is my code wrong or something or it's the default behavior of the PendingIntent? Is there something I can use to avoid the TaskKiller to stop my widgets from working?? Greetings.

    Read the article

  • Is ther a Designer for MFC in Visual Studio like for windows forms in .NET?

    - by claws
    Hello, I'm a .NET programmer. I've never developed anything in MFC. Currently I had to write a C++ application (console) for some image processing task. I finished writing it. But the point is I need to design GUI also for this. Well, there won't be anything complex. Just a window with few Buttons, RadioButtons, Check Boxes, PicturesBox & few sliders. thats it. I'm using VS 2008 and was expecting a .NET style form designer. Just to test, I created a MFC project (with all default configuration) and these files were created by default: ChildFrm.cpp MainFrm.cpp mfc.cpp mfcDoc.cpp mfcView.cpp stdafx.cpp Now, I'm unable to find a Designer. There is no View Designer. I've opened all the above *.cpp and in the code editor right clicked to see "Designer View". ToolBox is just empty because I'm in code editor mode. When I built the project. This is the window I get. How to open a designer?

    Read the article

  • How can I call `update_attribute` for a list item in rails then actually update the html using jquery?

    - by Patrick Connor
    I want my users to be able to mark one or more items from an index view as "Active" or "Inactive" using a link. The text for the link should be state aware - so it might default to "Mark as Active" if the corresponding attribute was false or null, and "Mark as Inactive" if true. Once the user clicks the link and the attribute is updated in the controller, the link-text should update based on the new state. I am WAY off here, but this is a small sample of the code I have been trying... CONTROLLER ... respond_to :html, :js ... def update @item = Item.find(params[:id]) if @item.update_attributes(params[:item]) #Not sure of how to respond to .js here end end ... update.js.erb #how do I identify which element to update? $('#item[13456]').html("State aware text for link_to") VIEW - for item in @items = item.name = link_to "Mark as Active", item_path(item), :method => :put, :remote => true. :id => "item[#{item.id}]" I am happy to read any APIs, blogs, tutorials, etc. I just can't seem to get my hands/mind around this task. Any help or guidance is greatly appreciated!

    Read the article

  • Compromising design & code quality to integrate with existing modules

    - by filip-fku
    Greetings! I inherited a C#.NET application I have been extending and improving for a while now. Overall it was obviously a rush-job (or whoever wrote it was seemingly less competent than myself). The app pulls some data from an embedded device & displays and manipulates it. At the core is a communications thread in the main application form which executes a 600+ lines of code method which calls functions all over the place, implementing a state machine - lots of if-state-then-do type code. Interaction with the device is done by setting the state/mode globally and letting the thread do it's thing. (This is just one example of the badness of the code - overall it is not very OO-like, it reminds of the style of embedded C code the device firmware is written in). My problem is that this piece of code is central to the application. The software, communications protocol or device firmware are not documented at all. Obviously to carry on with my work I have to interact with this code. What I would like some guidance on, is whether it is worth scrapping this code & trying to piece together something more reasonable from the information I can reverse engineer? I can't decide! The reason I don't want to refactor is because the code already works, and changing it will surely be a long, laborious and unpleasant task. On the flip side, not refactoring means I have to sometimes compromise the design of other modules so that I may call my code from this state machine! I've heard of "If it ain't broke don't fix it!", so I am wondering if it should apply when "it" is influencing the design of future code! Any advice would be appreciated! Thanks!

    Read the article

  • Any Alternate way for writing to a file other than ofstream

    - by Aditya
    Hi All, I am performing file operations (writeToFile) which fetches the data from a xml and writes into a output file(a1.txt). I am using MS Visual C++ 2008 and in windows XP. currently i am using this method of writing to output file.. 01.ofstreamhdr OutputFile; 02./* few other stmts / 03.hdrOutputFile.open(fileName, std::ios::out); 04. 05.hdrOutputFile << "#include \"commondata.h\""<< endl ; 06.hdrOutputFile << "#include \"Commonconfig.h\"" << endl ; 07.hdrOutputFile << "#include \"commontable.h\"" << endl << endl ; 08. hdrOutputFile << "#pragma pack(push,1)" << endl ; 09.hdrOutputFile << "typedef struct \n {" << endl ; 10./ simliar hdrOutputFiles statements... */.. I have around 250 lines to write.. Is any better way to perform this task. I want to reduce this hdrOutputFile and use a buffer to do this. Please guide me how to do that action. I mean, buff = "#include \"commontable.h\"" + "typedef struct \n {" + ....... hdrOutputFile << buff. is this way possible? Thanks Ramm

    Read the article

  • Replace without the replace function

    - by Molly Potter
    Assignment: Let X and Y be two words. Find/Replace is a common word processing operation that finds each occurrence of word X and replaces it with word Y in a given document. Your task is to write a program that performs the Find/Replace operation. Your program will prompt the user for the word to be replaced (X), then the substitute word (Y ). Assume that the input document is named input.txt. You must write the result of this Find/Replace operation to a file named output.txt. Lastly, you cannot use the replace() string function built into Python (it would make the assignment much too easy). To test your code, you should modify input.txt using a text editor such as Notepad or IDLE to contain different lines of text. Again, the output of your code must look exactly like the sample output. This is my code: input_data = open('input.txt','r') #this opens the file to read it. output_data = open('output.txt','w') #this opens a file to write to. userStr= (raw_input('Enter the word to be replaced:')) #this prompts the user for a word userReplace =(raw_input('What should I replace all occurences of ' + userStr + ' with?')) #this prompts the user for the replacement word for line in input_data: words = line.split() if userStr in words: output_data.write(line + userReplace) else: output_data.write(line) print 'All occurences of '+userStr+' in input.txt have been replaced by '+userReplace+' in output.txt' #this tells the user that we have replaced the words they gave us input_data.close() #this closes the documents we opened before output_data.close() It won't replace anything in the output file. Help!

    Read the article

  • Deployment a web-site on IIS from another program

    - by slo2ols
    Hi, I developed a web-site on ASP.NET 3.5 SP1 platform. And additional I have 2 win services. My task is to build install package. I decided that Visual Studio install projects are not met my requirements. I design my own installer for this project, because I need to resolve many question and problem in install process. My problem: I need to deploy web-site into IIS, but I don't know how to do it easy. I found Microsoft tool as Web Deployment Tool, but I didn't find any documentation. And must I include this tool into my installer for deployment at destination customer? Another side I found SDC Tasks Library and it looks like a solution for me. But I saw many topics where people had problems and because the project was dead anybody couldn't help them. I know it is a long story... My question: how can I deploy the web-site from another program (I know that IIS versions have some differences and it is another headache), set a virtual directory, application pool (very important), a type of authentification and so forth ??? Thanks.

    Read the article

  • MySQL query against pseudo-key-value pair data in WordPress custom query

    - by andrevr
    I'm writing a custom WordPress query to use some of the data which the Woothemes Diarise theme creates. Diarise is an event planner theme with calendar blah, blah... and uses custom fields to store the event start and end dates in WP custom fields in the *wp_postmeta* table, which implements a key-value store. So for each post in the "event" category, there are 2 records in *wp_postmeta*, named *event_start_date* and *event_end_date* that I'm interested in. The task is to compare a tourist's arrival and departure dates with the start and end dates of events, yielding a what's on list of events available. We thought we'd killed it with a grand flash of logic, that goes like this: Disregard any event that ends before the tourist arrives, and any that begin after the departure date. I wrote this query: SELECT wposts.* FROM wp_posts wposts LEFT JOIN wp_postmeta wpostmeta ON wposts.ID = wpostmeta.post_id LEFT JOIN wp_term_relationships ON (wposts.ID = wp_term_relationships.object_id) LEFT JOIN wp_term_taxonomy ON (wp_term_relationships.term_taxonomy_id = wp_term_taxonomy.term_taxonomy_id) WHERE wp_term_taxonomy.taxonomy = 'category' AND wp_term_taxonomy.term_id IN(3,4) AND ( wpostmeta.meta_key = 'event_start_date' AND NOT ( concat(subst(wpostmeta.meta_value,7,4),'-',subst(wpostmeta.meta_value,4,2),'-',subst(wpostmeta.meta_value,1,2) > '2010-07-31' ) ) AND ( wpostmeta.meta_key = 'event_end_date' AND NOT ( concat(subst(wpostmeta.meta_value,7,4),'-',subst(wpostmeta.meta_value,4,2),'-',subst(wpostmeta.meta_value,1,2) < '2010-05-01' ) ) ) ORDER BY wpostmeta.meta_value ASC And, of course it returns no records. The problem I believe is in the dual reference to wpostmeta.meta_key, but how to get around that?

    Read the article

  • I want tell the VC++ Compiler to compile all code. Can it be done?

    - by KGB
    I am using VS2005 VC++ for unmanaged C++. I have VSTS and am trying to use the code coverage tool to accomplish two things with regards to unit tests: See how much of my referenced code under test is getting executed See how many methods of my code under test (if any) are not unit tested at all Setting up the VSTS code coverage tool (see the link text) and accomplishing task #1 was straightforward. However #2 has been a surprising challenge for me. Here is my test code. class CodeCoverageTarget { public: std::string ThisMethodRuns() { return "Running"; } std::string ThisMethodDoesNotRun() { return "Not Running"; } }; #include <iostream> #include "CodeCoverageTarget.h" using namespace std; int main() { CodeCoverageTarget cct; cout<<cct.ThisMethodRuns()<<endl; } When both methods are defined within the class as above the compiler automatically eliminates the ThisMethodDoesNotRun() from the obj file. If I move it's definition outside the class then it is included in the obj file and the code coverage tool shows it has not been exercised at all. Under most circumstances I want the compiler to do this elimination for me but for the code coverage tool it defeats a significant portion of the value (e.g. finding untested methods). I have tried a number of things to tell the compiler to stop being smart for me and compile everything but I am stumped. It would be nice if the code coverage tool compensated for this (I suppose by scanning the source and matching it up with the linker output) but I didn't find anything to suggest it has a special mode to be turned on. Am I totally missing something simple here or is this not possible with the VC++ compiler + VSTS code coverage tool? Thanks in advance, KGB

    Read the article

  • How to deploy to multiple redundant production servers with "cap deploy"?

    - by Chad Johnson
    Capistrano is working great to deploy to a single server. However, I have multiple production API servers for my web application. When I deploy, my code needs to get deployed to every API server at once. Specifying each server manually is NOT the solution I am looking for (e.g. I don't want to do "cap api1 deploy; cap api2 deploy"). Is there a way, using Capistrano, to deploy to all servers at once, with just a simple "cap deploy"? I'm wondering what changes I would need to make to a typical deploy.rb file, whether I'd need to create a separate file for each server, and whether and how the Capfile would need to be changed. Also, I need to be able to specify a different deploy_to path for each server. And ideally, I wouldn't have to repeat things in different config files for different servers (eg. wouldn't have to specify :repository, :application, etc. multiple times). I have spent hours searching Google on this and looking through tutorials, but I have found nothing helpful. Here is a snippet from my current deploy.rb file: set :application, "testapplication" set :repository, "ssh://domain.com//srv/hg/#{application}" set :scm, :mercurial set :deploy_to, "/srv/www/#{application}" role :web, "domain.com" role :app, "domain.com" role :db, "domain.com", :primary => true, :norelease => true Should I just use the multistage extension and do this? task :deploy_everything do system "cap api1 deploy" system "cap api2 deploy" system "cap api2 deploy" end That could work, but I feel like this isn't what this extension is meant for...

    Read the article

< Previous Page | 376 377 378 379 380 381 382 383 384 385 386 387  | Next Page >