Search Results

Search found 11025 results on 441 pages for 'f4r 20'.

Page 388/441 | < Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >

  • Sitecore E-Commerce Module - Discount/Promotional Codes

    - by Zachary Kniebel
    I am working on a project for which I must use Sitecore's E-Commerce Module (and Sitecore 6.5 rev. 120706 - aka 'Update 5') to create a web-store. One of the features that I am trying to implement is a generic promotional/discount code system - customer enters a code at checkout which grants a discount like 'free shipping', '20% off', etc. At the moment, I am looking for some guidance (a high-level solution, a few pseudo-ideas, some references to review, etc) as to how this can be accomplished. Summary: What I am looking for is a way to detect whether or not the user entered a promo code at a previous stage in the checkout line, and to determine what that promo code is, if they did. Progress Thus Far: I have thoroughly reviewed all of the Sitecore E-Commerce Services (SES) documentation, especially "SES Order Line Extension" documentation (which I believe will have to be modified/extended in order to accomplish this task). Additionally, I have thoroughly reviewed the Sitecore Community article Extending Sitecore E-Commerce - Pricing and believe that it may be a useful guide for applying a discount statically, but does not say much in the way of applying a discount dynamically. After reviewing these documents, I have come up with the following possible high-level solution to start from: I create a template to represent a promotional code, which holds all data relevant to the promotion (percent off, free shipping, code, etc). I then create another template (based on the Product Search Group template) that holds a link to an item within a global "Promotional Code" items folder. Next, I use the Product Search Group features of my new template to choose which products to apply the discount to. In the source code for the checkout I create a class that checks if a code has been entered and, if so, somehow carry it through the rest of the checkout process. This is where I get stuck. More Details: No using cookies No GET requests No changing/creating/deleting items in the Sitecore Database during the checkout process (e.g., no manipulation of fields of a discount item during checkout to signal that the discount has been applied) must stay within the scope of C# Last Notes: I will update this post with any more information that I find/progress that I make. I upgrade all answers that are relevant and detailed, thought-provoking, or otherwise useful to me and potentially useful to others, in addition to any high-level answers that serve as a feasible solution to this problem; even if your idea doesn't help me, if I think it will help someone else I will still upgrade it. Thanks, in advance, for all your help! :)

    Read the article

  • Converting C source to C++

    - by Barry Kelly
    How would you go about converting a reasonably large (300K), fairly mature C codebase to C++? The kind of C I have in mind is split into files roughly corresponding to modules (i.e. less granular than a typical OO class-based decomposition), using internal linkage in lieu private functions and data, and external linkage for public functions and data. Global variables are used extensively for communication between the modules. There is a very extensive integration test suite available, but no unit (i.e. module) level tests. I have in mind a general strategy: Compile everything in C++'s C subset and get that working. Convert modules into huge classes, so that all the cross-references are scoped by a class name, but leaving all functions and data as static members, and get that working. Convert huge classes into instances with appropriate constructors and initialized cross-references; replace static member accesses with indirect accesses as appropriate; and get that working. Now, approach the project as an ill-factored OO application, and write unit tests where dependencies are tractable, and decompose into separate classes where they are not; the goal here would be to move from one working program to another at each transformation. Obviously, this would be quite a bit of work. Are there any case studies / war stories out there on this kind of translation? Alternative strategies? Other useful advice? Note 1: the program is a compiler, and probably millions of other programs rely on its behaviour not changing, so wholesale rewriting is pretty much not an option. Note 2: the source is nearly 20 years old, and has perhaps 30% code churn (lines modified + added / previous total lines) per year. It is heavily maintained and extended, in other words. Thus, one of the goals would be to increase mantainability. [For the sake of the question, assume that translation into C++ is mandatory, and that leaving it in C is not an option. The point of adding this condition is to weed out the "leave it in C" answers.]

    Read the article

  • Alter highchart output to display start - end date

    - by php_d
    I currently have the following highchart which display a start date and outputs the values for the next 31 days of data. Does anyone know how I may improve on this to include and end date so that I can filter the data by smaller specific amounts? On the x-axis I am also trying to only display labels that have data attached to them and hide any others. Any help is appreciated. My code is as follows: <script type="text/javascript"> var chart; $(document).ready(function() { chart = new Highcharts.Chart({ chart: { renderTo: 'container', type: 'line', marginRight: 130, marginBottom: 25 }, title: { text: '<?php echo $type ?>', x: -20 //center }, xAxis: { categories: [ <?php $start = $_POST["dateStart"]; $dates = array(); for ($i = 0, $days = date('t', strtotime($start)); $i < $days; ++$i) { $dates[] = date('Y-m-d', strtotime($start . ' + ' . $i . ' day')); } echo "'" . implode("', '", $dates) . "'"; ?> ] }, yAxis: { title: { text: 'Total Amount' }, plotLines: [{ value: 0, width: 1, color: '#808080' }] }, tooltip: { formatter: function() { return '<b>'+ this.series.name +'</b><br/>'+ this.x +': '+ this.y; } }, legend: { layout: 'vertical', align: 'right', verticalAlign: 'top', x: -10, y: 100, borderWidth: 0 }, series: [ <?php foreach ($array as $legend => $data) { echo '{'; echo "name: '" . $legend . "',"; $values = array(); for ($i = 0; $i < $days; ++$i) { $date = date('Y-m-d', strtotime($start . ' + ' . $i . ' day')); $values[] = isset($data[$date]) ? $data[$date] : 0; } echo 'data: [' . implode(', ', $values) . '],'; echo '},'; } ?> ] }); }); Thanks

    Read the article

  • div popup inside td

    - by sims
    I have a table with a bunch of cells. (No way! Amazing! :P) Some of the cells have a small div that when you put your mouse over, it gets bigger so you can read all the text. This works well and all. However, since html elements that come later in the document have a higher z-index, when the div gets bigger it is underneath the other divs in the other cells. Some html code: <table> <tr> <td> limited info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> informative long text is here </div> </div> </td> <td> some short info <div style="position: relative;"> <div style="position: absolute; top: 0; left: 0; width: 1em; height: 1em;" onmouseover="tooltipshow(this)" onmouseout="tooltiphide(this)"> longer explanation about what is really going on that covers the div up there ^^^. darn! </div> </div> </td> </tr> </table> Some js code: function tooltipshow(obj) { obj.style.width = '30em'; obj.style.zIndex = '100'; } function tooltiphide(obj) { obj.style.width = '1em'; obj.style.zIndex = '20'; } It doesn't matter if I set z-index dynamically to something higher onmouseover. It's like z-index has no affect. I think it has something to do with the table. I've tested this in FF3. When I'm feeling particularly macho, I'll test it in IE.

    Read the article

  • Supporting multiple instances of a plugin DLL with global data

    - by Bruno De Fraine
    Context: I converted a legacy standalone engine into a plugin component for a composition tool. Technically, this means that I compiled the engine code base to a C DLL which I invoke from a .NET wrapper using P/Invoke; the wrapper implements an interface defined by the composition tool. This works quite well, but now I receive the request to load multiple instances of the engine, for different projects. Since the engine keeps the project data in a set of global variables, and since the DLL with the engine code base is loaded only once, loading multiple projects means that the project data is overwritten. I can see a number of solutions, but they all have some disadvantages: You can create multiple DLLs with the same code, which are seen as different DLLs by Windows, so their code is not shared. Probably this already works if you have multiple copies of the engine DLL with different names. However, the engine is invoked from the wrapper using DllImport attributes and I think the name of the engine DLL needs to be known when compiling the wrapper. Obviously, if I have to compile different versions of the wrapper for each project, this is quite cumbersome. The engine could run as a separate process. This means that the wrapper would launch a separate process for the engine when it loads a project, and it would use some form of IPC to communicate with this process. While this is a relatively clean solution, it requires some effort to get working, I don't now which IPC technology would be best to set-up this kind of construction. There may also be a significant overhead of the communication: the engine needs to frequently exchange arrays of floating-point numbers. The engine could be adapted to support multiple projects. This means that the global variables should be put into a project structure, and every reference to the globals should be converted to a corresponding reference that is relative to a particular project. There are about 20-30 global variables, but as you can imagine, these global variables are referenced from all over the code base, so this conversion would need to be done in some automatic manner. A related problem is that you should be able to reference the "current" project structure in all places, but passing this along as an extra argument in each and every function signature is also cumbersome. Does there exist a technique (in C) to consider the current call stack and find the nearest enclosing instance of a relevant data value there? Can the stackoverflow community give some advice on these (or other) solutions?

    Read the article

  • If conditon showing alert even when the condition is false

    - by Adrian
    I have problem with if condition. I write a script who should showing alert when value from field #customer-age is less than 21 (the calculated age of person). The problem is - the alert is showing every time - when the value is less and greater than 21. My html code is: <div class="type-text"> <label for="birthday">Date1:</label> <input type="text" size="20" id="birthday" name="birthday" value="" readonly="readonly" /> </div> <div class="type-text"> <span id="customer-age" readonly="readonly"></span> </div> <span id="date_from_start">23/11/2012</span> and script looks like: function getAge() { var sday = $('#date_from_start').html(); var split_date1 = sday.split("/"); var todayDate = new Date(split_date1[2],split_date1[1] - 1,split_date1[0]); var bday = $('#birthday').val(); var split_date2 = bday.split("/"); var birthDate = new Date(split_date2[2],split_date2[1] - 1,split_date2[0]); var age = todayDate.getFullYear() - birthDate.getFullYear(); var m = todayDate.getMonth() - birthDate.getMonth(); if (m < 0 || (m === 0 && todayDate.getDate() < birthDate.getDate())) { age--; } return age; } var startDate = new Date("1935,01,01"); $('#birthday').datepicker({ dateFormat: 'dd/mm/yy', dayNamesMin: ['Nie', 'Pon', 'Wt', 'Sr', 'Czw', 'Pt', 'Sob'], dayNames: ['Niedziela','Poniedzialek','Wtorek','Sroda','Czwartek','Piatek','Sobota'], monthNamesShort: ['Sty', 'Lut', 'Mar', 'Kwi', 'Maj', 'Cze', 'Lip', 'Sie', 'Wrz', 'Paz', 'Lis', 'Gru'], changeMonth: true, changeYear: true, numberOfMonths: 1, constrainInput: true, firstDay: 1, dateFormat: 'dd/mm/yy', yearRange: '-77:-18', defaultDate: startDate, onSelect: function(dateText, inst) { $('#customer-age').html(getAge(new Date(dateText))); var cage = $('#customer-age').val(); if (cage < 21) { alert('< 21 year'); } else { } }, maxDate: +0 }); The workin code you can check on http://jsfiddle.net/amarcinkowski/DmYBt/

    Read the article

  • XML pass values to timer, AS3

    - by VideoDnd
    My timer has three variables that I can trace to the output window, but don't know how to pass them to the timer. How to I pass the XML values to my timer? Purpose I want to test with an XML document, before I try connecting it to an XML socket. myXML <?xml version="1.0" encoding="utf-8"?> <SESSION> <TIMER TITLE="speed">100</TIMER> <COUNT TITLE="starting position">-77777</COUNT> <FCOUNT TITLE="ramp">1000</FCOUNT> </SESSION> myFlash //myTimer 'instance of mytext on stage' /* fields I want to change with XML */ //CHANGE TO 100 var timer:Timer = new Timer(10); //CHANGE TO -77777 var count:int = 0; //CHANGE TO 1000 var fcount:int = 0; timer.addEventListener(TimerEvent.TIMER, incrementCounter); timer.start(); function incrementCounter(event:TimerEvent) { count++; fcount=int(count*count/1000);//starts out slow... then speeds up mytext.text = formatCount(fcount); } function formatCount(i:int):String { var fraction:int = i % 100; var whole:int = i / 100; return ("0000000" + whole).substr(-7, 7) + "." + (fraction < 10 ? "0" + fraction : fraction); } //LOAD XML var myXML:XML; var myLoader:URLLoader = new URLLoader(); myLoader.load(new URLRequest("time.xml")); myLoader.addEventListener(Event.COMPLETE, processXML); //PARSE XML function processXML(e:Event):void { myXML = new XML(e.target.data); trace(myXML.ROGUE.*); trace(myXML); //TEXT var text:TextField = new TextField(); text.text = myXML.TIMER.*; text.textColor = 0xFF0000; addChild(text); } RESOURCES OReilly's ActionScript 3.0 Cookbook, Chapter 12 Strings, Chapter 20 XML

    Read the article

  • WPF - Two way binding use a user control...binding to object, not an element!

    - by Scott
    I created an object with a simple property with a default value. I then created a user control that has a text box in it. I set the datacontext of the user control to the object. The text box correctly shows the properties default value but I can't seem to update the property value when the user changes the text box value. I created a simple project to illustrate my code. Thanks for the help!! public partial class UserControl1 : UserControl { public UserControl1() { InitializeComponent(); } private string _titleValue; public string TitleValue { get { return _titleValue; } set { _titleValue = value; textBox1.Text = _titleValue; } } public static readonly DependencyProperty TitleValueProperty = DependencyProperty.Register( "TitleValue", typeof(string), typeof(UserControl1), new FrameworkPropertyMetadata(new PropertyChangedCallback(titleUpdated)) ); //Don't think I should need to do this!!! private static void titleUpdated(DependencyObject d, DependencyPropertyChangedEventArgs e) { ((UserControl1)d).TitleValue = (string)e.NewValue; } } <UserControl x:Class="WpfApplication1.UserControl1" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" xmlns:mc="http://schemas.openxmlformats.org/markup-compatibility/2006" xmlns:d="http://schemas.microsoft.com/expression/blend/2008" mc:Ignorable="d" d:DesignHeight="300" d:DesignWidth="300"> <Grid> <TextBox Height="23" HorizontalAlignment="Left" Margin="94,97,0,0" Name="textBox1" VerticalAlignment="Top" Width="120" Text="{Binding Path=TitleValue, Mode=TwoWay}"/> </Grid> </UserControl> public partial class MainWindow : Window { public MainWindow() { InitializeComponent(); var dummy = new DummyObject("This is my title."); userControl11.DataContext = dummy; } private void button1_Click(object sender, RoutedEventArgs e) { MessageBox.Show("The value is: " + ((DummyObject)userControl11.DataContext).Title); } } <Window x:Class="WpfApplication1.MainWindow" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" Title="MainWindow" Height="350" Width="525" xmlns:my="clr-namespace:WpfApplication1"> <Grid> <my:UserControl1 HorizontalAlignment="Left" Margin="95,44,0,0" x:Name="userControl11" VerticalAlignment="Top" Height="191" Width="293" TitleValue="{Binding Path=Title, Mode=TwoWay}"/> <Button Content="Check Value" Height="23" HorizontalAlignment="Left" Margin="20,12,0,0" Name="button1" VerticalAlignment="Top" Width="75" Click="button1_Click" /> </Grid> </Window>

    Read the article

  • Why do sockets not die when server dies? Why does a socket die when server is alive?

    - by Roman
    I try to play with sockets a bit. For that I wrote very simple "client" and "server" applications. Client: import java.net.*; public class client { public static void main(String[] args) throws Exception { InetAddress localhost = InetAddress.getLocalHost(); System.out.println("before"); Socket clientSideSocket = null; try { clientSideSocket = new Socket(localhost,12345,localhost,54321); } catch (ConnectException e) { System.out.println("Connection Refused"); } System.out.println("after"); if (clientSideSocket != null) { clientSideSocket.close(); } } } Server: import java.net.*; public class server { public static void main(String[] args) throws Exception { ServerSocket listener = new ServerSocket(12345); while (true) { Socket serverSideSocket = listener.accept(); System.out.println("A client-request is accepted."); } } } And I found a behavior that I cannot explain: I start a server, than I start a client. Connection is successfully established (client stops running and server is running). Then I close the server and start it again in a second. After that I start a client and it writes "Connection Refused". It seems to me that the server "remember" the old connection and does not want to open the second connection twice. But I do not understand how it is possible. Because I killed the previous server and started a new one! I do not start the server immediately after the previous one was killed (I wait like 20 seconds). In this case the server "forget" the socket from the previous server and accepts the request from the client. I start the server and then I start the client. Connection is established (server writes: "A client-request is accepted"). Then I wait a minute and start the client again. And server (which was running the whole time) accept the request again! Why? The server should not accept the request from the same client-IP and client-port but it does!

    Read the article

  • What (tf) are the secrets behind PDF memory allocation (CGPDFDocumentRef)

    - by Kai
    For a PDF reader I want to prepare a document by taking 'screenshots' of each page and save them to disc. First approach is CGPDFDocumentRef document = CGPDFDocumentCreateWithURL((CFURLRef) someURL); for (int i = 1; i<=pageCount; i++) { NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; CGPDFPageRef page = CGPDFDocumentGetPage(document, i); ...//getting + manipulating graphics context etc. ... CGContextDrawPDFPage(context, page); ... UIImage *resultingImage = UIGraphicsGetImageFromCurrentImageContext(); ...//saving the image to disc [pool drain]; } CGPDFDocumentRelease(document); This results in a lot of memory which seems not to be released after the first run of the loop (preparing the 1st document), but no more unreleased memory in additional runs: MEMORY BEFORE: 6 MB MEMORY DURING 1ST DOC: 40 MB MEMORY AFTER 1ST DOC: 25 MB MEMORY DURING 2ND DOC: 40 MB MEMORY AFTER 2ND DOC: 25 MB .... Changing the code to for (int i = 1; i<=pageCount; i++) { CGPDFDocumentRef document = CGPDFDocumentCreateWithURL((CFURLRef) someURL); NSAutoreleasePool *pool = [[NSAutoreleasePool alloc]init]; CGPDFPageRef page = CGPDFDocumentGetPage(document, i); ...//getting + manipulating graphics context etc. ... CGContextDrawPDFPage(context, page); ... UIImage *resultingImage = UIGraphicsGetImageFromCurrentImageContext(); ...//saving the image to disc CGPDFDocumentRelease(document); [pool drain]; } changes the memory usage to MEMORY BEFORE: 6 MB MEMORY DURING 1ST DOC: 9 MB MEMORY AFTER 1ST DOC: 7 MB MEMORY DURING 2ND DOC: 9 MB MEMORY AFTER 2ND DOC: 7 MB .... but is obviously a step backwards in performance. When I start reading a PDF (later in time, different thread) in the first case no more memory is allocated (staying at 25 MB), while in the second case memory goes up to 20 MB (from 7). In both cases, when I remove the CGContextDrawPDFPage(context, page); line memory is (nearly) constant at 6 MB during and after all preparations of documents. Can anybody explain whats going on there?

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • How to prevent google chrome from caching my inputs, esp hidden ones when user click back?

    - by melaos
    hi there, i have an asp.net mvc app which have quite a few hidden inputs to keep values around and formatting their names so that i can use the Model binding later when i submit the form. i stumble into a weird bug with chrome which i don't have with IE or Firefox when the user submits the form and click on the back button, i find that chrome will keep my hidden input values as well. this whole chunk is generated via javascript hence i believe chrome is caching this. function addProductRow(productId, productName) { if (productName != "") { //use guid to ensure that the row never repeats var guid = $.Guid.New(); var temp = parseFloat($(".tboProductCount").val()); //need the span to workaround for chrome var szHTML = "<tr valign=\"top\" id=\"productRow\"><td class=\"productIdCol\"><input type=\"hidden\" id=productRegsID" + temp + "\" name=\"productRegs[" + temp + "].productId\" value=\"" + productId + "\"/>" + "<span id=\"spanProdID" + temp + "\" name=\"spanProdID" + temp + "\" >" + productId + "</span>" + "</td>" //+ "<td><input type=\"text\" id=\"productRegName\" name=\"productRegs[" + temp + "].productName\" value=\"" + productName + "\" class=\"productRegName\" size=\"50\" readonly=\"readonly\"/></td>" + "<td><span id=\"productRegName\" name=\"productRegs[" + temp + "].productName\" class=\"productRegName\">"+ productName + "<\span></td>" + "<td id=\"" + guid + "\" class=\"productrowguid\" \>" + "<input type=\"text\" size=\"20\" id=\"productSerialNo" + temp + "\" name=\"productRegs[" + temp + "].serialNo\" value=\"" + "\" class=\"productSerialNo\" maxlength=\"18\" />" + "<a class=\"fancybox\" id=\"btnImgSerialNo" + temp + "\" href=\"#divSerialNo" + temp + "\"><img class=\"btnImgSerialNo\" src=\"Images/landing_14.gif\" /></a>" + "<span id=\"snFlag" + temp + "\" class=\"redWarning\"></span></td>" + "<td><input type=\"text\" id=\"productRegDate" + temp + "\" name=\"productRegs[" + temp + "].PurchaseDate\" readonly=\"readonly\" />" + "<span id=\"snRegDate" + temp + "\" class=\"redWarning\"></span></td>" + "<td align=\"center\"><img style=\"cursor:pointer\" id=\"btnImgDelete\" src=\"Images/btn_remove.gif\" onclick=\"javascript:removeProductRow('" + guid + "')\" /><div style=\"display:none;\"><div id=\"divSerialNo" + temp + "\" style=\"font-family:verdana;font-size:11px;width:600px\">" + serialnumbergeneral + "<br /><br />" + getSNImageByCategory(productId) + "</div></div></td>" + "</tr>"; $(".ProductRegistrationTable").append(szHTML); $("a.fancybox").fancybox(); //initialization $("#productRegDate" + temp).datepicker({ minDate: new Date(1996, 1 - 1, 1), maxDate: 0 }); //sanity check //s7test alert('1 '+$("#spanProdID" + temp)); alert('2 '+$("#productRegsID" + temp)); } //end function addNewProductRow i need the id to be refreshed when the user select a new product, but putting another span tag beside it shows that the span will have the new id will the hidden input will still have the previous id. is there an elegant way to workaround this issue? thanks

    Read the article

  • vector related memory allocation question

    - by memC
    hi all, I am encountering the following bug. I have a class Foo . Instances of this class are stored in a std::vector vec of class B. in class Foo, I am creating an instance of class A by allocating memory using new and deleting that object in ~Foo(). the code compiles, but I get a crash at the runtime. If I disable delete my_a from desstructor of class Foo. The code runs fine (but there is going to be a memory leak). Could someone please explain what is going wrong here and suggest a fix? thank you! class A{ public: A(int val); ~A(){}; int val_a; }; A::A(int val){ val_a = val; }; class Foo { public: Foo(); ~Foo(); void createA(); A* my_a; }; Foo::Foo(){ createA(); }; void Foo::createA(){ my_a = new A(20); }; Foo::~Foo(){ delete my_a; }; class B { public: vector<Foo> vec; void createFoo(); B(){}; ~B(){}; }; void B::createFoo(){ vec.push_back(Foo()); }; int main(){ B b; int i =0; for (i = 0; i < 5; i ++){ std::cout<<"\n creating Foo"; b.createFoo(); std::cout<<"\n Foo created"; } std::cout<<"\nDone with Foo creation"; std::cout << "\nPress RETURN to continue..."; std::cin.get(); return 0; }

    Read the article

  • banner rotator advertising with probability

    - by cosy
    I have banners advertising with number of views, like CPM system. And for example : i have 3 banner: banner1 with 20.000 nr of views banner2 with 10.000 nr of views banner3 with 5.000 nr of views and on my website the banner must to appear in this position (when the page is reloaded) : banner1 banner2 banner1 banner2 banner3 if the number of views is higher then the probability of apparition is higher how can i do this in php? Thanks a lot for helping :)

    Read the article

  • Is a many-to-many relationship with extra fields the right tool for my job?

    - by whichhand
    Previously had a go at asking a more specific version of this question, but had trouble articulating what my question was. On reflection that made me doubt if my chosen solution was correct for the problem, so this time I will explain the problem and ask if a) I am on the right track and b) if there is a way around my current brick wall. I am currently building a web interface to enable an existing database to be interrogated by (a small number of) users. Sticking with the analogy from the docs, I have models that look something like this: class Musician(models.Model): first_name = models.CharField(max_length=50) last_name = models.CharField(max_length=50) dob = models.DateField() class Album(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) class Instrument(models.Model): artist = models.ForeignKey(Musician) name = models.CharField(max_length=100) Where I have one central table (Musician) and several tables of associated data that are related by either ForeignKey or OneToOneFields. Users interact with the database by creating filtering criteria to select a subset of Musicians based on data the data on the main or related tables. Likewise, the users can then select what piece of data is used to rank results that are presented to them. The results are then viewed initially as a 2 dimensional table with a single row per Musician with selected data fields (or aggregates) in each column. To give you some idea of scale, the database has ~5,000 Musicians with around 20 fields of related data. Up to here is fine and I have a working implementation. However, it is important that I have the ability for a given user to upload there own annotation data sets (more than one) and then filter and order on these in the same way they can with the existing data. The way I had tried to do this was to add the models: class UserDataSets(models.Model): user = models.ForeignKey(User) name = models.CharField(max_length=100) description = models.CharField(max_length=64) results = models.ManyToManyField(Musician, through='UserData') class UserData(models.Model): artist = models.ForeignKey(Musician) dataset = models.ForeignKey(UserDataSets) score = models.IntegerField() class Meta: unique_together = (("artist", "dataset"),) I have a simple upload mechanism enabling users to upload a data set file that consists of 1 to 1 relationship between a Musician and their "score". Within a given user dataset each artist will be unique, but different datasets are independent from each other and will often contain entries for the same musician. This worked fine for displaying the data, starting from a given artist I can do something like this: artist = Musician.objects.get(pk=1) dataset = UserDataSets.objects.get(pk=5) print artist.userdata_set.get(dataset=dataset.pk) However, this approach fell over when I came to implement the filtering and ordering of query set of musicians based on the data contained in a single user data set. For example, I could easily order the query set based on all of the data in the UserData table like this: artists = Musician.objects.all().order_by(userdata__score) But that does not help me order by the results of a given single user dataset. Likewise I need to be able to filter the query set based on the "scores" from different user data sets (eg find all musicians with a score 5 in dataset1 and < 2 in dataset2). Is there a way of doing this, or am I going about the whole thing wrong?

    Read the article

  • Accessing parent-level controls from inside a ComboBox's child controls

    - by eponymous23
    I have XAML similar to this: <ListBox ItemsSource="{Binding SearchCriteria, Source={StaticResource model}}" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ListBox.ItemTemplate> <DataTemplate> <StackPanel Name="spCriterion" Orientation="Horizontal" Height="20"> <ComboBox Name="cboSearchCriterionType" Width="120" SelectionChanged="cboSearchCriterionType_SelectionChanged"> <ComboBox.Items> <ComboBoxItem IsSelected="True" Content="Anagram Match" /> <ComboBoxItem Content="Pattern Match" /> <ComboBoxItem Content="Subanagram Match" /> <ComboBoxItem Content="Length" /> <ComboBoxItem Content="Number of Vowels" /> <ComboBoxItem Content="Number of Anagrams" /> <ComboBoxItem Content="Number of Unique Letters" /> </ComboBox.Items> </ComboBox> <TextBox x:Name="SearchSpec" Text="{Binding SearchSpec}" /> <TextBox x:Name="MinValue" Text="{Binding MinValue}" Visibility="Collapsed" /> <TextBox x:Name="MaxValue" Text="{Binding MaxValue}" Visibility="Collapsed" /> </StackPanel> </DataTemplate> </ListBox.ItemTemplate> As you can tell from the markup, I have a listbox that is bound to a collection of SearchCriterion objects (collectively contained in a SearchCriteria object). The idea is that the user can add/remove criterion items from the criteria, each criterion is represented by a listbox item. Inside the listbox item I have a combobox and three textboxes. What I'm trying to do is change the visibility of the TextBox controls depending on the item that is selected in the ComboBox. For example, if the user selects "Pattern Match" then I want to show only the first textbox and hide the latter two; conversely, if the user selects "Length" or any of the "Number of..." items, then I want to hide the first TextBox and show the latter two. What is the best way to achieve this? I was hoping to do something simple in the SelectionChanged event handler for the listbox but the textbox controls are presumably out of the SelectionChanged event's scope. Do I have to programmatically traverse the control hierarchy and find the controls?

    Read the article

  • BizTalk - generating schema from Oracle stored proc with table variable argument

    - by Ron Savage
    I'm trying to set up a simple example project in BizTalk that gets changes made to a table in a SQL Server db and updates a copy of that table in an Oracle db. On the SQL Server side, I have a stored proc named GetItemChanges() that returns a variable number of records. On the Oracle side, I have a stored proc named Update_Item_Region_Table() designed to take a table of records as a parameter so that it can process all the records returned from GetItemChanges() in one call. It is defined like this: create or replace type itemrec is OBJECT ( UPC VARCHAR2(15), REGION VARCHAR2(5), LONG_DESCRIPTION VARCHAR2(50), POS_DESCRIPTION VARCHAR2(30), POS_DEPT VARCHAR2(5), ITEM_SIZE VARCHAR2(10), ITEM_UOM VARCHAR2(5), BRAND VARCHAR2(10), ITEM_STATUS VARCHAR2(5), TIME_STAMP VARCHAR2(20), COSTEDBYWEIGHT INTEGER ); create or replace type tbl_of_rec is table of itemrec; create or replace PROCEDURE Update_Item_Region_table ( Item_Data tbl_of_rec ) IS errcode integer; errmsg varchar2(4000); BEGIN for recIndex in 1 .. Item_Data.COUNT loop update FL_ITEM_REGION_TEST set Region = Item_Data(recIndex).Region, Long_description = Item_Data(recIndex).Long_description, Pos_Description = Item_Data(recIndex).Pos_description, Pos_Dept = Item_Data(recIndex).Pos_dept, Item_Size = Item_Data(recIndex).Item_Size, Item_Uom = Item_Data(recIndex).Item_Uom, Brand = Item_Data(recIndex).Brand, Item_Status = Item_Data(recIndex).Item_Status, Timestamp = to_date(Item_Data(recIndex).Time_stamp, 'yyyy-mm-dd HH24:mi:ss'), CostedByWeight = Item_Data(recIndex).CostedByWeight where UPC = Item_Data(recIndex).UPC; log_message(Item_Data(recIndex).Region, '', 'Updated item ' || Item_Data(recIndex).UPC || '.'); end loop; EXCEPTION WHEN OTHERS THEN errcode := SQLCODE(); errmsg := SQLERRM(); log_message('CE', '', 'Error in Update_Item_Region_table(): Code [' || errcode || '], Msg [' || errmsg || '] ...'); END; In my BizTalk project I generate the schemas and binding information for both stored procedures. For the Oracle procedure, I specified a path for the GeneratedUserTypesAssemblyFilePath parameter to generate a DLL to contain the definition of the data types. In the Send Port on the server, I put the path to that Types DLL in the UserAssembliesLoadPath parameter. I created a map to translate the GetItemChanges() schema to the Update_Item_Region_Table() schema. When I run it the data is extracted and transformed fine but causes an exception trying to pass the data to the Oracle proc: *The adapter failed to transmit message going to send port "WcfSendPort_OracleDBBinding_HOST_DATA_Procedure_Custom" with URL "oracledb://dvotst/". It will be retransmitted after the retry interval specified for this Send Port. Details:"System.InvalidOperationException: Custom type mapping for 'HOST_DATA.TBL_OF_REC' is not specified or is invalid.* So it is apparently not getting the information about the custom data type TBL_OF_REC into the Types DLL. Any tips on how to make this work?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How to combine a list of choices to determine which select statement

    - by Larry
    I have a mysql db and am using php 5.2 What I am trying to do is offer a list of options for a person to select (only 1). The chosen option will cause a select, update, or delete statement to be ran. The results of the statement do not need to be shown, although, showing the old and then the new would be nice (no problems with that part tho'.). Pseudo-Code: Assign $choice = 0 Check the value of $choice // This way, if it = 100, we do a break Select a Choice:<br> 1. Adjust Status Value (+60) // $choice = 1<br> 2. Show all Ships <br> // $choice = 2 3. Show Ships in Port <br> // $choice = 3 ... 0. $choice="100" // if the value =100, quit this part Use either case (switch) or if/else statements to run the users choice1 If the choice is 1, then run the "Select" statement with the variable of $sql1 -- "SELECT .... If the choice is 2, then run the "Select" statement with the variable of $sql2 --- SELECT * FROM Ships If the choice is 3, then run the "Select" statement with the variable of $sql3 <br> .... If the choice is 0, then we are done. I figured the (3) statements would be assigned in php as: $sql1="...". $sql2="SELECT * FROM Ships" $sql3="SELECT * FROM Ships WHERE nPort="1" My idea was to use the switch statement, but got lost on it. :( I would like the options to be available over and over again, until a variable ($choice) is selected. In which case, this particular page is done and goes back to the "Main Menu"? The coding and display, if I use it, I can do. Just not sure how to write the way to select which one I want. It is possible that I would run all of the queries, and other times, only one, so that is why I would like the choice. An area I get confused in is the proper forms to use such as -- ' ' " " and ...?? Not sure the # of options I will end up with, but it will be more than 5 but less than 20 / page. So if I get the system down for 2-3 choices, I can replicate it for as many as I may need. And, as always, if a better way exists, I am willing to try it. Thanks again... Larry

    Read the article

  • Memory leaks getting sub-images from video (cvGetSubRect)

    - by dnul
    Hi, i'm trying to do video windowing that is: show all frames from a video and also some sub-image from each frame. This sub-image can change size and be taken from a different position of the original frame. So , the code i've written does basically this: cvQueryFrame to get a new image from the video Create a new IplImage (img) with sub-image dimensions ( window.height,window.width) Create a new Cvmat (mat) with sub-image dimensions ( window.height,window.width) CvGetSubRect(originalImage,mat,window) seizes the sub-image transform Mat (cvMat) to img (IplImage) using cvGetImage my problem is that for each frame i create new IplImage and cvMat which take a lot of memory and when i try to free the allocated memory I get a segmentation fault or in the case of the CvMat the allocated space does not get free (valgrind keeps telling me its definetly lost space). the following code does it: int main(void){ CvCapture* capture; CvRect window; CvMat * tmp; //window size window.x=0;window.y=0;window.height=100;window.width=100; IplImage * src=NULL,*bk=NULL,* sub=NULL; capture=cvCreateFileCapture( "somevideo.wmv"); while((src=cvQueryFrame(capture))!=NULL){ cvShowImage("common",src); //get sub-image sub=cvCreateImage(cvSize(window.height,window.width),8,3); tmp =cvCreateMat(window.height, window.width,CV_8UC1); cvGetSubRect(src, tmp , window); sub=cvGetImage(tmp, sub); cvShowImage("Window",sub); //free space if(bk!=NULL) cvReleaseImage(&bk); bk=sub; cvReleaseMat(&tmp); cvWaitKey(20); //window dimensions changes window.width++; window.height++; } } cvReleaseMat(&tmp); does not seem to have any effect on the total amount of lost memory, valgrind reports the same amount of "definetly lost" memory if i comment or uncomment this line. cvReleaseImage(&bk); produces a segmentation fault. notice i'm trying to free the previous sub-frame which i'm backing up in the bk variable. If i comment this line the program runs smoothly but with lots of memory leaks I really need to get rid of memory leaks, can anyone explain me how to correct this or even better how to correctly perform image windowing? Thank you

    Read the article

  • text in textbox shows up as circles instead of regular characters?

    - by BlueMonster
    When i type in either of the textboxes i get little circles appearing instead of text. Why is this happening and how do i stop it? Code is as follows: HTML: <%@ Page Language="C#" AutoEventWireup="true" CodeBehind="MainPage.aspx.cs" Inherits="Foods.MainPage" %> <!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"> <html xmlns="http://www.w3.org/1999/xhtml"> <head runat="server"> <title></title> <meta http-equiv="Content-Type" content="text/html; charset=utf-8" /> <link id="Link1" rel="stylesheet" type="text/css" href="Styles/mainStyle.css"/> </head> <body> <form id="form1" runat="server"> <div class = "userIDTboxDiv"> <div class = "userIDTboxText"> &nbsp;&nbsp;&nbsp; Enter User ID: </div> <asp:TextBox id="userIDBox" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> <div class = "passwordTboxDiv"> <div class = "passwordTboxText"> &nbsp;&nbsp;&nbsp; Enter User Password: </div> <asp:TextBox id="TextBox1" TextMode="password" runat="server" Height="52px" Width="200px" /> </div> </form> </body> CSS: body { text-decoration:none; background: white; } input { margin-left: 0px; margin-top: 7px; } .userIDTboxDiv { padding-top: 20%; padding-left: 45%; width: 15%; height: 30%; } .userIDTboxText { padding-left: 17%; height: auto; width:203px; } .passwordTboxDiv { padding-top: 2%; padding-left: 45%; width: 15%; height: 111px; } .passwordTboxText { padding-left: 10%; height: auto; width:203px; }

    Read the article

  • how to find the data key on checkedchanged event of checkbox in a list view in asp.net?

    - by subodh
    I am using a list view inside that in item template i am using a label and a checkbox. I want that whenever user clicks on the check box the value should be updated in a table.i am using a datakeys in listview.on the basis of datakey value should be updated in the table query is string updateQuery = "UPDATE [TABLE] SET [COLUMN] = " + Convert.ToInt32(chk.Checked) + " WHERE PK_ID =" + dataKey + " "; also i want some help in displaying the result as it is inside the table.means if the value for column in table for a particular pkid is 1 then the checkbox shoul be checked. here is the code snippet <asp:ListView ID="lvFocusArea" runat="server" DataKeyNames="PK_ID" onitemdatabound="lvFocusArea_ItemDataBound" > <LayoutTemplate> <table border="0" cellpadding="1" width="400px"> <tr style="background-color: #E5E5FE"> <th align="left"> Focus Area </th> <th> Is Current Focused </th> </tr> <tr id="itemPlaceholder" runat="server"> </tr> </table> </LayoutTemplate> <ItemTemplate> <tr> <td width="80%"> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center" width="20%"> <asp:CheckBox ID="chkFocusArea" runat="server" OnCheckedChanged="chkFocusArea_CheckedChanged" AutoPostBack="true"/> </td> </tr> </ItemTemplate> <AlternatingItemTemplate> <tr style="background-color: #EFEFEF"> <td> <asp:Label ID="lblFocusArea" runat="server" Text=""><%#Eval("FOCUS_AREA_NAME") %></asp:Label> </td> <td align="center"> <asp:CheckBox ID="chkFocusArea" runat="server" oncheckedchanged="chkFocusArea_CheckedChanged" AutoPostBack="true" /> </td> </tr> </AlternatingItemTemplate> <SelectedItemTemplate> <td> item selected</td> </SelectedItemTemplate> </asp:ListView> help me.

    Read the article

  • Is it correct or incorrect for a Java JAR to contain its own dependencies?

    - by 4herpsand7derpsago
    I guess this is a two-part question. I am trying to write my own Ant task (MyFirstTask) that can be used in other project's build.xml buildfiles. To do this, I need to compile and package my Ant task inside its own JAR. Because this Ant task that I have written is fairly complicated, it has about 20 dependencies (other JAR files), such as using XStream for OX-mapping, Guice for DI, etc. I am currently writing the package task in the build.xml file inside the MyFirstTask project (the buildfile that will package myfirsttask.jar, which is the reusable Ant task). I am suddenly realizing that I don't fully understand the intention of a Java JAR. Is it that a JAR should not contain dependencies, and leave it to the runtime configuration (the app container, the runtime environment, etc.) to supply it with the dependencies it needs? I would assume if this is the case, an executable JAR is an exception to the rule, yes? Or, is it the intention for Java JARs to also include their dependencies? Either way, I don't want to be forcing my users to be copying-n-pasting 25+ JARs into their Ant libs; that's just cruel. I like the way WAR files are set up, where the classpath for dependencies is defined under the classes/ directory. I guess, ultimately, I'd like my JAR structure to look like: myfirsttask.jar/ com/ --> the root package of my compiled binaries config/ --> config files, XML, XSD, etc. classes/ --> all dependencies, guice-3.0.jar, xstream-1.4.3.jar, etc. META-INF/ MANIFEST.MF I assume that in order to accomplish this (and get the runtime classpath to also look into the classes/ directory), I'll need to modify the MANIFEST.MF somehow (I know there's a manifest attribute called ClassPath, I believe?). I'm just having a tough time putting everything together, and have a looming/lingering question about the very intent of JARs to begin with. Can someone please confirm whether Oracle intends for JARs to contain their dependencies or not? And, either way, what I would have to do in the manifest (or anywhere else) to make sure that, at runtime, the classpath can find the dependencies stored under the classes/ directory? Thanks in advance!

    Read the article

  • How to change the JSON output format and how to support chinese character?

    - by sky
    Currently I using the following code to get my JSON output from MySQL. <?php $session = mysql_connect('localhost','name','pass'); mysql_select_db('dbname', $session); $result= mysql_query('SELECT message FROM posts', $session); $somethings = array(); while ($row = mysql_fetch_assoc($result)) { $somethings[] = $row; } ?> <script type="text/javascript"> var somethings= <?php echo json_encode($somethings); ?>; </script> And the output is: <script type="text/javascript"> var somethings= [{"message":"Welcome to Yo~ :)"},{"message":"Try iPhone post!"},{"message":"????"}]; </script> Here is the question, how can I change my output into format like : <script type="text/javascript"> userAge = new Array('21','36','20'), userMid = new Array('liuple','anhu','jacksen'); </script> Which I'll be using later with following code : var html = ' <table class="map-overlay"> <tr> <td class="user">' + '<a class="username" href="/' + **userMid[index]** + '" target="_blank"><img alt="" src="' + getAvatar(signImgList[index], '72x72') + '"></a><br> <a class="username" href="/' + **userMid[index]** + '" target="_blank">' + userNameList[index] + '</a><br> <span class="info">' + **userSex[index]** + ' ' + **userAge[index]** + '?<br> ' + cityList[index] + '</span>' + '</td> <td class="content">' + picString + somethings[index] + '<br> <span class="time">' + timeList[index] + picTips + '</span></td> </tr> </table> '; Thanks for helping and reading!

    Read the article

  • Programatically created UITableViewCell subclass only working on highlight

    - by squarefrog
    I've created a subclass of UITableViewCell but I'm struggling to get it to work properly. If I use UITableViewStyleDefault then the class only works when highlighted. If I use UITableViewStyleValue1 then it mostly works but I'm unable to change label fonts much. I tried researching but it seems everyone is doing this via a .xib file, but not programatically. Implementation file #import "ASCustomCellWithCount.h" @implementation ASCustomCellWithCount @synthesize primaryLabel,secondaryLabel,contentCountImage,contentCount; - (id)initWithStyle:(UITableViewCellStyle)style reuseIdentifier:(NSString *)reuseIdentifier { self = [super initWithStyle:style reuseIdentifier:reuseIdentifier]; if (self) { // Initialization code contentCountImage = [[UIImageView alloc] initWithImage:[UIImage imageNamed: @"tableCount.png"] ]; primaryLabel = [[UILabel alloc] init]; primaryLabel.textAlignment = UITextAlignmentLeft; primaryLabel.textColor = [UIColor blackColor]; primaryLabel.font = [UIFont systemFontOfSize: 20]; primaryLabel.backgroundColor = [UIColor clearColor]; secondaryLabel = [[UILabel alloc] init]; secondaryLabel.textAlignment = UITextAlignmentLeft; secondaryLabel.textColor = [UIColor blackColor]; secondaryLabel.font = [UIFont systemFontOfSize: 8]; secondaryLabel.backgroundColor = [UIColor clearColor]; contentCount = [[UILabel alloc] init]; contentCount.textAlignment = UITextAlignmentCenter; contentCount.font = [UIFont boldSystemFontOfSize: 15]; contentCount.textColor = [UIColor whiteColor]; contentCount.shadowColor = [UIColor blackColor]; contentCount.shadowOffset = CGSizeMake(1, 1); contentCount.backgroundColor = [UIColor clearColor]; [self.contentView addSubview: contentCountImage]; [self.contentView addSubview: primaryLabel]; [self.contentView addSubview: secondaryLabel]; [self.contentView addSubview: contentCount]; } return self; } - (void)layoutSubviews { [super layoutSubviews]; CGRect contentRect = self.contentView.bounds; // CGFloat boundsX = contentRect.origin.x; primaryLabel.frame = CGRectMake(0 ,0, 200, 25); secondaryLabel.frame = CGRectMake(0, 30, 100, 15); contentCount.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 13, 36, 24); contentCountImage.frame = CGRectMake(contentRect.size.width - 48, contentRect.size.height / 2 - 12, 36, 24); } - (void)setSelected:(BOOL)selected animated:(BOOL)animated { [super setSelected:selected animated:animated]; // Configure the view for the selected state } - (void)dealloc { [primaryLabel release]; [secondaryLabel release]; [contentCountImage release]; [contentCount release]; } @end And then to create the cell I use - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath:(NSIndexPath *)indexPath { static NSString *CellIdentifier = @"Cell"; ASCustomCellWithCount *cell = [tableView dequeueReusableCellWithIdentifier:CellIdentifier]; if (cell == nil) { cell = [[[ASCustomCellWithCount alloc] initWithStyle: UITableViewCellStyleDefault reuseIdentifier:CellIdentifier] autorelease]; } cell.textLabel.text = [NSString stringWithFormat:@"%@", [tempArray objectAtIndex: indexPath.row]]; cell.contentCount.text = @"49"; return cell; }

    Read the article

< Previous Page | 384 385 386 387 388 389 390 391 392 393 394 395  | Next Page >