Search Results

Search found 22062 results on 883 pages for 'save location'.

Page 39/883 | < Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >

  • SkyDrive broken after upgrade to Windows 8.1: "This location can't be found, please try later"

    - by avo
    Upgrading from Windows 8 to Windows 8.1 via the Store upgrade path has screwed my SkyDrive. The C:\Users\<user name>\SkyDrive folder is empty (it only has single file desktop.ini). When I open the native (Store) SkyDrive app, I see "This location can't be found, please try later". I'm glad to still have my files alive online in my SkyDrive account. I tried disconneting from / reconnecting to my Microsoft Account with no luck. Anyone has an idea on how to fix this without reinstalling/refreshing Windows 8.1? From Event Viewer: Faulting application name: skydrive.exe, version: 6.3.9600.16412, time stamp: 0x5243d370 Faulting module name: unknown, version: 0.0.0.0, time stamp: 0x00000000 Exception code: 0x00000000 Fault offset: 0x0000000000000000 Faulting process ID: 0x4e8 Faulting application start time: 0x01cece256589c7ee Faulting application path: C:\Windows\System32\skydrive.exe Faulting module path: unknown Report ID: {...} Faulting package full name: Faulting package-relative application ID: Also: The machine-default permission settings do not grant Local Activation permission for the COM Server application with CLSID {C2F03A33-21F5-47FA-B4BB-156362A2F239} and APPID {316CDED5-E4AE-4B15-9113-7055D84DCC97} to the user NT AUTHORITY\LOCAL SERVICE SID (S-1-5-19) from address LocalHost (Using LRPC) running in the application container Unavailable SID (Unavailable). This security permission can be modified using the Component Services administrative tool. Never was a big fan of in-place upgrade anyway, but this time it was a machine which I use for work, with a lot of stuff already installed on it. Shouldn't have tried to upgrade it in the first place, but was convinced Windows 8.1 is a solid update. Another lesson learnt.

    Read the article

  • Wget save cookies not working

    - by TrymBeast
    I've been trying to login in the pyload through the web api, but wget is not saving the cookies and I don't understand why. I'm using the following command: wget --delete-after --keep-session-cookies --save-cookies=my_cookies.txt --post-data="username=USERNAME&password=PASSWORD" http://localhost:8000/api/login But the content of my_cookies.txt is: # HTTP cookie file. # Generated by Wget on 2012-06-23 22:31:33. # Edit at your own risk. When I run the same command but in debug mode I get the following output that includes the set cookie in the header response: DEBUG output created by Wget 1.10.2 (Red Hat modified) on linux-gnueabi. --22:31:11-- http://localhost:8000/api/login Resolving localhost... 127.0.0.1 Caching localhost => 127.0.0.1 Connecting to localhost|127.0.0.1|:8000... connected. Created socket 3. Releasing 0x000504d0 (new refcount 1). ---request begin--- POST /api/login HTTP/1.0 User-Agent: Wget/1.10.2 (Red Hat modified) Accept: */* Host: localhost:8000 Connection: Keep-Alive Content-Type: application/x-www-form-urlencoded Content-Length: 32 ---request end--- [POST data: username=USERNAME&password=PASSWORD] HTTP request sent, awaiting response... ---response begin--- HTTP/1.1 200 OK Content-Length: 34 Content-Type: application/json Cache-Control: no-cache, must-revalidate Set-cookie: beaker.session.id=405390ddc809efed54820638c95d7997; expires=Tue, 19-Jan-2038 04:14:07 GMT; Path=/ Connection: Keep-Alive Date: Sat, 23 Jun 2012 21:31:11 GMT Server: CherryPy/3.1.2 WSGI Server ---response end--- 200 OK hs->local_file is: login (not existing) Registered socket 3 for persistent reuse. TEXTHTML is on. Length: 34 [application/json] Saving to: `login' 100%[=======================================>] 34 --.-K/s in 0s 22:31:11 (1.28 MB/s) - `login' saved [34/34] Removing file due to --delete-after in main(): Removing login. Saving cookies to my_cookies.txt. Done saving cookies. Can anyone tell me what am I doing wrong? Thanks in advance!

    Read the article

  • come on!teach u save photos from iphone to computer

    - by goodm
    i am using iphone ,when we have fun,we took a lot of nice pics ,but,that is a question,how to transfer photos from iphone to computer,now ,let me show you,step by step: Step 1: Download Tansee iPhone Transfer Photo free trial version here,and then install it. You also need iTunes above 7.3 installed.or download at: http://www.softseeking.com/prodail.aspx?proid=74 Step 2: Connect iPhone to your computer. Step 3: Launch Tansee iPhone Transfer Photo and all the photos in your iPhone will display automatically, Step 4: Select the photos to be transferred to your computer, the selected file will marked with red border. You can select photos by click on each one, or just drag a rectangle to select a bundle of photos. You can also select all photos by click right button of your mouse or click "File" to choose. Note: you can only select first 6 photos if you haven't purchase. Step 5: Click "Copy" button to select output path and start to transfer photos to your computer: iPhone Camera Photo & Camera Video: Click "Camera Roll", do as steps above can copy your iPhone Camera Photos and iPhone Camera Videos to PC. Options Setting 1.Backup File Format: To select backup photo file format, Tansee iPhone Transfer Photo support BMP and JPG file now. 2.Backup Path: To select directory for storing the backup photos. You can select backup directory for each photo during backup by check "Ask Every Time" or store all files in a specified directory by checking "Save Here" and select the directory in the edit box. 3.Backup Resolution: To select the photo size to be backup.

    Read the article

  • Default /server-status location not inheriting in Apache

    - by rmalayter
    I'm having a problem getting /server-status to work Apache 2.2.14 on Ubuntu Server 10.04.1. The default symlinks for status.load and status.conf are present in /etc/apache2/mods-enabled. The status.conf does include the location /server-status and appropriate allow/deny directives. However, the only vhost I have in sites-enabled looks like this. The idea is to proxy anything with a Tomcat URL to a cluster of tomcats, and anything else to an IIS box. However, this seems to result in requests to /server-status being sent to IIS. Copying the /server-status in explicitly to the Vhost configuration doesn't seem to help, no matter what order I use. Is it possible to include /server-status do this within a vhost configuration that has a "default" proxy rule?: <VirtualHost *:80> ServerAdmin webmaster@localhost DocumentRoot /var/www Header add Set-Cookie "ROUTEID=.%{BALANCER_WORKER_ROUTE}e; path=/" env=BALANCER_ROUTE_CHANGED <Proxy balancer://tomcatCluster> BalancerMember ajp://qa-app1:8009 route=1 BalancerMember ajp://qa-app2:8009 route=2 ProxySet stickysession=ROUTEID </Proxy> <ProxyMatch "^/(mytomcatappA|mytomcatappB)/(.*)" > ProxyPassMatch balancer://tomcatCluster/$1/$2 </ProxyMatch> #proxy anything that's not a tomcat URL to IIS on port 80 <Proxy /> ProxyPass http://qa-web1/ </Proxy>

    Read the article

  • can't save or create files in external hard disk

    - by Rodniko
    i formatted my computer and installed new win7. i connected my external hard disk (usb connector) and i have some kind of permission problem. i can't save files after opening them and right clicking and choosing "new" shows that i can only create folders. what is wrong ? why doesn't the external hd doesn't have permission and how do i cahnge it? in microsoft they probably thought: "hmmm.... how would i make it difficult for the user to use our product..." , "we will have to make the difficulty as soon as the windows is installed...." " but how would we guarantee 100% for the user to have problems? "oh yhe! block creating files and saving them, yes!" i'm so tired of those guys... my HD is half a Terra, changing ownership of all the files inside will take a couple of hours , i need other ideas... if any...

    Read the article

  • problems with retrieving data that was saved outside of a grails webflow

    - by callie16
    Hi, this is actually connected to an earlier question of mine here. Anyway, I have 3 domains that look like this: class A { ... static hasMany = [ b : B ] ... } class B { ... static belongsTo = [ a : A ] static hasMany = [ c : C ] ... } class C { ... static belongsTo = [ b : B ] ... } In my GSP page, I call an action in the Controller via a remote function in a javascript block (I'm using Dojo so I'm passing data to be saved this way... it's not a form per se so I use JSON for now to pass the data to the Controller). Let's say, I'm calling something like this: def someAction = { def jsonArr = [parse the JSON here] def tmpA = A.get(params.id) ... def tmpB = new B() b.someParam = jsonArr.someParam ... def tmpC = new C() tmpC.cParam = jsonArr.cParam tmpB.addToC(tmpC) tmpB.save(flush: true) //this may or may not be here but I'm adding it for the sake of completeness tmpA.addToB(tmpB) tmpA.save(flush: true) // NOTE: If I check here via println or whatnot, tmpA has a tmpB which has a tmpC... in other words, the data got saved. It's also in the DB. redirect(action: 'order' ...) } Then comes the fun part. Here's the webflow sample: def orderFlow = { ... someStateIShouldEndUpIn { on("next") { // or on previous... doesn't matter def anId = params.id def currA = A.get(anId) // this does NOT return a null value def testB = currA.b // this DOES return a null value }.to("somePage") ... } ... } Any ideas on why this happens? Moreover, when I dump the data of currA, b=null... instead of b=[] or b=[contents of tmpB]. Any help would be seriously appreciated... been at this for a couple of days now... Thanks!

    Read the article

  • Skyrim: Heavy Performance Issues after a couple of location changes

    - by Derija
    Okay, I've tried different solutions: ENB Series, removing certain mods, checking my FPS Rate, monitoring my resources, .ini tweaks. It's all just fine, I don't see what I'm missing. A couple of days ago, I bought Skyrim. Before I bought the game, I admit I had a pirated copy because my girlfriend actually wanted to buy me the game as a present, then said she didn't have enough money. Sick of waiting, I decided to buy the game by myself. The ridiculous part is, it worked better cracked than it does now uncracked. As the title suggests, after entering and leaving houses a couple of times, my performance obviously drops extremely. My build is just fine, Intel i5 quad core processor, NVIDIA GTX 560 Ti from Gigabyte, actually stock-OC, but manually downclocked to usual settings using appropriate Gigabyte software. This fixed the CTD issues I had before with both Skyrim and BF3. I have 4GB RAM. A website about Game Tweaks suggested that my HDD may be too slow. A screenshot of a Windows Performance Index sample with the subscription "This is likely to cause issues" showed the HDD with a performance index of 5.9, the exact same mine has, so I was playing with the thought to purchase an SSD instead, load games onto it that really need it like Skyrim, and hope it'd do the trick. Unfortunately, SSDs are likewise expensive, compared to "normal" HDDs... I'm really getting desperate about it. My save is gone because the patches made it impossible to load saves of the unpatched version and I already saved more than 80 times despite being only level 8, just because every time I interact with a door leading me to another location I'm scared the game will drop again. I can't even play for 30 mins straight anymore, it's just no fun at all. I've researched for a couple of days before I decided to post my question here. Any help is appreciated, I don't want to regret having bought the game... Since it actually is the best game I've played possibly for ever. Sincerely. P.S.: I don't think it's necessary to say, but still, of course I'm playing on PC. P.P.S.: After monitoring both my PC resources including CPU usage and HDD usage as well as the GPU usage, I don't see any changes even after the said event. P.P.P.S.: Original question posted here where I've been advised to ask here.

    Read the article

  • filtering itunes library items by file location

    - by Cawas
    3 answers and unfortunately no solution yet. The Problem I've got way more than 1000 duplicated items in my iTunes Library pointing to a non-existant place (the "where" under "get info" window), along with other duplicated items and other MIAs (Missing In Action). Is there any simple way to just delete all of them and only them? From the library, of course. By that I mean some MIAs are pointing to /Volumes while some are pointing to .../music/Music/... or just .../music/.... I want to delete all pointing to /Volumes as to later I'll recover the rest. Check the image below. Some Background I tried searching for a specific key word on the path and creating smart play list, but with no result. Being able to just sort all library by path would be a perfect solution! I believe old iTunes could do that. PowerTunes can do it (sort by path) but I can't do anything with its list. I would also welcome any program able to handle this, then import and properly export back the iTunes library. Since this seems to just not be clear enough... AppleScript doesn't work That's because AppleScript just can't gather the missing info anywhere in iTunes Library. Maybe we could use AppleScript by opening the XML file, but that's a whole nother issue. Here's a quote from my conversation with Doug the man himself Adams last december: I don't think you do understand. There is no way to get the path to the file of a dead track because iTunes has "forgotten" it. That is, by definition, what a dead track is. Doug On Dec 21, 2010, at 7:08 AM, Caue Rego wrote: yes I understand that and have seem the script. but I'm not looking for the file. just the old broken path reference to it. Sent from my iPhone On 21/12/2010, at 10:00, Doug Adams wrote: You cannot locate missing files of dead tracks because, by definition, a dead track is one that doesn't have any file information. If you look at "Super Remove Dead Tracks", you will notice it looks for tracks that have "missing value" for the location property.

    Read the article

  • phpexcel write excel and save ?

    - by boss
    code: <?php /** PHPExcel */ require_once '../Classes/PHPExcel.php'; /** PHPExcel_IOFactory */ require_once '../Classes/PHPExcel/IOFactory.php'; // Create new PHPExcel object $objPHPExcel = new PHPExcel(); // Set properties $objPHPExcel->getProperties()->setCreator("Maarten Balliauw") ->setLastModifiedBy("Maarten Balliauw") ->setTitle("Office 2007 XLSX Test Document") ->setSubject("Office 2007 XLSX Test Document") ->setDescription("Test document for Office 2007 XLSX, generated using PHP classes.") ->setKeywords("office 2007 openxml php") ->setCategory("Test result file"); $result = 'select * from table1'; for($i=0;$i<count($result);$i++){ $result1 = 'select * from table2 where table1_id = ' . $result[$i]['table1_id']; for ($j=0;$j<count($result1);$j++) { $objPHPExcel->setActiveSheetIndex(0)->setCellValue('A' . $j, $result1[$j]['name']); } // Set active sheet index to the first sheet, so Excel opens this as the first sheet $objPHPExcel->setActiveSheetIndex(0); // Save Excel 2007 file $objWriter = PHPExcel_IOFactory::createWriter($objPHPExcel, 'Excel2007'); $objWriter->save(str_replace('.php', '.xlsx', __FILE__)); // Echo done echo date('H:i:s') . " Done writing file.\r\n"; } ?> The above code executes and save n no of .xlsx files in the folder, but the problem im getting is biggest count(result1) in the for loop executing in all saved excel files. Please give me the solution.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Different location of assemblies stoped the type casting.

    - by smwikipedia
    I am writing a custom Control class in C# for my main project. There're 2 projects, one for my Control and one for my main project. These 2 projects are in the same solution. I add a reference from my main project to my Control project. I notice that the first time after I drag my Control from the Tool Panel onto my main winform, an assembly folder was generated at the C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and the folder name is something like "jlebh-py01". The first build is always OK, but after I rebuild my Control class or whole solution, a new assembly folder will be generated at C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies, and then problem arises, my Control fails to behave well because Visual Studio says that the two types "originates from different location". The error message is as below: [A]MyControl.TypeXXX cannot be cast to [B]MyControl.TypeXXX. Type A orginates from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\jlebh-py01\MyControl.dll' Type B originats from assemblyXXX at location 'C:\Users\XXX\AppData\Local\Microsoft\VisualStudio\9.0\ProjectAssemblies\ue4i-z3j01\MyControl.dll' If I reference the Control DLL directly instead of through project reference, or never rebuild the Control project after use my Control in the main project, things seem to be OK. Does anyone knows why? Is it the proper way to develop a control and a main project within the same solution? Many thanks...

    Read the article

  • Invalidating Memcached Keys on save() in Django

    - by Zack
    I've got a view in Django that uses memcached to cache data for the more highly trafficked views that rely on a relatively static set of data. The key word is relatively: I need invalidate the memcached key for that particular URL's data when it's changed in the database. To be as clear as possible, here's the meat an' potatoes of the view (Person is a model, cache is django.core.cache.cache): def person_detail(request, slug): if request.is_ajax(): cache_key = "%s_ABOUT_%s" % settings.SITE_PREFIX, slug # Check the cache to see if we've already got this result made. json_dict = cache.get(cache_key) # Was it a cache hit? if json_dict is None: # That's a negative Ghost Rider person = get_object_or_404(Person, display = True, slug = slug) json_dict = { 'name' : person.name, 'bio' : person.bio_html, 'image' : person.image.extra_thumbnails['large'].absolute_url, } cache.set(cache_key) # json_dict will now exist, whether it's from the cache or not response = HttpResponse() response['Content-Type'] = 'text/javascript' response.write(simpljson.dumps(json_dict)) # Make sure it's all properly formatted for JS by using simplejson return response else: # This is where the fully templated response is generated What I want to do is get at that cache_key variable in it's "unformatted" form, but I'm not sure how to do this--if it can be done at all. Just in case there's already something to do this, here's what I want to do with it (this is from the Person model's hypothetical save method) def save(self): # If this is an update, the key will be cached, otherwise it won't, let's see if we can't find me try: old_self = Person.objects.get(pk=self.id) cache_key = # Voodoo magic to get that variable old_key = cache_key.format(settings.SITE_PREFIX, old_self.slug) # Generate the key currently cached cache.delete(old_key) # Hit it with both barrels of rock salt # Turns out this doesn't already exist, let's make that first request even faster by making this cache right now except DoesNotExist: # I haven't gotten to this yet. super(Person, self).save() I'm thinking about making a view class for this sorta stuff, and having functions in it like remove_cache or generate_cache since I do this sorta stuff a lot. Would that be a better idea? If so, how would I call the views in the URLconf if they're in a class?

    Read the article

  • longitude and latitude for current location returned from CLLocationManager in UK region is not corr

    - by bond
    Hi I am getting latitude and longitude of current location from CLLocationManager delegate method. It works fine for some region but its giving problem in UK region. When it is used in UK region, the current location longitude and latitude returned from CLLocationManager is not proper. Thanks heres a part of the logic i am using. -(void)viewWillAppear:(BOOL)animated { [super viewWillAppear:animated]; self.locationManager = [[CLLocationManager alloc] init]; if(self.locationManager.locationServicesEnabled) { self.locationManager.delegate = self; self.locationManager.distanceFilter = kCLDistanceFilterNone; self.locationManager.desiredAccuracy = kCLLocationAccuracyBest; } } -(void)locationManager:(CLLocationManager *)manager didUpdateToLocation:(CLLocation *)newLocation fromLocation:(CLLocation *)oldLocation { NSLog(@"Updating"); //if the time interval returned from core location is more than 15 seconds //we ignore it because it might be from an old session if ( abs([newLocation.timestamp timeIntervalSinceDate: [NSDate date]]) < 15) { self.latitude = newLocation.coordinate.latitude; self.longitude = newLocation.coordinate.longitude; NSLog(@"longitude=%f-- latitude=%f--",self.longitude,self.latitude); [self.locationManager stopUpdatingLocation]; [self removeActivityIndicator]; [[self locationSaved] setHidden:NO]; [[self viewLocationInMap] setEnabled:YES]; }}

    Read the article

  • when updating location.hash in Chrome the jQuery animation "freezes" for a second

    - by ubunut
    I'm trying to create a sort of "virtual gallery". I'm using Coda Slider 2.0 & jQuery v1.4.2 It behaves perfectly in IE, FF & Safari, but Chrome seems to reload/hang for a second when setting location.hash. This causes the jQuery animation to freeze for a second :S Example: http://hardyernst.dk/gallery.html try clicking on the navigation links above the pictures. The jQuery code that is being executed when clicking a navigation link: $('#coda-nav-' + sliderCount + ' a').each(function(z) { // What happens when a nav link is clicked $(this).bind("click", function() { offset = -(panelWidth*z); navClicks++; $(this).addClass('current').parents('ul').find('a').not($(this)).removeClass('current'); alterPanelHeight(z); currentPanel = z + 1; $('.panel-container', slider).stop().animate({ left: offset }, settings.slideEaseDuration, settings.slideEaseFunction, function(){ if (!settings.crossLinking) { return false; } // Don't change the URL hash unless cross-linking is specified }); }); }); if I add return false; at the end of the function. The animation will slide smoothly :)... BUT as you might have guessed the location.hash value remains unchanged :( I have tried setting the location.hash earlier in the function alas it did not change the behavior in Chrome Would be immensely grateful for any help :) Regards Ubunut

    Read the article

  • recommended format to save time with MJD + BCD format in database

    - by pierr
    Hi, There is a time represented in MJD and BCD format with 5 bytes .I am wondering what is the recommended format to save this date-time in the sqlite database so that user can search against it ? My first attempt is to save it just as it is, that is a 5 bytes string. The user will use the same format to search and the result will be converted to unix time by the user with following code. However, later, I was suggested to save the time in the integer - the UTC time, for example. But I can not find a standard way to do the conversion. I feel this is a common issue and would like to hear your comments. time_t sidate_to_unixtime(unsigned char sidate[]) { int k = 0; struct tm tm; double mjd; /* check for the undefined value */ if ((sidate[0] == 0xff) && (sidate[1] == 0xff) && (sidate[2] == 0xff) && (sidate[3] == 0xff) && (sidate[4] == 0xff)) { return -1; } memset(&tm, 0, sizeof(tm)); mjd = (sidate[0] << 8) | sidate[1]; tm.tm_year = (int) ((mjd - 15078.2) / 365.25); tm.tm_mon = (int) (((mjd - 14956.1) - (int) (tm.tm_year * 365.25)) / 30.6001); tm.tm_mday = (int) mjd - 14956 - (int) (tm.tm_year * 365.25) - (int) (tm.tm_mon * 30.6001); if ((tm.tm_mon == 14) || (tm.tm_mon == 15)) k = 1; tm.tm_year += k; tm.tm_mon = tm.tm_mon - 2 - k * 12; tm.tm_sec = bcd_to_integer(sidate[4]); tm.tm_min = bcd_to_integer(sidate[3]); tm.tm_hour = bcd_to_integer(sidate[2]); return mktime(&tm); }

    Read the article

  • JSF how to temporary disable validators to save draft

    - by Swiety
    I have a pretty complex form with lots of inputs and validators. For the user it takes pretty long time (even over an hour) to complete that, so they would like to be able to save the draft data, even if it violates rules like mandatory fields being not typed in. I believe this problem is common to many web applications, but can't find any well recognised pattern how this should be implemented. Can you please advise how to achieve that? For now I can see the following options: use of immediate=true on "Save draft" button doesn't work, as the UI data would not be stored on the bean, so I wouldn't be able to access it. Technically I could find the data in UI component tree, but traversing that doesn't seem to be a good idea. remove all the fields validation from the page and validate the data programmaticaly in the action listener defined for the form. Again, not a good idea, form is really complex, there are plenty of fields so validation implemented this way would be very messy. implement my own validators, that would be controlled by some request attribute, which would be set for standard form submission (with full validation expected) and would be unset for "save as draft" submission (when validation should be skipped). Again, not a good solution, I would need to provide my own wrappers for all validators I am using. But as you see no one is really reasonable. Is there really no simple solution to the problem?

    Read the article

  • How to save to Django Model that Have Mulitple Foreign Keys Fields

    - by Spikie
    I have Models for business Apps class staff_name(models.Model): TITLE_CHOICES = ( ('Mr', 'Mr'), ('Miss', 'Miss'), ( 'Mrs', 'Mrs'), ( 'chief', 'chief'), ) titlename = models.CharField(max_length=10,choices=TITLE_CHOICES) firstname = models.CharField(max_length=150) surname = models.CharField(max_length=150) date = models.DateTimeField(auto_now=True) class meta: ordering = ["date"] get_latest_by = "date" class inventory_transaction(models.Model): stock_in = models.DecimalField(blank=True, null=True,max_digits=8, decimal_places=2) stock_out = models.DecimalField(blank=True,null=True,max_digits=8, decimal_places=2) Number_container = models.ForeignKey(container_identity) staffs = models.ForeignKey(staff_name) goods_details = models.ForeignKey(departments) balance = models.DecimalField(max_digits=8, decimal_places=2) date = models.DateTimeField(auto_now=True) What i want to accomplish is check if the staff have made entry to the table before if yes add the value for the stock in plus (last) balance field and assign to balance if no just assign stock in value to balance field and save these are my codes These are my codes: try: s = staffname.staffs_set.all().order_by("-date").latest() # staffname is the instant of the class model staff_name e = s.staffs_set.create(stockin=vdataz,balance=s.balance + vdataz ) # e is the instant of the class model inventory_transaction e.save e.staffs.add(s) e.from_container.add(containersno) e.goods_details.add(department) except ObjectDoesNotExist: e = staff_name.objects.create(stockin=vdataz,balance=vdataz ) e.save e.staffs.add(staffname) e.from_container.add(containersno) e.goods_details.add(department) I will really appreciate a solution Thanks I hope it make more sense now. iam on online if you need more explanation just ask in the comment.Thank you for your help

    Read the article

  • How to save a HTMLElement (Table) in localStorage?

    - by Hagbart Celine
    I've been trying this for a while now and could not find anything online... I have a project, where tablerows get added to a table. Works fine. Now I want to save the Table in the localStorage, so I can load it again. (overwrite the existing table). function saveProject(){ //TODO: Implement Save functionality var projects = []; projects.push($('#tubes table')[0].innerHTML); localStorage.setItem('projects', projects); //console.log(localStorage.getItem('projects')); The problem is the Array "projects" has (after one save) 2000+ elements. But all I want is the whole table to be saved to the first (or appending later) index. In the end I want the different Saves to be listed on a Option element: function loadSaveStates(){ alert('loading saved states...'); var projects = localStorage.getItem('projects'); select = document.getElementById('selectSave'); //my Dropdown var length = projects.length, element = null; console.log(length); for (var i = 0; i < length; i++) { element = projects[i]; var opt = document.createElement('option'); opt.value = i; opt.innerHTML = 'project ' + i; select.appendChild(opt); } } Can anyone tell me what I am doing wrong?

    Read the article

  • .save puts NULL in id field in Rails

    - by mathee
    Here's the model file: class ProfileTag < ActiveRecord::Base def self.create_or_update(options = {}) id = options.delete(:id) record = find_by_id(id) || new record.id = id record.attributes = options puts "record.profile_id is" puts record.profile_id record.save! record end end This gives me the correct print out in my log. But it also says that there's a call to UPDATE that sets profile_id to NULL. Here's some of the output in the log file: Processing ProfilesController#update (for 127.0.0.1 at 2010-05-28 18:20:54) [PUT] Parameter: {"commit"=>"Save", ...} ?[4;36;1mProfileTag Create (0.0ms)?[0m ?[0;1mINSERT INTO `profile_tags` (`reputation_value`, `updated_at`, `tag_id`, `id`, `profile_id`, `created_at`) VALUES(0, '2010-05-29 01:20:54', 1, NULL, 4, '2010-05-29 01:20:54')?[0m ?[4;35;1mSQL (2.0ms)?[0m ?[0mCOMMIT?[0m ?[4;36;1mSQL (0.0ms)?[0m ?[0;1mBEGIN?[0m ?[4;35;1mSQL (0.0ms)?[0m ?[0mCOMMIT?[0m ?[4;36;1mProfileTag Load (0.0ms)?[0m ?[0;1mSELECT * FROM `profile_tags` WHERE (`profile_tags`.profile_id = 4) ?[0m ?[4;35;1mSQL (1.0ms)?[0m ?[0mBEGIN?[0m ?[4;36;1mProfileTag Update (0.0ms)?[0m ?[0;1mUPDATE `profile_tags` SET profile_id = NULL WHERE (profile_id = 4 AND id IN (35)) ?[0m I'm not sure I understand why the INSERT puts the value into profile_id properly, but then it sets it to NULL on an UPDATE. If you need more specifics, please let me know. I'm thinking that the save functionality does many things other than INSERTs into the database, but I don't know what I need to specify so that it will properly set profile_id.

    Read the article

  • Where to prompt for required file location at start of Win Forms application

    - by Murph
    I have an application that uses a file to store its data. I store the location of the file in the app settings so have two tests at startup: Do I have a setting for the file and Does the file (if I have a setting) exist If I fail either test I want to prompt the user for the file location - the mechanics of the are not the problem, I can read and write the app settings, fire off dialogs and otherwise request the data. If the user refuses to choose a file (or at least a file location) I want to exit the app. My problem is where to do this i.e. at what point in the flow of code. In an ideal world you start the app, show a splash screen, load the main form and run from there... I'm looking for a general pattern that allows me to slot the test for parameters into the right place so that I can prompt the user for whatever (and allowing that I have to worry about the fact that my splash screen is currently topmost for my app). I appreciate that this is a bit vague so will update this with code as we go along.

    Read the article

  • Preselection in the save dialog (c#)

    - by FullmetalBoy
    Goal: Save a notepad file in the computer. (C#) Problem: I don't know how to make a preselection as "TXT Files(*.txt)" in the "Save as type:" when save dialog display? // Fullmetalboy using System; using System.Collections.Generic; using System.ComponentModel; using System.Data; using System.Drawing; using System.Linq; using System.Text; using System.Windows.Forms; using System.IO; namespace Labb2_application { public partial class MainForm : Form { public MainForm() { InitializeComponent(); } private void mnuFileOpen_Click(object sender, EventArgs e) { OpenFileDialog fDialog = new OpenFileDialog(); fDialog.Title = "Öppna"; fDialog.Filter = "Text files|*.txt"; fDialog.InitialDirectory = @"C:\Windows"; fDialog.ShowHelp = true; DialogResult result = fDialog.ShowDialog(); // Show the dialog and get result. if (result == DialogResult.OK) { string fileAdress = fDialog.FileName; try { string textContent = File.ReadAllText(fileAdress); rtxtDisplay.Text = textContent; } catch (IOException) { } } // If syntax } private void mnuFileSave_Click(object sender, EventArgs e) { saveAsFileDialog.ShowDialog(); } private void mnuFileSaveAs_Click(object sender, EventArgs e) { saveAsFileDialog.Filter = "Text files|*.txt"; saveAsFileDialog.ShowDialog(); } private void mnuFileExit_Click(object sender, EventArgs e) { Application.Exit(); } private void saveAsFileDialog_FileOk(object sender, CancelEventArgs e) { string fileNameAddress = saveAsFileDialog.FileName; File.WriteAllText(fileNameAddress, rtxtDisplay.Text); } } // Partial Class }

    Read the article

  • EF4 POCO Not Updating Navigation Property On Save

    - by Gavin Draper
    I'm using EF4 with POCO objects the 2 tables are as follows Service ServiceID, Name, StatusID Status StatusID, Name The POCO objects look like this Service ServiceID, Status, Name Status StatusID, Name With Status on the Service object being a Navigation Property and of type Status. In my Service Repository I have a save method that takes a service objects attaches it to the context and calls save. This works fine for the service, but if the status for that service has been changed it does not get updated. My Save method looks like this public static void SaveService(Service service) { using (var ctx = Context.CreateContext()) { ctx.AttachModify("Services", service); ctx.AttachTo("Statuses",service.Status); ctx.SaveChanges(); } } The AttachModify method attaches an object to the context and sets it to modified it looks like this public void AttachModify(string entitySetName, object entity) { if (entity != null) { AttachTo(entitySetName, entity); SetModified(entity); } } public void SetModified(object entity) { ObjectStateManager.ChangeObjectState(entity, EntityState.Modified); } If I look at a SQL profile its not even including the navigation property in the update for the service table, it never touches the StatusID. Its driving me crazy. Any idea what I need to do to force the Navigation Property to update?

    Read the article

  • Django forms I cannot save picture file

    - by dana
    i have the model: class OpenCv(models.Model): created_by = models.ForeignKey(User, blank=True) first_name = models.CharField(('first name'), max_length=30, blank=True) last_name = models.CharField(('last name'), max_length=30, blank=True) url = models.URLField(verify_exists=True) picture = models.ImageField(help_text=('Upload an image (max %s kilobytes)' %settings.MAX_PHOTO_UPLOAD_SIZE),upload_to='jakido/avatar',blank=True, null= True) bio = models.CharField(('bio'), max_length=180, blank=True) date_birth = models.DateField(blank=True,null=True) domain = models.CharField(('domain'), max_length=30, blank=True, choices = domain_choices) specialisation = models.CharField(('specialization'), max_length=30, blank=True) degree = models.CharField(('degree'), max_length=30, choices = degree_choices) year_last_degree = models.CharField(('year last degree'), max_length=30, blank=True,choices = year_last_degree_choices) lyceum = models.CharField(('lyceum'), max_length=30, blank=True) faculty = models.ForeignKey(Faculty, blank=True,null=True) references = models.CharField(('references'), max_length=30, blank=True) workplace = models.ForeignKey(Workplace, blank=True,null=True) the form: class OpencvForm(ModelForm): class Meta: model = OpenCv fields = ['first_name','last_name','url','picture','bio','domain','specialisation','degree','year_last_degree','lyceum','references'] and the view: def save_opencv(request): if request.method == 'POST': form = OpencvForm(request.POST, request.FILES) # if 'picture' in request.FILES: file = request.FILES['picture'] filename = file['filename'] fd = open('%s/%s' % (MEDIA_ROOT, filename), 'wb') fd.write(file['content']) fd.close() if form.is_valid(): new_obj = form.save(commit=False) new_obj.picture = form.cleaned_data['picture'] new_obj.created_by = request.user new_obj.save() return HttpResponseRedirect('.') else: form = OpencvForm() return render_to_response('opencv/opencv_form.html', { 'form': form, }, context_instance=RequestContext(request)) but i don't seem to save the picture in my database... something is wrong, and i can't figure out what :(

    Read the article

  • Django forms I cannot save picture file

    - by dana
    i have the model: class OpenCv(models.Model): created_by = models.ForeignKey(User, blank=True) first_name = models.CharField(('first name'), max_length=30, blank=True) last_name = models.CharField(('last name'), max_length=30, blank=True) url = models.URLField(verify_exists=True) picture = models.ImageField(help_text=('Upload an image (max %s kilobytes)' %settings.MAX_PHOTO_UPLOAD_SIZE),upload_to='jakido/avatar',blank=True, null= True) bio = models.CharField(('bio'), max_length=180, blank=True) date_birth = models.DateField(blank=True,null=True) domain = models.CharField(('domain'), max_length=30, blank=True, choices = domain_choices) specialisation = models.CharField(('specialization'), max_length=30, blank=True) degree = models.CharField(('degree'), max_length=30, choices = degree_choices) year_last_degree = models.CharField(('year last degree'), max_length=30, blank=True,choices = year_last_degree_choices) lyceum = models.CharField(('lyceum'), max_length=30, blank=True) faculty = models.ForeignKey(Faculty, blank=True,null=True) references = models.CharField(('references'), max_length=30, blank=True) workplace = models.ForeignKey(Workplace, blank=True,null=True) objects = OpenCvManager() the form: class OpencvForm(ModelForm): class Meta: model = OpenCv fields = ['first_name','last_name','url','picture','bio','domain','specialisation','degree','year_last_degree','lyceum','references'] and the view: def save_opencv(request): if request.method == 'POST': form = OpencvForm(request.POST, request.FILES) # if 'picture' in request.FILES: file = request.FILES['picture'] filename = file['filename'] fd = open('%s/%s' % (MEDIA_ROOT, filename), 'wb') fd.write(file['content']) fd.close() if form.is_valid(): new_obj = form.save(commit=False) new_obj.picture = form.cleaned_data['picture'] new_obj.created_by = request.user new_obj.save() return HttpResponseRedirect('.') else: form = OpencvForm() return render_to_response('opencv/opencv_form.html', { 'form': form, }, context_instance=RequestContext(request)) but i don't seem to save the picture in my database... something is wrong, and i can't figure out what :(

    Read the article

  • How to load/save C++ class instance (using STL containers) to disk

    - by supert
    I have a C++ class representing a hierarchically organised data tree which is very large (~Gb, basically as large as I can get away with in memory). It uses an STL list to store information at each node plus iterators to other nodes. Each node has only one parent, but 0-10 children. Abstracted, it looks something like: struct node { public: node_list_iterator parent; // iterator to a single parent node double node_data_array[X]; map<int,node_list_iterator> children; // iterators to child nodes }; class strategy { private: list<node> tree; // hierarchically linked list of nodes struct some_other_data; public: void build(); // build the tree void save(); // save the tree from disk void load(); // load the tree from disk void use(); // use the tree }; I would like to implement the load() and save() to disk, and it should be fairly fast, however the obvious problems are: I don't know the size in advance; The data contains iterators, which are volatile; My ignorance of C++ is prodigious. Could anyone suggest a pure C++ solution please?

    Read the article

< Previous Page | 35 36 37 38 39 40 41 42 43 44 45 46  | Next Page >