Search Results

Search found 1228 results on 50 pages for 'comparing'.

Page 39/50 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • Checking for Repeated Strings in 2d list

    - by Zach Santiago
    i have a program where i have a list of names and classes. i have the list in alphabetical order. now im trying to check if names repeat, add the classes to one single name. im trying to write some code like go through names if name is already in list, add the class to the one name. so an example would be, instead of having 'Anita ','phys 1443', and 'Anita','IE 3312' i would just have 'Anita','PHYS 1443','IE 3312'. How would i go about doing this in a logival way, WITHOUT using any sort of built in functions? i tried comparing indexe's like if list[i][0] == list[i+1][0], append list[i+1][1] to an emptylist. while that almost worked, it would screw up at some points along the way. here is my attempt size = len(c) i = 0 c = [['Anita', 'PHYS 1443'], ['Anita', 'IE 3312'], ['Beihuang', 'PHYS 1443'], ['Chiao-Lin', 'MATH 1426'], ['Chiao-Lin', 'IE 3312'], ['Christopher', 'CSE 1310'], ['Dylan', 'CSE 1320'], ['Edmund', 'PHYS 1443'], ['Ian', 'IE 3301'], ['Ian', 'CSE 1320'], ['Ian', 'PHYS 1443'], ['Isis', 'PHYS 1443'], ['Jonathan', 'MATH 2325'], ['Krishna', 'MATH 2325'], ['Michael', 'IE 3301'], ['Nang', 'MATH 2325'], ['Ram', 'CSE 1320'], ['Taesu', 'CSE 1320'], ["Tre'Shaun", 'IE 3312'], ["Tre'Shaun", 'MATH 2325'], ["Tre'Shaun", 'CSE 1310']] ## Check if any names repeat d.append(c[0][0]) while i < size - 1 : if c[i][0] == c[i+1][0] : d.append(c[i][1]) d.append(c[i+1][1]) else : d.append(c[i+1][0]) d.append(c[i+1][1]) i = i + 1 print d output was. ['Anita', 'PHYS 1443', 'IE 3312', 'Beihuang', 'PHYS 1443', 'Chiao-Lin', 'MATH 1426', 'MATH 1426', 'IE 3312', 'Christopher', 'CSE 1310', 'Dylan', 'CSE 1320', 'Edmund', 'PHYS 1443', 'Ian', 'IE 3301', 'IE 3301', 'CSE 1320', 'CSE 1320', 'PHYS 1443', 'Isis', 'PHYS 1443', 'Jonathan', 'MATH 2325', 'Krishna', 'MATH 2325', 'Michael', 'IE 3301', 'Nang', 'MATH 2325', 'Ram', 'CSE 1320', 'Taesu', 'CSE 1320', "Tre'Shaun", 'IE 3312', 'IE 3312', 'MATH 2325', 'MATH 2325', 'CSE 1310']

    Read the article

  • Newly created Document library and columns using webservices are not visible on sharepoint

    - by Royson
    Hi, for creating a columns I worked on this code . and for creating document library Lists listService = new Lists(); listService.PreAuthenticate = true; listService.Credentials = new NetworkCredential(username,password,domain; String url = "http://YourServer/SiteName/"; listService.Url = url @ + /_vti_bin/lists.asmx"; XmlNode ndList = listService.AddList(NewListName, "Description", 101); Both are working successfully. But Problem i am facing is: New Columns and document library are not visible. I tried with comparing Field Value of Both Visible and No-Visible types. Difference i found is : Visible (Created Manually) doesn't contain Version value. were as i am creating have it. Can you help me out in this? EDIT: I checked contents of ndList node, List is created and it is visible on my UI. but on sharepoint it should be listed in 'Document' tab where default 'Shared Documents' library is shown. If i click on 'Documents' then we can also see all lib created by this code. Visible means library displayed under 'Documents' tab

    Read the article

  • Boost Mersenne Twister: how to seed with more than one value?

    - by Eamon Nerbonne
    I'm using the boost mt19937 implementation for a simulation. The simulation needs to be reproducible, and that means storing and potentially reusing the RNG seeds later. I'm using the windows crypto api to generate the seed values because I need an external source for the seeds and not because of any particular guarantees of randomness. The output of any simulation run will have a note including the RNG seed - so the seed needs to be reasonably short. On the other hand, as part of the analysis of the simulation, I'll be comparing several runs - but to be sure that these runs are actually different, I'll need to use different seeds - so the seed needs to be long enough to avoid accidental collisions. I've determined that 64-bits of seeding should suffice; the chance of a collision will reach 50% after about 2^32 runs - that probability is low enough that the average error caused by it is negligible to me. Using just 32-bits of seed is tricky; the chance of a collision reaches 50% already after 2^16 runs; and that's a little too likely for my tastes. Unfortunately, the boost implementation either seeds with a full state vector - which is far, far too long - or a single 32-bit unsigned long - which isn't ideal. How can I seed the generator with more than 32-bits but less than a full state vector? I tried just padding the vector or repeating the seeds to fill the state vector, but even a cursory glance at the results shows that that generates poor results.

    Read the article

  • Deriving an HTMLElement Object from jQuery Object

    - by Jasconius
    I'm doing a fairly exhaustive series of DOM manipulations where a few elements (specifically form elements) have some events. I am dynamically creating (actually cloning from a source element) several boxes and assigning a change() event to them. The change event executes, and within the context of the event, "this" is the HTML Element Object. What I need to do at this point however is determine a contact for this HTML Element Object. I have these objects stored already as jQuery entities in assorted arrays, but obviously [HTMLElement Object] != [Object Object] And the trick is that I cannot cast $(this) and make a valid comparison since that would create a new object and the pointer would be different. So... I've been banging my head against this for a while. In the past I've been able to circumvent this problem by doing an innerHTML comparison, but in this case the objects I am comparing are 100% identical, just there's lots of them. Therefore I need a solid comparison. This would be easy if I could somehow derive the HTMLElement object from my originating jQuery object. Thoughts, other ideas? Help. :(

    Read the article

  • Subversion versus Vault

    - by WebDude
    I'm currently reviewing the benefits of moving from SVN to a SourceGear Vault. Has anyone got advice or a link to a detailed comparison between the two? Bear in mind I would have to move my current Source Control system across which works strongly in SVN's favor Here is some info I have found out thus far from my own investigations. I have been taking some time tests between the two and vault seems to perform most operations much faster. Time tests used the same server as the repository, the same workstation client, and the same project. Time Comparisons SVN Add/Commit    12:30 Get Latest Revision    5:35 Tagging/Labelling    0:01 Branching    N/A - I don't think true branching exists in SVN Vault Add/Commit    4:45 Get Latest Revision    0:51 Tagging/Labelling    0:30 Branching    3:23 (can't get this to format correctly) I also found an online source comparing some other points. This is the kind of information i'm looking for. Usage Comparisons Subversion is edit/merge/commit only. Vault allows you to do either edit/merge/commit or checkout/edit/checkin. Vault looks and acts just like VSS, which makes the learning curve effectively zero for VSS users. Vault has a VS plugin, but it only works if you're going to run in checkout-mode. Subversion has clients for pretty much every OS you can imagine; Vault has a GUI client for Windows and a command line client for Mono. Both will support remote work, since both use HTTP as their transport (Subversion uses extended DAV, Vault uses SOAP). Subversion installation, especially w/ Apache, is more complex. Subversion has a lot of third party support. Vault has just a few things. My question Has anyone got advice or a link to a detailed comparison between the two?

    Read the article

  • IronRuby System.DateTime NilClass

    - by Sergey Mirvoda
    Why comparing to null is so unstable? Just code. IronRuby 0.9.4.0 on .NET 2.0.50727.4927 Copyright (c) Microsoft Corporation. All rights reserved. >>> require 'System' => true >>> i = System::Int32.MinValue => -2147483648 >>> i==nil => false >>> d = System::DateTime.Now => 11.02.2010 14:15:02 >>> d==nil (ir):1: can't convert NilClass into System::DateTime (TypeError) >>> In 9.1 this code works as expected. EDIT: workaround: >>> i.nil? => false >>> d.nil? => false >>> nil => nil >>> nil.nil? => true >>>

    Read the article

  • Cloud-aware programming and help choosing a good framework

    - by Shoaibi
    How can i write a cloud-aware application? e.g. an application that takes benefit of being deployed on cloud. Is it same as an application that runs or a vps/dedicated server? if not then what are the differences? are there any design changes? What are the procedures that i need to take if i am to migrate an application to cloud-aware? Also i am about to implement a web application idea which would need features like security, performance, caching, and more importantly free. I have been comparing some frameworks and found that django has least RAM/CPU usage and works great in prefork+threaded mode, but i have also read that django based sites stop to respond with huge load of connections. Other frameworks that i have seen/know are Zend, CakePHP, Lithium/Cake3, CodeIgnitor, Symfony, Ruby on Rails.... So i would leave this to your opinion as well, suggest me a good free framework based on my needs. Finally thanks for reading the essay ;)

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Video-codec rater by image comparison algorithm?

    - by Andreas Hornig
    Hi, perhaps anyone knows if this is possible. comparing image quality is almost imposible to describe without subjective influences. When someone rates an image quality as good there is at least one person, that doesn't think so. human preferences are always different. So, I would like to know if there is away to "rate" the image quality by an algorithm that compares the original image to the produced one in following issues colour change(difference pixel by pixel blur rate artifacts and macroblocking the first one would be the easiest one because you could check just the diffeence in colours and can give 3 values in +- of each hex-value both last once I don't know if this is possible, but the blocking could be detected by edge-finding. and the king's quest would be to do that for more then just one image, because video is done with several frames. perhaps you expert programmers could tell me, if such an automated algo can be done to bring some objective measurement divice into rating image quality. this could perhaps calm down some h.264 is better than x264 and better than vp8 and blaaah people :) Andreas 1st posted here http://www.hdtvtotal.com/index.php?name=PNphpBB2&file=viewtopic&p=9705

    Read the article

  • python raw_input odd behavior with accents containing strings

    - by Ryan
    I'm writing a program that asks the user for input that contains accents. The user input string is tested to see if it matches a string declared in the program. As you can see below, my code is not working: code # -*- coding: utf-8 -*- testList = ['má'] myInput = raw_input('enter something here: ') print myInput, repr(myInput) print testList[0], repr(testList[0]) print myInput in testList output in eclipse with pydev enter something here: má mv° 'm\xe2\x88\x9a\xc2\xb0' má 'm\xc3\xa1' False output in IDLE enter something here: má má u'm\xe1' má 'm\xc3\xa1' Warning (from warnings module): File "/Users/ryanculkin/Desktop/delete.py", line 8 print myInput in testList UnicodeWarning: Unicode equal comparison failed to convert both arguments to Unicode - interpreting them as being unequal False How can I get my code to print True when comparing the two strings? Additionally, I note that the result of running this code on the same input is different depending on whether I use eclipse or IDLE. Why is this? My eventual goal is to put my program on the web; is there anything that I need to be aware of, since the result seems to be so volatile?

    Read the article

  • In a digital photo, how can I detect if a mountain is obscured by clouds?

    - by Gavin Brock
    The problem I have a collection of digital photos of a mountain in Japan. However the mountain is often obscured by clouds or fog. What techniques can I use to detect that the mountain is visible in the image? I am currently using Perl with the Imager module, but open to alternatives. All the images are taken from the exact same position - these are some samples. My naïve solution I started by taking several horizontal pixel samples of the mountain cone and comparing the brightness values to other samples from the sky. This worked well for differentiating good image 1 and bad image 2. However in the autumn it snowed and the mountain became brighter than the sky, like image 3, and my simple brightness test started to fail. Image 4 is an example of an edge case. I would classify this as a good image since some of the mountain is clearly visible. UPDATE 1 Thank you for the suggestions - I am happy you all vastly over-estimated my competence. Based on the answers, I have started trying the ImageMagick edge-detect transform, which gives me a much simpler image to analyze. convert sample.jpg -edge 1 edge.jpg I assume I should use some kind of masking to get rid of the trees and most of the clouds. Once I have the masked image, what is the best way to compare the similarity to a 'good' image? I guess the "compare" command suited for this job? How do I get a numeric 'similarity' value from this?

    Read the article

  • decimal.TryParse() drops leading "1"

    - by Martin Harris
    Short and sweet version: On one machine out of around a hundred test machines decimal.TryParse() is converting "1.01" to 0.01 Okay, this is going to sound crazy but bare with me... We have a client applications that communicates with a webservice through JSON, and that service returns a decimal value as a string so we store it as a string in our model object: [DataMember(Name = "value")] public string Value { get; set; } When we display that value on screen it is formatted to a specific number of decimal places. So the process we use is string - decimal then decimal - string. The application is currently undergoing final testing and is running on more than 100 machines, where this all works fine. However on one machine if the decimal value has a leading '1' then it is replaced by a zero. I added simple logging to the code so it looks like this: Log("Original string value: {0}", value); decimal val; if (decimal.TryParse(value, out val)) { Log("Parsed decimal value: {0}", val); string output = val.ToString(format, CultureInfo.InvariantCulture.NumberFormat); Log("Formatted string value: {0}", output); return output; } On my machine - any every other client machine - the logfile output is: Original string value: 1.010000 Parsed decimal value: 1.010000 Formatted string value: 1.01 On the defective machine the output is: Original string value: 1.010000 Parsed decimal value: 0.010000 Formatted string value: 0.01 So it would appear that the decimal.TryParse method is at fault. Things we've tried: Uninstalling and reinstalling the client application Uninstalling and reinstalling .net 3.5 sp1 Comparing the defective machine's regional settings for numbers (using English (United Kingdom)) to those of a working machine - no differences. Has anyone seen anything like this or has any suggestions? I'm quickly running out of ideas... While I was typing this some more info came in: Passing a string value of "10000" to Convert.ToInt32() returns 0, so that also seems to drop the leading 1.

    Read the article

  • Why is the Clojure Hello World program so slow compared to Java and Python?

    - by viksit
    Hi all, I'm reading "Programming Clojure" and I was comparing some languages I use for some simple code. I noticed that the clojure implementations were the slowest in each case. For instance, Python - hello.py def hello_world(name): print "Hello, %s" % name hello_world("world") and result, $ time python hello.py Hello, world real 0m0.027s user 0m0.013s sys 0m0.014s Java - hello.java import java.io.*; public class hello { public static void hello_world(String name) { System.out.println("Hello, " + name); } public static void main(String[] args) { hello_world("world"); } } and result, $ time java hello Hello, world real 0m0.324s user 0m0.296s sys 0m0.065s and finally, Clojure - hellofun.clj (defn hello-world [username] (println (format "Hello, %s" username))) (hello-world "world") and results, $ time clj hellofun.clj Hello, world real 0m1.418s user 0m1.649s sys 0m0.154s Thats a whole, garangutan 1.4 seconds! Does anyone have pointers on what the cause of this could be? Is Clojure really that slow, or are there JVM tricks et al that need to be used in order to speed up execution? More importantly - isn't this huge difference in performance going to be an issue at some point? (I mean, lets say I was using Clojure for a production system - the gain I get in using lisp seems completely offset by the performance issues I can see here). The machine used here is a 2007 Macbook Pro running Snow Leopard, a 2.16Ghz Intel C2D and 2G DDR2 SDRAM. BTW, the clj script I'm using is from here and looks like, #!/bin/bash JAVA=/System/Library/Frameworks/JavaVM.framework/Versions/1.6/Home/bin/java CLJ_DIR=/opt/jars CLOJURE=$CLJ_DIR/clojure.jar CONTRIB=$CLJ_DIR/clojure-contrib.jar JLINE=$CLJ_DIR/jline-0.9.94.jar CP=$PWD:$CLOJURE:$JLINE:$CONTRIB # Add extra jars as specified by `.clojure` file if [ -f .clojure ] then CP=$CP:`cat .clojure` fi if [ -z "$1" ]; then $JAVA -server -cp $CP \ jline.ConsoleRunner clojure.lang.Repl else scriptname=$1 $JAVA -server -cp $CP clojure.main $scriptname -- $* fi

    Read the article

  • Looking for merge tool with very good in-line-comparison support

    - by peter p
    I have seen this topic discussed several times, but emphasis is on "very good in-line-comparison" here, which was not really covered by those threads. E.g. I would like the tool to recognize and highlight that the resource "colorpicker_newstring" has been added when comparing the following two blocks. WinMerge and Kdiff both fail... Does anyone know a software that does not? I am using Windows. Ah, and I'd prefer free/OS software, of course. Thanks a lot in advance, Peter File A: <resource name="colorpicker_title">Color picker</resource> <resource name="colorpicker_apply">Apply</resource> <resource name="colorpicker_transparent">Transparent</resource> <resource name="colorpicker_htmlcolor">HTML color</resource> <resource name="colorpicker_red">Red</resource> <resource name="colorpicker_newstring">New String</resource> <resource name="colorpicker_green">Green</resource> <resource name="colorpicker_blue">Blue</resource> <resource name="colorpicker_alpha">Alpha</resource> <resource name="colorpicker_recentcolors">Recently used colors</resource> File B: <resource name="colorpicker_title">Sélecteur de couleur</resource> <resource name="colorpicker_apply">Appliquer</resource> <resource name="colorpicker_transparent">Transparent</resource> <resource name="colorpicker_htmlcolor">Couleur HTML</resource> <resource name="colorpicker_red">Rouge</resource> <resource name="colorpicker_green">Vert</resource> <resource name="colorpicker_blue">Bleu</resource> <resource name="colorpicker_alpha">Alpha</resource> <resource name="colorpicker_recentcolors">Couleurs récentes</resource>

    Read the article

  • Documentation for java.util.concurrent.locks.ReentrantReadWriteLock

    - by Andrei Taptunov
    Disclaimer: I'm not very good at Java and just comparing read/writer locks between C# and Java to understand this topic better & decisions behind both implementations. There is JavaDoc about ReentrantReadWriteLock. It states the following about upgrade/downgrade for locks: Lock downgrading ... However, upgrading from a read lock to the write lock is not possible. It also has the following example that shows manual upgrade from read lock to write lock: // Here is a code sketch showing how to exploit reentrancy // to perform lock downgrading after updating a cache void processCachedData() { rwl.readLock().lock(); if (!cacheValid) { // upgrade lock manually #1: rwl.readLock().unlock(); // must unlock first to obtain writelock #2: rwl.writeLock().lock(); if (!cacheValid) { // recheck ... } ... } use(data); rwl.readLock().unlock(); Does it mean that actually the sample from above may not behave correctly in some cases - I mean there is no lock between lines #1 & #2 and underlying structure is exposed to changes from other threads. So it can not be considered as the correct way to upgrade the lock or do I miss something here?

    Read the article

  • iphone certain PDFs rendering as black image

    - by skantner
    I'm trying to draw the pages of a PDF using the code below. Some PDF's render correctly, but others simply show as a completely black image, or have partial portions rendered and the rest black. In comparing what's going on, the ones that show OK seem to have always have "regular" text in them along with some graphics (diagrams, etc.), while the ones that come out black are typically all graphics (like a page of sheet music, for example). Can anyone point me in the right direction on this? I building this on the new 3.2 SDK. Thanks! // PDF page drawing expects a Lower-Left coordinate system, so we flip the coordinate system // before we start drawing. CGContextTranslateCTM(context, 0.0, self.bounds.size.height); CGContextScaleCTM(context, 1.0, -1.0); // Grab the first PDF page CGPDFPageRef page = CGPDFDocumentGetPage(myPDF, pageNo); // We're about to modify the context CTM to draw the PDF page where we want it, so save the graphics state in case we want to do more drawing CGContextSaveGState(context); // CGPDFPageGetDrawingTransform provides an easy way to get the transform for a PDF page. It will scale down to fit, including any // base rotations necessary to display the PDF page correctly. CGAffineTransform pdfTransform = CGPDFPageGetDrawingTransform(page, kCGPDFCropBox, self.bounds, 0, true); // And apply the transform. CGContextConcatCTM(context, pdfTransform); // Finally, we draw the page and restore the graphics state for further manipulations! CGContextDrawPDFPage(context, page); CGContextRestoreGState(context);

    Read the article

  • Using MinHash to find similiarities between 2 images

    - by Sung Meister
    I am using MinHash algorithm to find similar images between images. I have run across this post, How can I recognize slightly modified images? which pointed me to MinHash algorithm. Being a bit mathematically challenged, I was using a C# implementation from this blog post, Set Similarity and Min Hash. But while trying to use the implementation, I have run into 2 problems. What value should I set universe value to? When passing image byte array to HashSet, it only contains distinct byte values; thus comparing values from 1 ~ 256. What is this universe in MinHash? And what can I do to improve the C# MinHash implementation? Since HashSet<byte> contains values upto 256, similarity value always come out to 1. Here is the source that uses the C# MinHash implementation from Set Similarity and Min Hash: class Program { static void Main(string[] args) { var imageSet1 = GetImageByte(@".\Images\01.JPG"); var imageSet2 = GetImageByte(@".\Images\02.TIF"); //var app = new MinHash(256); var app = new MinHash(Math.Min(imageSet1.Count, imageSet2.Count)); double imageSimilarity = app.Similarity(imageSet1, imageSet2); Console.WriteLine("similarity = {0}", imageSimilarity); } private static HashSet<byte> GetImageByte(string imagePath) { using (var fs = new FileStream(imagePath, FileMode.Open, FileAccess.Read)) using (var br = new BinaryReader(fs)) { //List<int> bytes = br.ReadBytes((int)fs.Length).Cast<int>().ToList(); var bytes = new List<byte>(br.ReadBytes((int) fs.Length).ToArray()); return new HashSet<byte>(bytes); } } }

    Read the article

  • Problem with .Contains

    - by Rene
    Hello there, I have a little problem which i can't solve. I want to use an SQL-In-Statement in Linq. I've read in this Forum and in other Forums that I have to use the .Contains (with reverse-thinking-notation :-)). As input i have a List of Guids. I first copied them into an array and then did something like that : datatoget = (from p in objectContext.MyDataSet where ArrayToSearch.Contains(p.Subtable.Id.ToString()) select p).ToList(); datatoget is the result in which all records matching the Subtable.Id (which is a Guid) should be stored. Subtable is a Detail-Table from MyData, and the Id is a Guid-Type. I've tried several things (Convert Guid to String, and then using .Contains, etc), but I always get an Exception which says : 'Linq to Entities' doesn't recognize the Method 'Boolean Contains(System.Guid) and is not able to Translate this method into a memory expression. (Something like that, because I'm using the German Version of VS2008) I am using L2E with .NET 3.5 and am programming in C# with VS 2008. I've read several Examples, but it doesn't work. Is it perhaps because of using Guid's instead of strings ? I've also tried to write my own compare-function, but I don't know how to integrate it so that .NET calls my function for comparing.

    Read the article

  • Is it possible to update old database from dbml file ? (C#, .Net 4, Linq, SQL Server)

    - by Emil
    Hi all, I began recently a new job, a very interesting project (C#,.Net 4, Linq, VS 2010 and SQL Server). And immediately I got a very exciting challenge: I must implement either a new tool or integrate the logic when program start, or whatever, but what must happen is the following: the customers have previous application and database (full with their specific data). Now a new version is ready and the customer gets the update. In the mean time we made some modification on DB (new table, columns, maybe an old column deleted, or whatever). I’m pretty new in Linq and also SQL databases and my first solution can be: I check the applications/databases version and implement all the changes step by step comparing all tables, columns, keys, constrains, etc. (all this new information I have in my dbml and the old I asked from the existing DB). And I’ll do this each time the version changed. But somehow I feel, this is NOT a smart solution so I look for a general solution of this problem. Is there a way to update customers DB from the dbml file? To create a new one is not a problem (CreateDatabase with DataContext), is there any update/alter database methods? I guess I’m not the only one who search for such a solution (I found nothing in internet – or I looked for bad keywords). How did you solve this problem? I look also for an external tool, but first for a solution with C#, Linq or something similar. For any idea thank you in advance! Best regards, Emil

    Read the article

  • how to compare the two xml files and update the one xml file in java?

    - by prasad.gai
    I have created two xml files from those xml file i would like to compare one xml file with another xml file and update the xml file. I have created an xml file as follows: main.xml <?xml version="1.0" encoding="utf-8"?> <ScrollView xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="fill_parent" android:background="#00BFFF"> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" android:layout_width="fill_parent" android:layout_height="fill_parent" android:orientation="vertical"> <LinearLayout android:id="@+id/linearLayout1" android:layout_width="fill_parent" android:layout_height="wrap_content" android:gravity="center" android:visibility="visible"> </LinearLayout> <LinearLayout android:id="@+id/linearLayout2" android:layout_width="fill_parent" android:layout_height="wrap_content" android:gravity="center" android:visibility="visible"> </LinearLayout> </LinearLayout> </ScrollView> properties.xml <?xml version='1.0' encoding='utf-8' standalone='yes' ?> <map> <int name="linearLayout1" value="8" /> <int name="linearLayout2" value="0" /> </map> from the above two xml files i would like to compare with LinearLayout android:id ="@id/LinearLayout1" from main.xml with int name ="linearLayout1" from properties.xml. from the above properties.xml file where name ="linearLayout1" and value ="8" then i would like to update the main.xml file where as LinearLayout android:id="@id/linearLayout1" propertie value as android:visibility="gone" From the above xml file how can i update main.xml file by comparing properties.xml? please any body help me.....

    Read the article

  • How can I add a "Loading...Please wait..." feature?

    - by Rob
    I have a very simple table on my website, that displays different URL's. I have an input field where I can type in a URL and click 'Submit' to add additional URL's. However, I want to add an MD5 grabbing feature to this, using @md5_file(); to grab the MD5 of the URL and check to make sure it's the MD5 it should be, before adding it to the database. However it may take a few seconds for it to grab the MD5 and compare it, so I would like to add a little bit of text, like "Processing...Please wait..." while it does the comparing, and then once it's compared I want that text to go away. I've never done this before, or even though about doing it so I have no idea where to start. I'll go ahead and put javascript as a tag for this, since I'm guessing it would be done with javascript, but I really have no idea. I don't think it's possible with PHP, but again, I have no idea. Any suggestions?

    Read the article

  • Git Diff with Beyond Compare

    - by Avanst
    I have succeeded in getting git to start Beyond Compare 3 as a diff tool however, when I do a diff, the file I am comparing against is not being loaded. Only the latest version of the file is loaded and nothing else, so there is nothing in the right pane of Beyond Compare. I am running git 1.6.3.1 with Cygwin with Beyond Compare 3. I have set up beyond compare as they suggest in the support part of their website with a script like such: #!/bin/sh # diff is called by git with 7 parameters: # path old-file old-hex old-mode new-file new-hex new-mode "path_to_bc3_executable" "$2" "$5" | cat Has anyone else encountered this problem and know a solution to this? Edit: I have followed the suggestions by VonC but I am still having exactly the same problem as before. I am kinda new to Git so perhaps I am not using the diff correctly. For example, I am trying to see the diff on a file with a command like such: git diff main.css Beyond Compare will then open and only display my current main.css in the left pane, there is nothing in the right pane. I would like the see my current main.css in the left pane compared to the HEAD, basically what I have last committed. My git-diff-wrapper.sh looks like this: #!/bin/sh # diff is called by git with 7 parameters: # path old-file old-hex old-mode new-file new-hex new-mode "c:/Program Files/Beyond Compare 3/BCompare.exe" "$2" "$5" | cat My git config looks like this for Diff: [diff] external = c:/cygwin/bin/git-diff-wrapper.sh

    Read the article

  • Join + IEqualityComparer<T> and HashCode

    - by Jesus Rodriguez
    Im writing my own LINQ reference but Im getting troubles with some of the more complicated operators implementations. There is a Join implementation that takes a IEqualityComparer Im getting just crazy. Im trying to understand it first before I write (obviously) Image this two lists: List<string> initials = new List<string> {"A", "B", "C", "D", "E"}; List<string> words = new List<string> {"Ant", "Crawl", "Pig", "Boat", "Elephant", "Arc"}; Nothing weird here. I want to join both lists by the Initial, something like: Initial=A Word=Ant Initial=A Word=Arc Initial=B Word=Boat ... I need a comparator, I wrote this: public class InitialComparator : IEqualityComparer<string> { public bool Equals(string x, string y) { return x.StartsWith(y); } public int GetHashCode(string obj) { return obj[0].GetHashCode(); } } The Join itself: var blah = initials.Join(words, initial => initial, word => word, (initial, word) => new {Initial = initial, Word = word}, new InitialComparator()); It's the first time Im using HashCodes, after a good session of debugging I see that every word go to the comparator and look at its HashCode, if another word has the same HashCode it calls equals. Since I want to compare just the initial I though that I just need the first letter Hash (Am I wrong?) The thing is that this is not working correctly. Its says that "Ant" and "Arc" are equals, Ok, its comparing every word in the same list or not, But it adds only the last word it finds, in this case Arc, ignoring Ant and Ant is equals to "A" too... If I put "Ant" and "Ant" it add both. In short, What is the way of doing something like that? I know that Im doing something wrong. Thank you.

    Read the article

  • T-SQL - Left Outer Joins - Fileters in the where clause versus the on clause.

    - by Greg Potter
    I am trying to compare two tables to find rows in each table that is not in the other. Table 1 has a groupby column to create 2 sets of data within table one. groupby number ----------- ----------- 1 1 1 2 2 1 2 2 2 4 Table 2 has only one column. number ----------- 1 3 4 So Table 1 has the values 1,2,4 in group 2 and Table 2 has the values 1,3,4. I expect the following result when joining for Group 2: `Table 1 LEFT OUTER Join Table 2` T1_Groupby T1_Number T2_Number ----------- ----------- ----------- 2 2 NULL `Table 2 LEFT OUTER Join Table 1` T1_Groupby T1_Number T2_Number ----------- ----------- ----------- NULL NULL 3 The only way I can get this to work is if I put a where clause for the first join: PRINT 'Table 1 LEFT OUTER Join Table 2, with WHERE clause' select table1.groupby as [T1_Groupby], table1.number as [T1_Number], table2.number as [T2_Number] from table1 LEFT OUTER join table2 --****************************** on table1.number = table2.number --****************************** WHERE table1.groupby = 2 AND table2.number IS NULL and a filter in the ON for the second: PRINT 'Table 2 LEFT OUTER Join Table 1, with ON clause' select table1.groupby as [T1_Groupby], table1.number as [T1_Number], table2.number as [T2_Number] from table2 LEFT OUTER join table1 --****************************** on table2.number = table1.number AND table1.groupby = 2 --****************************** WHERE table1.number IS NULL Can anyone come up with a way of not using the filter in the on clause but in the where clause? The context of this is I have a staging area in a database and I want to identify new records and records that have been deleted. The groupby field is the equivalent of a batchid for an extract and I am comparing the latest extract in a temp table to a the batch from yesterday stored in a partioneds table, which also has all the previously extracted batches as well. Code to create table 1 and 2: create table table1 (number int, groupby int) create table table2 (number int) insert into table1 (number, groupby) values (1, 1) insert into table1 (number, groupby) values (2, 1) insert into table1 (number, groupby) values (1, 2) insert into table2 (number) values (1) insert into table1 (number, groupby) values (2, 2) insert into table2 (number) values (3) insert into table1 (number, groupby) values (4, 2) insert into table2 (number) values (4)

    Read the article

  • Defining < for STL sort algorithm - operator overload, functor or standalone function?

    - by Andy
    I have a stl::list containing Widget class objects. They need to be sorted according to two members in the Widget class. For the sorting to work, I need to define a less-than comparator comparing two Widget objects. There seems to be a myriad of ways to do it. From what I can gather, one can either: a. Define a comparison operator overload in the class: bool Widget::operator< (const Widget &rhs) const b. Define a standalone function taking two Widgets: bool operator<(const Widget& lhs, const Widget& rhs); And then make the Widget class a friend of it: class Widget { // Various class definitions ... friend bool operator<(const Widget& lhs, const Widget& rhs); }; c. Define a functor and then include it as a parameter when calling the sort function: class Widget_Less : public binary_function<Widget, Widget, bool> { bool operator()(const Widget &lhs, const Widget& rhs) const; }; Does anybody know which method is better? In particular I am interested to know if I should do 1 or 2. I searched the book Effective STL by Scott Meyer but unfortunately it does not have anything to say about this. Thank you for your reply.

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >