Search Results

Search found 16413 results on 657 pages for 'array manipulation'.

Page 389/657 | < Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >

  • Sudoku Recursion Issue (Java)

    - by SkylineAddict
    I'm having an issue with creating a random Sudoku grid. I tried modifying a recursive pattern that I used to solve the puzzle. The puzzle itself is a two dimensional integer array. This is what I have (By the way, the method doesn't only randomize the first row. I had an idea to randomize the first row, then just decided to do the whole grid): public boolean randomizeFirstRow(int row, int col){ Random rGen = new Random(); if(row == 9){ return true; } else{ boolean res; for(int ndx = rGen.nextInt() + 1; ndx <= 9;){ //Input values into the boxes sGrid[row][col] = ndx; //Then test to see if the value is valid if(this.isRowValid(row, sGrid) && this.isColumnValid(col, sGrid) && this.isQuadrantValid(row, col, sGrid)){ // grid valid, move to the next cell if(col + 1 < 9){ res = randomizeFirstRow(row, col+1); } else{ res = randomizeFirstRow( row+1, 0); } //If the value inputed is valid, restart loop if(res == true){ return true; } } } } //If no value can be put in, set value to 0 to prevent program counting to 9 setGridValue(row, col, 0); //Return to previous method in stack return false; } This results in an ArrayIndexOutOfBoundsException with a ridiculously high or low number (+- 100,000). I've tried to see how far it goes into the method, and it never goes beyond this line: if(this.isRowValid(row, sGrid) && this.isColumnValid(col, sGrid) && this.isQuadrantValid(row, col, sGrid)) I don't understand how the array index goes so high. Can anyone help me out?

    Read the article

  • How to implement a simple queue properly?

    - by Stephen Hsu
    The current Go library doesn't provide the queue container. To implement a simple queue, I use circle array as the underlying data structure. It follows algorithms mentioned in TAOCP: Insert Y into queue X: X[R]<-Y; R<-(R+1)%M; if R=F then OVERFLOW. Delete Y from queue X: if F=R then UNDERFLOW; Y<-X[F]; F<-(F+1) % M. F: Front, R: Rear, M: Array length. Following is the code: package main import ( "fmt" ) type Queue struct { len int head, tail int q []int } func New(n int) *Queue { return &Queue{n, 0, 0, make([]int, n)} } func (p *Queue) Enqueue(x int) bool { p.q[p.tail] = x p.tail = (p.tail + 1) % p.len return p.head != p.tail } func (p *Queue) Dequeue() (int, bool) { if p.head == p.tail { return 0, false } x := p.q[p.head] p.head = (p.head + 1) % p.len return x, true } func main() { q := New(10) for i := 1; i < 13; i++ { fmt.Println(i, q.Enqueue(i)) } fmt.Println() for i := 1; i < 13; i++ { fmt.Println(q.Dequeue()) } } But the output is obviously wrong: 1 true 2 true 3 true 4 true 5 true 6 true 7 true 8 true 9 true 10 false 11 true 12 true 11 true 12 true 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false 0 false I think I need one more field to make the code work properly. What do you suggest?

    Read the article

  • Create folder and insert file in Google Drive

    - by web_student
    I am trying to create a new folder in Drive and upload one (or more) files to that created folder. I use the code below, but the result is that both the folder and the file are placed in the root of my Drive. $client->setAccessToken($_SESSION['accessToken']); //create folder $folder_mime = "application/vnd.google-apps.folder"; $folder_name = 'New Folder'; $service = new Google_DriveService($client); $folder = new Google_DriveFile(); $folder->setTitle($folder_name); $folder->setMimeType($folder_mime); $service->files->insert($folder); //upload file $file_name = $_FILES["uploadFile"]["name"]; $file_mime = $_FILES["uploadFile"]["type"]; $file_path = $_FILES["uploadFile"]["tmp_name"]; $service = new Google_DriveService($client); $file = new Google_DriveFile(); $file->setParents(array($folder_name)); $file->setTitle($file_name); $file->setDescription('This is a '.$file_mime.' document'); $file->setMimeType($file_mime); $service->files->insert( $file, array( 'data' => file_get_contents($file_path) ) );

    Read the article

  • Swt file dialog too much files selected?

    - by InsertNickHere
    Hi there, the swt file dialog will give me an empty result array if I select too much files (approx. 2500files). The listing shows you how I use this dialog. If i select too many sound files, the syso will show 0. Debugging tells me, that the files array is empty in this case. Is there any way to get this work? FileDialog fileDialog = new FileDialog(mainView.getShell(), SWT.MULTI); fileDialog.setText("Choose sound files"); fileDialog.setFilterExtensions(new String[] { new String("*.wav") }); Vector<String> result = new Vector<String>(); fileDialog.open(); String[] files = fileDialog.getFileNames(); for (int i = 0, n = files.length; i < n; i++) { if( !files[i].contains(".wav")) { System.out.println(files[i]); } StringBuffer stringBuffer = new StringBuffer(); stringBuffer.append(fileDialog.getFilterPath()); if (stringBuffer.charAt(stringBuffer.length() - 1) != File.separatorChar) { stringBuffer.append(File.separatorChar); } stringBuffer.append(files[i]); stringBuffer.append(""); String finalName = stringBuffer.toString(); if( !finalName.contains(".wav")) { System.out.println(finalName); } result.add(finalName); } System.out.println(result.size()) ;

    Read the article

  • Program repeats each time a character is scanned .. How to stop it ?

    - by ZaZu
    Hello there, I have a program that has this code : #include<stdio.h> main(){ int input; char g; do{ printf("Choose a numeric value"); printf(">"); scanf("\n%c",&input); g=input-'0'; }while((g>=-16 && g<=-1)||(g>=10 && g<=42)||(g>=43 && g<=79)); } It basically uses ASCII manipulation to allow the program to accept numbers only .. '0' is given the value 48 by default...the ASCII value - 48 gives a ranges of numbers above (in the while statement) Anyway, whenever a user inputs numbers AND alphabets, such as : abr39293afakvmienb23 The program ignores : a,b,r .. But takes '3' as the first input. For a b and r, the code under the do loop repeats. So for the above example, I get : Choose a numeric value >Choose a numeric value> Choose a numeric value >3 Is there a way I can stop this ??? I tried using \n%c to scan the character and account for whitespace, but that didnt work :( Please help thank you very much !

    Read the article

  • Perl - Using hashes in classes

    - by brydgesk
    I have a class with several variables, one of which is a hash (_runs): sub new { my ($class, $name) = @_; my $self = { _name => $name, ... _runs => (), _times => [], ... }; bless ($self, $class); return $self; } Now, all I'm trying to do is create an accessor/mutator, as well as another subroutine that pushes new data into the hash. But I'm having a hell of a time getting all the referencing/dereferencing/$self calls working together. I've about burned my eyes out with "Can't use string ("blah") as a HASH ref etc etc" errors. For the accessor, what is 'best practice' for returning hashes? Which one of these options should I be using (if any)?: return $self->{_runs}; return %{ $self->{_runs} }; return \$self->{_runs}; Further, when I'm using the hash within other subroutines in the class, what syntax do I use to copy it? my @runs = $self->{_runs}; my @runs = %{ $self->{_runs} }; my @runs = $%{ $self->{_runs} }; my @runs = $$self->{_runs}; Same goes for iterating over the keys: foreach my $dt (keys $self->{_runs}) foreach my $dt (keys %{ $self->{_runs} }) And how about actually adding the data? $self->{_runs}{$dt} = $duration; %{ $self->{_runs} }{$dt} = $duration; $$self->{_runs}{$dt} = $duration; You get the point. I've been reading articles about using classes, and articles about referencing and dereferencing, but I can't seem to get my brain to combine the knowledge and use both at the same time. I got my _times array working finally, but mimicking my array syntax over to hashes didn't work.

    Read the article

  • Making a jQuery plugin to feed Tumblr to site

    - by tylorreimer
    I have some experience with PHP and a little with JS but I'm far from anything proficient. I'm trying to make a jQuery plugin for my site that I can call in my HTML via something like this: $('.new').tumble({username: "tylor", count: 9}); Which would basically put the Tumblr list the code should make into the DIV with class 'new' in this case. Here is my code so far; the problem seems to be how to get it to pick up class/id from the original call (in the HTML) and use that in the jQuery. Here's the code so far: (function($) { $.fn.tumble = function(options){ var settings = $.extend({ username: null, // [string or array] required to get url for tumblr account count: 3, // [integer] how many posts to display? }, options); //url construction var url = "http://" + settings.username + ".tumblr.com"; var jsonurl = url + "/api/read/json?num=" + settings.count + "&callback=?"; $.getJSON(jsonurl, function(data) { var items = []; $.each(data.posts, function(id, url) { // Goes over each post in the JSON document retrieved from data URL var url = this.url; // Just assigns a variable to the url to avoid constantly writing "this.whatever" var photourl = this['photo-url-250']; // photo-url-xxx needs to be called this way due to integers in the name items.push('<li><a href="' + url + '">' + photourl + '</a></li>'); }); $('<ul/>', { // Creates an empty list html: items.join('') // Takes the values in the item array and puts 'em together }).appendTo('.new'); // I don't want this to have the class set in the jQuery itself }); //end json }; })( jQuery ); Any help you can lend would be wonderful. Thank you

    Read the article

  • Latex - Apply an operation to every character in a string

    - by hroest
    Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

    Read the article

  • How do I update a NSTableView when its data source has changed?

    - by Jergason
    I am working along with Cocoa Programming For Mac OS X (a great book). One of the exercises the book gives is to build a simple to-do program. The UI has a table view, a text field to type in a new item and an "Add" button to add the new item to the table. On the back end I have a controller that is the data source and delegate for my NSTableView. The controller also implements an IBAction method called by the "Add" button. It contains a NSMutableArray to hold the to do list items. When the button is clicked, the action method fires correctly and the new string gets added to the mutable array. However, my data source methods are not being called correctly. Here they be: - (NSInteger)numberOfRowsInTableView:(NSTableView *)aTableView { NSLog(@"Calling numberOfRowsInTableView: %d", [todoList count]); return [todoList count]; } - (id)tableView:(NSTableView *)aTableView objectValueForTableColumn:(NSTableColumn *)aTableColumn row:(NSInteger)rowIndex { NSLog(@"Returning %@ to be displayed", [todoList objectAtIndex:rowIndex]); return [todoList objectAtIndex:rowIndex]; } Here is the rub. -numberOfRowsInTableView only gets called when the app first starts, not every time I add something new to the array. -objectValueForTableColumn never gets called at all. I assume this is because Cocoa is smart enough to not call this method when there is nothing to draw. Is there some method I need to call to let the table view know that its data source has changed, and it should redraw itself?

    Read the article

  • How do you deserialize a collection with child collections?

    - by Stuart Helwig
    I have a collection of custom entity objects one property of which is an ArrayList of byte arrays. The custom entity is serializable and the collection property is marked with the following attributes: [XmlArray("Images"), XmlArrayItem("Image",typeof(byte[]))] So I serialize a collection of these custom entities and pass them to a web service, as a string. The web service receives the string and byte array in tact, The following code then attempts to deserialize the collection - back into custom entities for processing... XmlSerializer ser = new XmlSerializer(typeof(List<myCustomEntity>)); StringReader reader = new StringReader(xmlStringPassedToWS); List<myCustomEntity> entities = (List<myCustomEntity>)ser.Deserialize(reader); foreach (myCustomEntity e in entities) { // ...do some stuff... foreach (myChildCollection c in entities.ChildCollection { // .. do some more stuff.... } } I've checked the XML resulting from the initial serialization and it does contain byte array - the child collection, as does the StringReader built above. After the deserialization process, the resulting collection of custom entites is fine, except that each object in the collection does not contain any items in its child collection. (i.e. it doesn't get to "...do some more stuff..." above. Can someone please explain what I am doing wrong? Is it possible to serialize ArrayLists within a generic collection of custom entities?

    Read the article

  • Memory efficient collection class

    - by Joe
    I'm building an array of dictionaries (called keys) in my iphone application to hold the section names and row counts for a tableview. the code looks like this: [self.results removeAllObjects]; [self.keys removeAllObjects]; NSUInteger i,j = 0; NSString *key = [NSString string]; NSString *prevKey = [NSString string]; if ([self.allResults count] > 0) { prevKey = [NSString stringWithString:[[[self.allResults objectAtIndex:0] valueForKey:@"name"] substringToIndex:1]]; for (NSDictionary *theDict in self.allResults) { key = [NSString stringWithString:[[theDict valueForKey:@"name"] substringToIndex:1]]; if (![key isEqualToString:prevKey]) { NSDictionary *newDictionary = [NSDictionary dictionaryWithObjectsAndKeys: [NSNumber numberWithInt:i],@"count", prevKey,@"section", [NSNumber numberWithInt:j], @"total",nil]; [self.keys addObject:newDictionary]; prevKey = [NSString stringWithString:key]; i = 1; } else { i++; } j++; } NSDictionary *newDictionary = [NSDictionary dictionaryWithObjectsAndKeys: [NSNumber numberWithInt:i],@"count", prevKey,@"section", [NSNumber numberWithInt:j], @"total",nil]; [self.keys addObject:newDictionary]; } [self.tableview reloadData]; The code works fine first time through but I sometimes have to rebuild the entire table so I redo this code which orks fine on the simulator, but on my device the program bombs when I execute the reloadData line : malloc: *** mmap(size=3772944384) failed (error code=12) *** error: can't allocate region *** set a breakpoint in malloc_error_break to debug malloc: *** mmap(size=3772944384) failed (error code=12) *** error: can't allocate region *** set a breakpoint in malloc_error_break to debug Program received signal: “EXC_BAD_ACCESS”. If I remove the reloadData line the code works on the device. I'm wondering if this is something to do with the way I've built the keys array (ie using autoreleased strings and dictionaries).

    Read the article

  • strange memory error when deleting object from Core Data

    - by llloydxmas
    I have an application that downloads an xml file, parses the file, and creates core data objects while doing so. In the parse code I have a function called 'emptydatacontext' that removes all items from Core Data before creating replacements from the xml file. This method looks like this: -(void) emptyDataContext { NSMutableArray* mutableFetchResults = [CoreDataHelper getObjectsFromContext:@"Condition" :@"road" :NO :managedObjectContext]; NSFetchRequest * allCon = [[NSFetchRequest alloc] init]; [allCon setEntity:[NSEntityDescription entityForName:@"Condition" inManagedObjectContext:managedObjectContext]]; NSError * error = nil; NSArray * conditions = [managedObjectContext executeFetchRequest:allCon error:&error]; [allCon release]; for (NSManagedObject * condition in conditions) { [managedObjectContext deleteObject:condition]; } } The first time this runs it deletes all objects and functions as it should - creating new objects from the xml file. I created a 'update' button that starts the exact same process of retrieving the file the preceeding as it did the first time. All is well until its time to delete the core data objects again. This 'deleteObject' call creates a "EXC_BAD_ACCESS" error each time. This only happens on the second time through. See this image for the debugger window as it appears when walking through the deletion FOR loop on the second iteration. Conditions is the fetched array of 7 objects with the objects below. Condition should be an individual condition. link text As you can see 'condition' does not match any of the objects in the 'conditions' array. I'm sure this is why I'm getting the memory access errors. Just not sure why this fetch (or the FOR) is returning a wrong reference. All the code that successfully performes this function on the first iteration is used in the second but with very different results. Thanks in advance for the help!

    Read the article

  • How to sort a list so that managers are always ahead of their subordinates (How do I do a topologica

    - by James Black
    I am working on a project using Groovy, and I would like to take an array of employees, so that no manager follows their subordinates in the array. The reason being that I need to add people to a database and I would prefer not to do it in two passes. So, I basically have: <employees> <employee> <employeeid>12</employeeid> <manager>3</manager> </employee> <employee> <employeeid>1</employeeid> <manager></manager> </employee> <employee> <employeeid>3</employeeid> <manager>1</manager> </employee> </employees> So, it should be sorted as such: employeeid = 1 employeeid = 3 employeeid = 12 The first person should have a null for managers. I am thinking about a binary tree representation, but I expect it will be very unbalanced, and I am not certain the best way to do this using Groovy properly. Is there a way to do this that isn't going to involve using nested loops?

    Read the article

  • Can't use my form

    - by Alexandr
    I have class with my form in folder /application/forms/Auth.php it looks like class Form_Auth extends Zend_Form { public function __construct() { $this->setName(); parent::__construct(); $username = new Zend_Form_Element_Text('username'); $password = new Zend_Form_Element_Password('password'); $mail = new Zend_Form_Element_Text('mail'); $submit = new Zend_Form_Element_Submit('submit'); $this->addElements(array($username,$password,$mail,$submit)); } } When i try create object $this->view->form = new Form_Auth(); is see exeption Application error Exception information: Message: Invalid name provided; must contain only valid variable characters and be non-empty Stack trace: D:\WWW\zends\application\Forms\Auth.php(8): Zend_Form-setName() d:\WWW\zends\application\controllers\RegistrationController.php(49): Form_Auth-__construct() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Action.php(513): RegistrationController-indexAction() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Dispatcher\Standard.php(289): Zend_Controller_Action-dispatch('indexAction') D:\WebServer\ZendFramework\ZendFramework\library\Zend\Controller\Front.php(954): Zend_Controller_Dispatcher_Standard-dispatch(Object(Zend_Controller_Request_Http), Object(Zend_Controller_Response_Http)) D:\WebServer\ZendFramework\ZendFramework\library\Zend\Application\Bootstrap\Bootstrap.php(97): Zend_Controller_Front-dispatch() D:\WebServer\ZendFramework\ZendFramework\library\Zend\Application.php(366): Zend_Application_Bootstrap_Bootstrap-run() D:\WWW\zends\public\index.php(26): Zend_Application-run() {main} Request Parameters: array ( 'controller' = 'registration', 'action' = 'index', 'module' = 'default', ) the version zf is 1.10.3 what i do wrong ?

    Read the article

  • How to use PHP preg_replace regular expression to find and replace text

    - by Roger
    I wrote this PHP code to make some substitutions: function cambio($txt){ $from=array( '/\+\>([^\+\>]+)\<\+/', //finds +>text<+ '/\%([^\%]+)\%/', //finds %text% ); $to=array( '<span class="P">\1</span>', '<span>\1</span>', ); return preg_replace($from,$to,$txt); } echo cambio('The fruit I most like is: +> %apple% %banna% %orange% <+.'); Resulting into this: The fruit I most like is: <span class="P"> <span>apple</span> <span>banna</span> <span>orange</span> </span>. however I needed to identify the fruit's span tags, like this: The fruit I most like is: <span class="P"> <span class="a">apple</span> <span class="b">banna</span> <span class="c">coco</span> </span>. I'd buy a fruit to whom discover a regular expression to accomplish this :-)

    Read the article

  • Is it a good idea to use an integer column for storing US ZIP codes in a database?

    - by Yadyn
    From first glance, it would appear I have two basic choices for storing ZIP codes in a database table: Text (probably most common), i.e. char(5) or varchar(9) to support +4 extension Numeric, i.e. 32-bit integer Both would satisfy the requirements of the data, if we assume that there are no international concerns. In the past we've generally just gone the text route, but I was wondering if anyone does the opposite? Just from brief comparison it looks like the integer method has two clear advantages: It is, by means of its nature, automatically limited to numerics only (whereas without validation the text style could store letters and such which are not, to my knowledge, ever valid in a ZIP code). This doesn't mean we could/would/should forgo validating user input as normal, though! It takes less space, being 4 bytes (which should be plenty even for 9-digit ZIP codes) instead of 5 or 9 bytes. Also, it seems like it wouldn't hurt display output much. It is trivial to slap a ToString() on a numeric value, use simple string manipulation to insert a hyphen or space or whatever for the +4 extension, and use string formatting to restore leading zeroes. Is there anything that would discourage using int as a datatype for US-only ZIP codes?

    Read the article

  • How would you code an efficient Circular Buffer in Java or C#

    - by Cheeso
    I want a simple class that implements a fixed-size circular buffer. It should be efficient, easy on the eyes, generically typed. EDIT: It need not be MT-capable, for now. I can always add a lock later, it won't be high-concurrency in any case. Methods should be: .Add and I guess .List, where I retrieve all the entries. On second thought, Retrieval I think should be done via an indexer. At any moment I will want to be able to retrieve any element in the buffer by index. But keep in mind that from one moment to the next Element[n] may be different, as the Circular buffer fills up and rolls over. This isn't a stack, it's a circular buffer. Regarding "overflow": I would expect internally there would be an array holding the items, and over time the head and tail of the buffer will rotate around that fixed array. But that should be invisible from the user. There should be no externally-detectable "overflow" event or behavior. This is not a school assignment - it is most commonly going to be used for a MRU cache or a fixed-size transaction or event log.

    Read the article

  • In a Tab Bar based app a controller release data of the other ! !

    - by Flodev03
    Hi all ! I've made a ViewBased app, in the app delegate i've set a UITabBarCotntroller, in the app i have different view Controller two of them displays text in a UITextView and labels, the other one is my "ShakeController" a UIViewController in which i've set a UIAcelerometerDelegate, in it i create a instance of UIAccelerometer, in the method which manages the shake everything works fine, in this controller i have also set a UIImageView to make a simple animation, in the view Did Load method i set my imageView.animation to an array of UIImage. My problem is : when the app is launched i use the ViewControllers and everything work fine, but when i tap the ShakeController item in the tab bar and then when i come back to the other controllers the label looks like : label and textView like : Lorem ipsum..... the text of UItextView in IB. I have noticed thaht if i comment the initialisation of my imageView to the array of image i can navigate the items (from a view controller to another) without the label change and stay what i want them to be. Notice that the two controllers are in a UINavigationController. (i use @proprety (nonnatomic, retain) then @synthesize ... then releqse in the dealloc for the labels textview and my uiimageView) Do not know what to do thanks to all

    Read the article

  • Algorithm for assigning a unique series of bits for each user?

    - by Mark
    The problem seems simple at first: just assign an id and represent that in binary. The issue arises because the user is capable of changing as many 0 bits to a 1 bit. To clarify, the hash could go from 0011 to 0111 or 1111 but never 1010. Each bit has an equal chance of being changed and is independent of other changes. What would you have to store in order to go from hash - user assuming a low percentage of bit tampering by the user? I also assume failure in some cases so the correct solution should have an acceptable error rate. I would an estimate the maximum number of bits tampered with would be about 30% of the total set. I guess the acceptable error rate would depend on the number of hashes needed and the number of bits being set per hash. I'm worried with enough manipulation the id can not be reconstructed from the hash. The question I am asking I guess is what safe guards or unique positioning systems can I use to ensure this happens.

    Read the article

  • Using an SHA1 with Micrsoft CAPI

    - by Erik Jõgi
    Hello, I have an SHA1 hash and I need to sign it. The CryptSignHash() method requires a HCRYPTHASH handle for signing. I create it and as I have the actual hash value already then set it: CryptCreateHash(cryptoProvider, CALG_SHA1, 0, 0, &hash); CryptSetHashParam(hash, HP_HASHVAL, hashBytes, 0); The hashBytes is an array of 20 bytes. However the problem is that the signature produced from this HCRYPTHASH handle is incorrect. I traced the problem down to the fact that CAPI actually doesn't use all 20 bytes from my hashBytes array. For some reason it thinks that SHA1 is only 4 bytes. To verify this I wrote this small program: HCRYPTPROV cryptoProvider; CryptAcquireContext(&cryptoProvider, NULL, NULL, PROV_RSA_FULL, 0); HCRYPTHASH hash; HCRYPTKEY keyForHash; CryptCreateHash(cryptoProvider, CALG_SHA1, keyForHash, 0, &hash); DWORD hashLength; CryptGetHashParam(hash, HP_HASHSIZE, NULL, &hashLength, 0); printf("hashLength: %d\n", hashLength); And this prints out hashLength: 4 ! Can anyone explain what I am doing wrong or why Microsoft CAPI thinks that SHA1 is 4 bytes (32 bits) instead of 20 bytes (160 bits). Thank you.

    Read the article

  • I need to sort php jquery gallery script alphabetically

    - by David Cahill
    know nothing about php, but I have this script that reads a folder and displays a thumbnail gallery, problem is it dosent display alphabetically. Have searched the net and seen that sort does this but have no idea where to start any help would be much appreciated. heres the script $sitename = $row_wigsites['id']; $directory = 'sites/'.$sitename.'/pans'; $allowed_types=array('jpg','jpeg','gif','png'); $file_parts=array(); $ext=''; $title=''; $i=0; $dir_handle = @opendir($directory) or die("There is an error with your image directory!"); while ($file = readdir($dir_handle)) { if($file=='.' || $file == '..') continue; $file_parts = explode('.',$file); $ext = strtolower(array_pop($file_parts)); $title = implode('.',$file_parts); $title = htmlspecialchars($title); $nomargin=''; if(in_array($ext,$allowed_types)) { if(($i+1)%4==0) $nomargin='nomargin'; echo ' <div class="pic '.$nomargin.'" style="background:url('.$directory.'/'.$file.') no-repeat 50% 50%;"> <a href="'.$directory.'/'.$file.'" title="Panoramic Stills taken at '.$title.'°" rel="pan1" target="_blank">'.$title.'</a> </div>'; $i++; } } closedir($dir_handle);

    Read the article

  • Managed C++ or C# .NET, Downloading from rapidshare?

    - by cruisx
    I am trying to download a file from rapidshare via C++ .NET but I'm having a bit of trouble. The address used to be "https://ssl.rapidshare.com/cgi-bin/premiumzone.cgi" but that no longer works, does anyone know what the new one is? The code works but the file size is always 1KB, I don't think its connecting to the right server. private: void downloadFileAsync(String^ fileUrl) { String^ uriString; //fileUrl = "http://rapidshare.com/files/356458319/Keeping.Up.with.the.Kardashians.S04E10.Delivering.Baby.Mason.HDTV.XviD-MOMENTUM.rar"; uriString = "https://ssl.rapidshare.com/premzone.html";//"https://ssl.rapidshare.com"; NameValueCollection^ postvals = gcnew NameValueCollection(); postvals->Add("login", "bob"); postvals->Add("password", "12345"); // postvals->Add("uselandingpage", "1"); WebClient^ myWebClient = gcnew WebClient(); array<unsigned char>^ responseArray = gcnew array<unsigned char>(10024); responseArray = myWebClient->UploadValues(uriString, "POST", postvals); StreamReader^ strRdr = gcnew StreamReader(gcnew MemoryStream(responseArray)); String^ cookiestr = myWebClient->ResponseHeaders->Get("Set-Cookie"); myWebClient->Headers->Add("Cookie", cookiestr); //myWebClient->DownloadFileCompleted += gcnew AsyncCompletedEventHandler(myWebClient->DownloadFileCompleted); myWebClient-DownloadFileAsync(gcnew Uri(fileUrl),"C:\rapid\"+Path::GetFileName(fileUrl)); }

    Read the article

  • Using pointers to adjust global objects in objective-c

    - by Rob
    Ok, so I am working with two sets of data that are extremely similar, and at the same time, these data sets are both global NSMutableArrays within the object. data_set_one = [[NSMutableArray alloc] init]; data_set_two = [[NSMutableArray alloc] init]; Two new NSMutableArrays are loaded, which need to be added to the old, existing data. These Arrays are also global. xml_dataset_one = [[NSMutableArray alloc] init]; xml_dataset_two = [[NSMutableArray alloc] init]; To reduce code duplication (and because these data sets are so similar) I wrote a void method within the class to handle the data combination process for both Arrays: -(void)constructData:(NSMutableArray *)data fromDownloadArray:(NSMutableArray *)down withMatchSelector:(NSString *)sel_str Now, I have a decent understanding of object oriented programming, so I was thinking that if I were to invoke the method with the global Arrays in the data like so... [self constructData:data_set_one fromDownloadArray:xml_dataset_one withMatchSelector:@"id"]; Then the global NSMutableArrays (data_set_one) would reflect the changes that happen to "array" within the method. Sadly, this is not the case, data_set_one doesn't reflect the changes (ex: new objects within the Array) outside of the method. Here is a code snippet of the problem // data_set_one is empty // xml_dataset_one has a few objects [constructData:(NSMutableArray *)data_set_one fromDownloadArray:(NSMutableArray *)xml_dataset_one withMatchSelector:(NSString *)@"id"]; // data_set_one should now be xml_dataset_one, but when echoed to screen, it appears to remain empty And here is the gist of the code for the method, any help is appreciated. -(void)constructData:(NSMutableArray *)data fromDownloadArray:(NSMutableArray *)down withMatchSelector:(NSString *)sel_str { if ([data count] == 0) { data = down; // set data equal to downloaded data } else if ([down count] == 0) { // download yields no results, do nothing } else { // combine the two arrays here } } This project is not ARC enabled. Thanks for the help guys! Rob

    Read the article

  • File streaming in PHP - How to replicate this C#.net code in PHP?

    - by openid_kenja
    I'm writing an interface to a web service where we need to upload configuration files. The documentation only provides a sample in C#.net which I am not familiar with. I'm trying to implement this in PHP. Can someone familiar with both languages point me in the right direction? I can figure out all the basics, but I'm trying to figure out suitable PHP replacements for the FileStream, ReadBytes, and UploadDataFile functions. I believe that the RecService object contains the URL for the web service. Thanks for your help! private void UploadFiles() { clientAlias = “<yourClientAlias>”; string filePath = “<pathToYourDataFiles>”; string[] fileList = {"Config.txt", "ProductDetails.txt", "BrandNames.txt", "CategoryNames.txt", "ProductsSoldOut.txt", "Sales.txt"}; RecommendClient RecService = new RecommendClient(); for (int i = 0; i < fileList.Length; i++) { bool lastFile = (i == fileList.Length - 1); //start generator after last file try { string fileName = filePath + fileList[i]; if (!File.Exists(fileName)) continue; // file not found } // set up a file stream and binary reader for the selected file and convert to byte array FileStream fStream = new FileStream(fileName, FileMode.Open, FileAccess.Read); BinaryReader br = new BinaryReader(fStream); byte[] data = br.ReadBytes((int)numBytes); br.Close(); // pass byte array to the web service string result = RecService.UploadDataFile(clientAlias, fileList[i], data, lastFile); fStream.Close(); fStream.Dispose(); } catch (Exception ex) { // log an error message } } }

    Read the article

  • Deserialize json with json.net c#

    - by 76mel
    Hi, am new to Json so a little green. I have a Rest Based Service that returns a json string; {"treeNode":[{"id":"U-2905","pid":"R","userId":"2905"}, {"id":"U-2905","pid":"R","userId":"2905"}]} I have been playing with the Json.net and trying to Deserialize the string into Objects etc. I wrote an extention method to help. public static T DeserializeFromJSON<T>(this Stream jsonStream, Type objectType) { T result; using (StreamReader reader = new StreamReader(jsonStream)) { JsonSerializer serializer = new JsonSerializer(); try { result = (T)serializer.Deserialize(reader, objectType); } catch (Exception e) { throw; } } return result; } I was expecting an array of treeNode[] objects. But its seems that I can only deserialize correctly if treeNode[] property of another object. public class treeNode { public string id { get; set; } public string pid { get; set; } public string userId { get; set; } } I there a way to to just get an straight array from the deserialization ? Cheers

    Read the article

< Previous Page | 385 386 387 388 389 390 391 392 393 394 395 396  | Next Page >