Search Results

Search found 10536 results on 422 pages for 'dan course'.

Page 391/422 | < Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >

  • C++ - Breaking code implementation into different parts

    - by Kotti
    Hi! The question plot (a bit abstract, but answering this question will help me in my real app): So, I have some abstract superclass for objects that can be rendered on the screen. Let's call it IRenderable. struct IRenderable { // (...) virtual void Render(RenderingInterface& ri) = 0; virtual ~IRenderable() { } }; And suppose I also have some other objects that derive from IRenderable, e.g. Cat and Dog. So far so good. I add some Cat and Dog specific methods, like SeekForWhiskas(...) and Bark(...). After that I add specific Render(...) method for them, so my code looks this way: class Cat : public IRenderable { public: void SeekForWhiskas(...) { // Implementation could be here or moved // to a source file (depends on me wanting // to inline it or not) } virtual void Render(...) { // Here comes the rendering routine, that // is specific for cats SomehowDrawAppropriateCat(...); } }; class Dog : public IRenderable { public: void Bark(...) { // Same as for 'SeekForWhiskas(...)' } virtual void Render(...) { // Here comes the rendering routine, that // is specific for dogs DrawMadDog(...); } }; And then somewhere else I can do drawing the way that an appropriate rendering routine is called: IRenderable* dog = new Dog(); dog->Render(...); My question is about logical wrapping of such kind of code. I want to break apart the code, that corresponds to rendering of the current object and it's own methods (Render and Bark in this example), so that my class implementation doesn't turn into a mess (imagine that I have 10 methods like Bark and of course my Render method doesn't fit in their company and would be hard to find). Two ways of making what I want to (as far as I know) are: Making appropriate routines that look like RenderCat(Cat& cat, RenderInterface* ri), joining them to render namespace and then the functions inside a class would look like virtual void Render(...) { RenderCat(*this, ...); }, but this is plain stupid, because I'll lose access to Cat's private members and friending these functions looks like a total design disaster. Using visitor pattern, but this would also mean I have to rebuild my app's design and looks like an inadequate way to make my code complicated from the very beginning. Any brilliant ideas? :)

    Read the article

  • Creating multiple heads in remote repository

    - by Jab
    We are looking to move our team (~10 developers) from SVN to mercurial. We are trying to figure out how to manage our workflow. In particular, we are trying to see if creating remote heads is the right solution. We currently have a very large repository with multiple, related projects. They share a lot of code, but pieces of the project are deployed by different teams (3 teams) independent of other portions of the code-base. So each team is working on concurrent large features. The way we currently handles this in SVN are branches. Team1 has a branch for Feature1, same deal for the other teams. When Team1 finishes their change, it gets merged into the trunk and deployed out. The other teams follow suite when their project is complete, merging of course. So my initial thought are using Named Branches for these situations. Team1 makes a Feature1 branch off of the default branch in Hg. Now, here is the question. Should the team PUSH that branch, in it's current/half-state to the repository. This will create a second head in the core repo. My initial reaction was "NO!" as it seems like a bad idea. Handling multiple heads on our repository just sounds awful, but there are some advantages... First, the teams want to setup Continuous Integration to build this branch during their development cycle(months long). This will only work if the CI can pull this branch from the repo. This is something we do now with SVN, copy a CI build and change the branch. Easy. Second, it makes it easier for any team member to jump onto the branch and start working. Without pushing to the core repo, they would have to receive a push from a developer on that team with the changeset information. It is also possible to lose local commits to hardware failure. The chances increase a lot if it's a branch by a single developer who has followed the "don't push until finished" approach. And lastly is just for ease of use. The developers can easily just commit and push on their branch at any time without consequence(as they do today, in their SVN branches). Is there a better way to handle this scenario that I may be missing? I just want a veteran's opinion before moving forward with the strategy. For bug fixes we like the general workflow of mecurial, anonymous branches that only consist of 1-2 commits. The simplicity is great for those cases. By the way, I've read this , great article which seems to favor Named branches.

    Read the article

  • dynamically embedding youtube videos with jquery

    - by danwoods
    Hello all, I'm trying to retrieve a listing of a user's youtube videos and embed them in a page using jQuery. My code looks something like this: $(document).ready(function() { //some variables var fl_obj_template = $('<object width="260" height="140">' + '<param name="movie" value=""></param>' + '<param name="allowFullScreen" value="true"></param>' + '<param name="allowscriptaccess" value="always"></param>' + '<embed src="" type="application/x-shockwave-flash" allowscriptaccess="always" allowfullscreen="true" width="260" height="140"></embed>' + '</object>'); var video_elm_arr = $('.video'); //hide videos until ready $('.video').addClass('hidden'); //pull video data from youtube $.ajax({ url: 'http://gdata.youtube.com/feeds/api/users/username/uploads?alt=json', dataType: 'jsonp', success: function(data) { $.each(data.feed.entry, function(i,item){ //only take the first 7 videos if(i > 6) return; //give the video element a flash object var cur_flash_obj = fl_obj_template; //assign title $(video_elm_arr[i]).find('.video_title').html(item.title.$t); //clean url var video_url = item.media$group.media$content[0].url; var index = video_url.indexOf("?"); if (index > 0) video_url = video_url.substring(0, index); //and asign it to the player's parameters $(cur_flash_obj).find('object param[name="movie"]').attr('value', video_url); $(cur_flash_obj).find('object embed').attr('src', video_url); //alert(cur_flash_obj); //insert flash object in video element $(video_elm_arr[i]).append(cur_flash_obj); //and show $(video_elm_arr[i]).removeClass('hidden'); }); } }); }); (of course with 'username' being the actual username). The video titles appear correctly but no videos show up. What gives? The target html looks like: <div id="top_row_center" class="video_center video"> <p class="video_title"></p> </div>

    Read the article

  • Hibernate3: Self-Referencing Objects

    - by monojohnny
    Need some help on understanding how to do this; I'm going to be running recursive 'find' on a file system and I want to keep the information in a single DB table - with a self-referencing hierarchial structure: This is my DB Table structure I want to populate. DirObject Table: id int NOT NULL, name varchar(255) NOT NULL, parentid int NOT NULL); Here is the proposed Java Class I want to map (Fields only shown): public DirObject { int id; String name; DirObject parent; ... For the 'root' directory was going to use parentid=0; real ids will start at 1, and ideally I want hibernate to autogenerate the ids. Can somebody provide a suggested mapping file for this please; as a secondary question I thought about doing the Java Class like this instead: public DirObject { int id; String name; List<DirObject> subdirs; Could I use the same data model for either of these two methods ? (With a different mapping file of course). --- UPDATE: so I tried the mapping file suggested below (thanks!), repeated here for reference: <hibernate-mapping> <class name="my.proj.DirObject" table="category"> ... <set name="subDirs" lazy="true" inverse="true"> <key column="parentId"/> <one-to-many class="my.proj.DirObject"/> </set> <many-to-one name="parent" class="my.proj.DirObject" column="parentId" cascade="all" /> </class> ...and altered my Java class to have BOTH 'parentid' and 'getSubDirs' [returning a 'HashSet']. This appears to work - thanks, but this is the test code I used to drive this - I think I'm not doing something right here, because I thought Hibernate would take care of saving the subordinate objects in the Set without me having to do this explicitly ? DirObject dirobject=new DirObject(); dirobject.setName("/files"); dirobject.setParent(dirobject); DirObject d1, d2; d1=new DirObject(); d1.setName("subdir1"); d1.setParent(dirobject); d2=new DirObject(); d2.setName("subdir2"); d2.setParent(dirobject); HashSet<DirObject> subdirs=new HashSet<DirObject>(); subdirs.add(d1); subdirs.add(d2); dirobject.setSubdirs(subdirs); session.save(dirobject); session.save(d1); session.save(d2);

    Read the article

  • Thoughts on streamlining multiple .Net apps

    - by John Virgolino
    We have a series of ASP.Net applications that have been written over the course of 8 years. Mostly in the first 3-4 years. They have been running quite well with little maintenance, but new functionality is being requested and we are running into IDE and platform issues. The apps were written in .Net 1.x and 2.x and run in separate spaces but are presented as a single suite of applications which use a common navigation toolbar (implemented as a user control). Every time we want to add something to a menu in the nav we have to modify it in all the apps which is a pain. Also, the various versions of Crystal reports and that we used tables to organize the visual elements and we end up with a mess, especially with all the multi-platform .Net versions running. We need to streamline the suite of apps and make it easier to add on new apps without a hassle. We also need to bring all these apps under one .Net platform and IDE. In addition, there is a WordPress blog styled to match the style of the application suite "integrated" into the UI and a link to a MediaWiki Wiki application as well. My current thinking is to use an open source content management system (CMS) like Joomla (PHP based unfortunately, but it works well) as the user interface framework for style templating and menu management. Joomla's article management would allow us to migrate the Wiki content into articles which could be published without interfering with the .Net apps. Then essentially use an IFrame within an "article" to "host" the .Net application, then... Upgrade the .Net apps to VS2010, strip out all the common header/footer controls and migrate the styles to use the style sheets used in the CMS. As I write this, I certainly realize this is a lot of work and there are optimization issues which this may cause as well as using IFrames seems a bit like cheating and I've read about issues with IFrames. I know that we could use .Net application styling, but it seems like a lot more work (not sure really). Also, the use of a CMS to handle the blog and wiki also seems appealing, unless there is a .Net CMS out there that can handle all of these requirements. Given this information, I am looking to know if I am totally going in the wrong direction? We tried to use open source and integrate it over time, but not this has become hard to maintain. Am I not aware of some technology out there that will meet our requirements? Did we do this right and should we just focus on getting the .Net streamlined? I understand that no matter what we do, it's going to be a lot of work. The communities considerable experience would be helpful. Thanks!! PS - A complete rewrite is not an option.

    Read the article

  • Which style is preferable when writing this boolean expression?

    - by Jeppe Stig Nielsen
    I know this question is to some degree a matter of taste. I admit this is not something I don't understand, it's just something I want to hear others' opinion about. I need to write a method that takes two arguments, a boolean and a string. The boolean is in a sense (which will be obvious shortly) redundant, but it is part of a specification that the method must take in both arguments, and must raise an exception with a specific message text if the boolean has the "wrong" value. The bool must be true if and only if the string is not null or empty. So here are some different styles to write (hopefully!) the same thing. Which one do you find is the most readable, and compliant with good coding practice? // option A: Use two if, repeat throw statement and duplication of message string public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name)) throw new SomeException("..."); if (!useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option B: Long expression but using only && and || public void SomeMethod(bool useName, string name) { if (useName && string.IsNullOrEmpty(name) || !useName && !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option C: With == operator between booleans public void SomeMethod(bool useName, string name) { if (useName == string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } // option D1: With XOR operator public void SomeMethod(bool useName, string name) { if (!(useName ^ string.IsNullOrEmpty(name))) throw new SomeException("..."); // rest of method } // option D2: With XOR operator public void SomeMethod(bool useName, string name) { if (useName ^ !string.IsNullOrEmpty(name)) throw new SomeException("..."); // rest of method } Of course you're welcome to suggest other possibilities too. Message text "..." would be something like "If 'useName' is true a name must be given, and if 'useName' is false no name is allowed".

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • Mysql select - improve performances

    - by realshadow
    Hey, I am working on an e-shop which sells products only via loans. I display 10 products per page in any category, each product has 3 different price tags - 3 different loan types. Everything went pretty well during testing time, query execution time was perfect, but today when transfered the changes to the production server, the site "collapsed" in about 2 minutes. The query that is used to select loan types sometimes hangs for ~10 seconds and it happens frequently and thus it cant keep up and its hella slow. The table that is used to store the data has approximately 2 milion records and each select looks like this: SELECT * FROM products_loans WHERE KOD IN("X17/Q30-10", "X17/12", "X17/5-24") AND 369.27 BETWEEN CENA_OD AND CENA_DO; 3 loan types and the price that needs to be in range between CENA_OD and CENA_DO, thus 3 rows are returned. But since I need to display 10 products per page, I need to run it trough a modified select using OR, since I didnt find any other solution to this. I have asked about it here, but got no answer. As mentioned in the referencing post, this has to be done separately since there is no column that could be used in a join (except of course price and code, but that ended very, very badly). Here is the show create table, kod and CENA_OD/CENA_DO very indexed via INDEX. CREATE TABLE `products_loans` ( `KOEF_ID` bigint(20) NOT NULL, `KOD` varchar(30) NOT NULL, `AKONTACIA` int(11) NOT NULL, `POCET_SPLATOK` int(11) NOT NULL, `koeficient` decimal(10,2) NOT NULL default '0.00', `CENA_OD` decimal(10,2) default NULL, `CENA_DO` decimal(10,2) default NULL, `PREDAJNA_CENA` decimal(10,2) default NULL, `AKONTACIA_SUMA` decimal(10,2) default NULL, `TYP_VYHODY` varchar(4) default NULL, `stage` smallint(6) NOT NULL default '1', PRIMARY KEY (`KOEF_ID`), KEY `CENA_OD` (`CENA_OD`), KEY `CENA_DO` (`CENA_DO`), KEY `KOD` (`KOD`), KEY `stage` (`stage`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8 And also selecting all loan types and later filtering them trough php doesnt work good, since each type has over 50k records and the select takes too much time as well... Any ides about improving the speed are appreciated. Edit: Here is the explain +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | id | select_type | table | type | possible_keys | key | key_len | ref | rows | Extra | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ | 1 | SIMPLE | products_loans | range | CENA_OD,CENA_DO,KOD | KOD | 92 | NULL | 190158 | Using where | +----+-------------+----------------+-------+---------------------+------+---------+------+--------+-------------+ I have tried the combined index and it improved the performance on the test server from 0.44 sec to 0.06 sec, I cant access the production server from home though, so I will have to try it tomorrow.

    Read the article

  • Subband decomposition using Daubechies filter

    - by misha
    I have the following two 8-tap filters: h0 ['-0.010597', '0.032883', '0.030841', '-0.187035', '-0.027984', '0.630881', '0.714847', '0.230378'] h1 ['-0.230378', '0.714847', '-0.630881', '-0.027984', '0.187035', '0.030841', '-0.032883', '-0.010597'] Here they are on a graph: I'm using it to obtain the approximation (lower subband of an image). This is a(m,n) in the following diagram: I got the coefficients and diagram from the book Digital Image Processing, 3rd Edition, so I trust that they are correct. The star symbol denotes one dimensional convolution (either over rows or over columns). The down arrow denotes downsampling in one dimension (either over rows, or columns). My problem is that the filter coefficients for h0 and h1 sum to greater than 1 (approximately 1.4 or sqrt(2) to be exact). Naturally, if I convolve any image with the filter, the image will get brighter. Indeed, here's what I get (expected result on right): Can somebody suggest what the problem is here? Why should it work if the convolution filter coefficients sum to greater than 1? I have the source code, but it's quite long so I'm hoping to avoid posting it here. If it's absolutely necessary, I'll put it up later. EDIT What I'm doing is: Decompose into subbands Filter one of the subbands Recompose subbands into original image Note that the point isn't just to have a displayable subband-decomposed image -- I have to be able to perfectly reconstruct the original image from the subbands as well. So if I scale the filtered image in order to compensate for my decomposition filter making the image brighter, this is what I will have to do: Decompose into subbands Apply intensity scaling Filter one of the subbands Apply inverse intensity scaling Recompose subbands into original image Step 2 performs the scaling. This is what @Benjamin is suggesting. The problem is that then step 4 becomes necessary, or the original image will not be properly reconstructed. This longer method will work. However, the textbook explicitly says that no scaling is performed on the approximation subband. Of course, it's possible that the textbook is wrong. However, what's more possible is I'm misunderstanding something about the way this all works -- this is why I'm asking this question.

    Read the article

  • Learning... anything really

    - by WebDevHobo
    I'm particularly interested in Windows PowerShell, but here's a somewhat more general complaint: When asking for help on learning something new, be it a small subject on PHP or understanding a class in Java, what usually happens is that people direct me towards the documentation pages. What I'm looking for is somewhat of a course. A deep explanation of why something works the way it does. I know my basic programming, like Java and C#. I've never seen C or C++, though I have seen a bit of assembler. I know what the Stack and Heap are, how boxing and unboxing works, why you have to deep-copy an array instead of copying the pointer and some other things. Windows PowerShell on the other hand, I know nothing about. And I notice that when reading the small document or some code, I usually forget what it does or why it works. What I am looking for is preferably, a nice tutorial that explains the beginnings, the concepts, and goes to more difficult things at a steady pace. The only thing documentation can do is explain what a function does. That's no good to me since I don't know what I want to do yet. I could read about a thousand functions, and forget about most of them, because I don't need to implement them right after it. Randomly wandering through the documentation doesn't do me any good. So conclude, what is a good tutorial on Windows Powershell? One which explains in clear language what is happening, one which builds on previous things learned. I don't think googling this is a good idea. Doing a Google search on this would turn up numerous tutorials. And experience tells me that you have to look long and hard to find the gem you're looking for. That's why I'm asking here. Because this is the place where you can find more experienced people. Many of the PowerShell guys among you will know the good ones already, and by asking you, I avoid wasting time that could be spent learning. So to summarize: I will not google this!

    Read the article

  • Why is this simple Mobile Form not closed when using the player

    - by ajhvdb
    Hi, I created this simple sample Form with the close button. Everything is working as expected when NOT using the Interop.WMPLib.dll I've seen other applications using this without problems but why isn't the Form process closed when I just add the line: SoundPlayer myPlayer = new SoundPlayer(); and of course dispose it: if (myPlayer != null) { myPlayer.Dispose(); myPlayer = null; } The Form closes but the debugger VS2008 is still active. The Form project and the dll are still active. If you send me an email to [email protected], I can send you the zipped project. Below is the class for the dll: using System; using System.Collections.Generic; using System.Text; using System.Threading; using System.Runtime.InteropServices; using WMPLib; namespace WindowsMobile.Utilities { public delegate void SoundPlayerStateChanged(SoundPlayer sender, SoundPlayerState newState); public enum SoundPlayerState { Stopped, Playing, Paused, } public class SoundPlayer : IDisposable { [DllImport("coredll")] public extern static int waveOutSetVolume(int hwo, uint dwVolume); [DllImport("coredll")] public extern static int waveOutGetVolume(int hwo, out uint dwVolume); WindowsMediaPlayer myPlayer = new WindowsMediaPlayer(); public SoundPlayer() { myPlayer.uiMode = "invisible"; myPlayer.settings.volume = 100; } string mySoundLocation = string.Empty; public string SoundLocation { get { return mySoundLocation; } set { mySoundLocation = value; } } public void Pause() { myPlayer.controls.pause(); } public void PlayLooping() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.settings.setMode("loop", true); } public int Volume { get { return myPlayer.settings.volume; } set { myPlayer.settings.volume = value; } } public void Play() { Stop(); myPlayer.URL = mySoundLocation; myPlayer.controls.play(); } public void Stop() { myPlayer.controls.stop(); myPlayer.close(); } #region IDisposable Members public void Dispose() { try { Stop(); } catch (Exception) { } // need this otherwise the process won't exit?! try { int ret = Marshal.FinalReleaseComObject(myPlayer); } catch (Exception) { } myPlayer = null; GC.Collect(); } #endregion } }

    Read the article

  • ASP.NET MVC 4/Web API Single Page App for Mobile Devices ... Needs Authentication

    - by lmttag
    We have developed an ASP.NET MVC 4/Web API single page, mobile website (also using jQuery Mobile) that is intended to be accessed only from mobile devices (e.g., iPads, iPhones, Android tables and phones, etc.), not desktop browsers. This mobile website will be hosted internally, like an intranet site. However, since we’re accessing it from mobile devices, we can’t use Windows authentication. We still need to know which user (and their role) is logging in to the mobile website app. We tried simply using ASP.NET’s forms authentication and membership provider, but couldn’t get it working exactly the way we wanted. What we need is for the user to be prompted for a user name and password only on the first time they access the site on their mobile device. After they enter a correct user name and password and have been authenticated once, each subsequent time they access the site they should just go right in. They shouldn’t have to re-enter their credentials (i.e., something needs to be saved locally to each device to identify the user after the first time). This is where we had troubles. Everything worked as expected the first time. That is, the user was prompted to enter a user name and password, and, after doing that, was authenticated and allowed into the site. The problem is every time after the browser was closed on the mobile device, the device and user were not know and the user had to re-enter user name and password. We tried lots of things too. We tried setting persistent cookies in JavaScript. No good. The cookies weren’t there to be read the second time. We tried manually setting persistent cookies from ASP.NET. No good. We, of course, used FormsAuthentication.SetAuthCookie(model.UserName, true); as part of the form authentication framework. No good. We tried using HTML5 local storage. No good. No matter what we tried, if the user was on a mobile device, they would have to log in every single time. (Note: we’ve tried on an iPad and iPhone running both iOS 5.1 and 6.0, with Safari configure to allow cookies, and we’ve tried on Android 2.3.4.) Is there some trick to getting a scenario like this working? Or, do we have to write some sort of custom authentication mechanism? If so, how? And, what? Or, should we use something like claims-based authentication and WIF? Or??? Any help is appreciated. Thanks!

    Read the article

  • Settings designer file complains when protecting configuration for connectionStrings in App.Config i

    - by Joe
    Hi, I am trying to encrypt Configuration Information Using Protected Configuration in Visual Studio 2010. I have the following info speicifed in the App.Config file: <connectionStrings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </connectionStrings> <appSettings configProtectionProvider="TheProviderName"> <EncryptedData> <CipherData> <CipherValue>VALUE GOES HERE</CipherValue> </CipherData> </EncryptedData> </appSettings> However, when I then go to the Settings area of the Projects Properties to view the settings in the Designer, I get prompted with the following error "An error occured while reading the App.config file. The file might be corrupted or contain invalid XML." I understand that my changes are causing the error, however, is there anyway I can bypass that the information is not read into at design view? (Of course the best way would be to make the tags be recognized by the designer, is there any way to do this?) I tried adding <connectionStrings configProtectionProvider="TheProviderName" xmlns="http://schemas.microsoft.com/.NetConfiguration/v2.0"> to connectionStrings as well as to the appSettings, but with no luck, the intellisense is bypassed in the config file, but the designer still complains. I would be satisfied if the designer would not complain about this "error", which is not actually an error because Microsoft states here that it should work. ASP.NET 2.0 provides a new feature, called protected configuration, that enables you to encrypt sensitive information in a configuration file. Although primarily designed for ASP.NET, protected configuration can also be used to encrypt configuration file sections in Windows applications. For a detailed description of the new protected configuration capabilities, see Encrypting Configuration Information Using Protected Configuration. And yes, it does work to encrypt it and to decrypt it and use it, it is just very annoying and frustrating that the designer complains about it. Anyone who knows which xsd file that is used (if used) to verify the contents of the App.config file in the design view? Any help appreciated.

    Read the article

  • Loading the last related record instantly for multiple parent records using Entity framework

    - by Guillaume Schuermans
    Does anyone know a good approach using Entity Framework for the problem described below? I am trying for our next release to come up with a performant way to show the placed orders for the logged on customer. Of course paging is always a good technique to use when a lot of data is available I would like to see an answer without any paging techniques. Here's the story: a customer places an order which gets an orderstatus = PENDING. Depending on some strategy we move that order up the chain in order to get it APPROVED. Every change of status is logged so we can see a trace for statusses and maybe even an extra line of comment per status which can provide some extra valuable information to whoever sees this order in an interface. So an Order is linked to a Customer. One order can have multiple orderstatusses stored in OrderStatusHistory. In my testscenario I am using a customer which has 100+ Orders each with about 5 records in the OrderStatusHistory-table. I would for now like to see all orders in one page not using paging where for each Order I show the last relevant Status and the extra comment (if there is any for this last status; both fields coming from OrderStatusHistory; the record with the highest Id for the given OrderId). There are multiple scenarios I have tried, but I would like to see any potential other solutions or comments on the things I have already tried. Trying to do Include() when getting Orders but this still results in multiple queries launched on the database. Each order triggers an extra query to the database to get all orderstatusses in the history table. So all statusses are queried here instead of just returning the last relevant one, plus 100 extra queries are launched for 100 orders. You can imagine the problem when there are 100000+ orders in the database. Having 2 computed columns on the database: LastStatus, LastStatusInformation and a regular Linq-Query which gets those columns which are available through the Entity-model. The problem with this approach is the fact that those computed columns are determined using a scalar function which can not be changed without removing the formula from the computed column, etc... In the end I am very familiar with SQL and Stored procedures, but since the rest of the data-layer uses Entity Framework I would like to stick to it as long as possible, even though I have my doubts about performance. Using the SQL approach I would write something like this: WITH cte (RN, OrderId, [Status], Information) AS ( SELECT ROW_NUMBER() OVER (PARTITION BY OrderId ORDER BY Id DESC), OrderId, [Status], Information FROM OrderStatus ) SELECT o.Id, cte.[Status], cte.Information AS StatusInformation, o.* FROM [Order] o INNER JOIN cte ON o.Id = cte.OrderId AND cte.RN = 1 WHERE CustomerId = @CustomerId ORDER BY 1 DESC; which returns all orders for the customer with the statusinformation provided by the Common Table Expression. Does anyone know a good approach using Entity Framework?

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • casting doubles to integers in order to gain speed

    - by antirez
    Hello all, in Redis (http://code.google.com/p/redis) there are scores associated to elements, in order to take this elements sorted. This scores are doubles, even if many users actually sort by integers (for instance unix times). When the database is saved we need to write this doubles ok disk. This is what is used currently: snprintf((char*)buf+1,sizeof(buf)-1,"%.17g",val); Additionally infinity and not-a-number conditions are checked in order to also represent this in the final database file. Unfortunately converting a double into the string representation is pretty slow. While we have a function in Redis that converts an integer into a string representation in a much faster way. So my idea was to check if a double could be casted into an integer without lost of data, and then using the function to turn the integer into a string if this is true. For this to provide a good speedup of course the test for integer "equivalence" must be fast. So I used a trick that is probably undefined behavior but that worked very well in practice. Something like that: double x = ... some value ... if (x == (double)((long long)x)) use_the_fast_integer_function((long long)x); else use_the_slow_snprintf(x); In my reasoning the double casting above converts the double into a long, and then back into an integer. If the range fits, and there is no decimal part, the number will survive the conversion and will be exactly the same as the initial number. As I wanted to make sure this will not break things in some system, I joined #c on freenode and I got a lot of insults ;) So I'm now trying here. Is there a standard way to do what I'm trying to do without going outside ANSI C? Otherwise, is the above code supposed to work in all the Posix systems that currently Redis targets? That is, archs where Linux / Mac OS X / *BSD / Solaris are running nowaday? What I can add in order to make the code saner is an explicit check for the range of the double before trying the cast at all. Thank you for any help.

    Read the article

  • BULK INSERT from one table to another all on the server

    - by steve_d
    I have to copy a bunch of data from one database table into another. I can't use SELECT ... INTO because one of the columns is an identity column. Also, I have some changes to make to the schema. I was able to use the export data wizard to create an SSIS package, which I then edited in Visual Studio 2005 to make the changes desired and whatnot. It's certainly faster than an INSERT INTO, but it seems silly to me to download the data to a different computer just to upload it back again. (Assuming that I am correct that that's what the SSIS package is doing). Is there an equivalent to BULK INSERT that runs directly on the server, allows keeping identity values, and pulls data from a table? (as far as I can tell, BULK INSERT can only pull data from a file) Edit: I do know about IDENTITY_INSERT, but because there is a fair amount of data involved, INSERT INTO ... SELECT is kinda of slow. SSIS/BULK INSERT dumps the data into the table without regards to indexes and logging and whatnot, so it's faster. (Of course creating the clustered index on the table once it's populated is not fast, but it's still faster than the INSERT INTO...SELECT that I tried in my first attempt) Edit 2: The schema changes include (but are not limited to) the following: 1. Splitting one table into two new tables. In the future each will have its own IDENTITY column, but for the migration I think it will be simplest to use the identity from the original table as the identity for the both new tables. Once the migration is over one of the tables will have a one-to-many relationship to the other. 2. Moving columns from one table to another. 3. Deleting some cross reference tables that only cross referenced 1-to-1. Instead the reference will be a foreign key in one of the two tables. 4. Some new columns will be created with default values. 5. Some tables aren’t changing at all, but I have to copy them over due to the "put it all in a new DB" request.

    Read the article

  • CSS selectors : should I minimise my use of the class attribute in the HTML or optimise the speed

    - by Laurent Bourgault-Roy
    As I was working on a small website, I decided to use the PageSpeed extension to check if their was some improvement I could do to make the site load faster. However I was quite surprise when it told me that my use of CSS selector was "inefficient". I was always told that you should keep the usage of the class attribute in the HTML to a minimum, but if I understand correctly what PageSpeed tell me, it's much more efficient for the browser to match directly against a class name. It make sense to me, but it also mean that I need to put more CSS classes in my HTML. It also make my .css file a little harder to read. I usually tend to mark my CSS like this : #mainContent p.productDescription em.priceTag { ... } Which make it easy to read : I know this will affect the main content and that it affect something in a paragraph tag (so I wont start to put all sort of layout code in it) that describe a product and its something that need emphasis. However it seem I should rewrite it as .priceTag { ... } Which remove all context information about the style. And if I want to use differently formatted price tag (for example, one in a list on the sidebar and one in a paragraph), I need to use something like that .paragraphPriceTag { ... } .listPriceTag { ... } Which really annoy me since I seem to duplicate the semantic of the HTML in my classes. And that mean I can't put common style in an unqualified .priceTag { ... } and thus I need to replicate the style in both CSS rule, making it harder to make change. (Altough for that I could use multiple class selector, but IE6 dont support them) I believe making code harder to read for the sake of speed has never been really considered a very good practice . Except where it is critical, of course. This is why people use PHP/Ruby/C# etc. instead of C/assembly to code their site. It's easier to write and debug. So I was wondering if I should stick with few CSS classes and complex selector or if I should go the optimisation route and remove my fancy CSS selectors for the sake of speed? Does PageSpeed make over the top recommandation? On most modern computer, will it even make a difference?

    Read the article

  • Openlayers and Bing Maps (POLYGONS)

    - by Jordan
    When trying to draw polygons onto a bing map, the initial marker is set differently on the map. How can I fix this? OpenLayers Bing Example <script src="OpenLayers.js"></script> <script> var map; function init(){ map = new OpenLayers.Map("map"); map.addControl(new OpenLayers.Control.LayerSwitcher()); var shaded = new OpenLayers.Layer.VirtualEarth("Shaded", { type: VEMapStyle.Shaded }); var hybrid = new OpenLayers.Layer.VirtualEarth("Hybrid", { type: VEMapStyle.Hybrid }); var aerial = new OpenLayers.Layer.VirtualEarth("Aerial", { type: VEMapStyle.Aerial }); var POLY_LAYER = new OpenLayers.Layer.Vector(); map.addLayers([shaded, hybrid, aerial, POLY_LAYER]); map.setCenter(new OpenLayers.LonLat(-110, 45), 3); var polygon = new OpenLayers.Control.DrawFeature(POLY_LAYER, OpenLayers.Handler.Polygon); map.addControl(polygon); polygon.activate(); } </script> Bing Example <div id="tags"> Bing, Microsoft, Virtual Earth </div> <p id="shortdesc"> Demonstrates the use of Bing layers. </p> <div id="map" class="smallmap"></div> <div id="docs">This example demonstrates the ability to create layers using tiles from Bing maps.</div> Of course the above is being initialized and page works. You can draw the polygon shapes. Notice if you zoom in or out one time, the markers are set at the correct coordinates. My app I was testing this on is really using the bing maps API keys and not VirtualEarth. But it's doing a similar thing. Is this an Openlayers bug? The below source came directly from the open layers example site, I just added and activated polygons to the map. Please let me know how I can fix this for using the Bing Map API.. I've been stuck on this for HOURS! :(

    Read the article

  • L-Soft LISTSERV TCPGUI Interface for PHP Creation

    - by poolnoodl
    I'm trying to use LISTSERV's "API" in PHP. L-Soft calls this TCPGUI, and essentially, you can request data like over Telnet. To do this, I'm using PHP's TCP socket functions. I've seen this done in other languages but can't quite convert it to PHP. I can connect, I can change set ASCII or BINARY mode. But I can never quite craft the header packet the way I need to authenticate, so I'm thinking I'm messing up my conversion. C: http://www.lsoft.com/manuals/16.0/htmlhelp/advanced%20topics/TCPGUI.html#2334328 $origin = '[email protected]'; $pwd = 'password'; $host = "example.com"; $port = 2306; $email = "[email protected]"; $list = "mailinglist"; $command = "Query $list FOR $email"; $fp = stream_socket_client("tcp://$host:$port", $errno, $errstr, 30); $cmd = $command . " PW=" . $pwd; $len = strlen($cmd); $orglen = strlen($origin); $n = $len + $orglen + 1; $headerPacket[0] = "1"; $headerPacket[1] = "B"; $headerPacket[2] = "\r"; $headerPacket[3] = "\n"; $headerPacket[4] = ord($n / 256); $headerPacket[5] = ord($n + 255); $headerPacket[6] = ord($orglen); for ($i = 0; $i < $orglen; $i++) { $headerPacket[$i + 7] = ord($origin[$i]); } for ($i = 0; $i < $len; $i++) { $cmdPacket[$i] = ord($cmd[$i]); } fwrite($fp, implode($headerPacket)); while (!feof($fp)) { echo fgets($fp, 1024); } Any thoughts on where I'm going wrong? I'd much appreciate it if anyone could point me toward some code to do this, days of googling and searching here on SO has only lead me to examples in other languages. Of course, if you know C (or Java or Perl as linked below in my comment to bypass the spam filter), PHP, and socket programming fairly well, you could probably rewrite the whole of the code in an hour, maybe a few minutes. You'd have my eternal thanks for that.

    Read the article

  • grdb not working variables

    - by stupid_idiot
    hi, i know this is kinda retarded but I just can't figure it out. I'm debugging this: xor eax,eax mov ah,[var1] mov al,[var2] call addition stop: jmp stop var1: db 5 var2: db 6 addition: add ah,al ret the numbers that I find on addresses var1 and var2 are 0x0E and 0x07. I know it's not segmented, but that ain't reason for it to do such escapades, because the addition call works just fine. Could you please explain to me where is my mistake? I see the problem, dunno how to fix it yet though. The thing is, for some reason the instruction pointer starts at 0x100 and all the segment registers at 0x1628. To address the instruction the used combination is i guess [cs:ip] (one of the segment registers and the instruction pointer for sure). The offset to var1 is 0x10 (probably because from the begining of the code it's the 0x10th byte in order), i tried to examine the memory and what i got was: 1628:100 8 bytes 1628:108 8 bytes 1628:110 <- wtf? (assume another 8 bytes) 1628:118 ... whatever tricks are there in the memory [cs:var1] points somewhere else than in my code, which is probably where the label .data would usually address ds.... probably.. i don't know what is supposed to be at 1628:10 ok, i found out what caused the assness and wasted me whole fuckin day. the behaviour described above is just correct, the code is fully functional. what i didn't know is that grdb debugger for some reason sets the begining address to 0x100... the sollution is to insert the directive ORG 0x100 on the first line and that's the whole thing. the code was working because instruction pointer has the right address to first instruction and goes one by one, but your assembler doesn't know what effective address will be your program stored at so it pretty much remains relative to first line of the code which means all the variables (if not using label for data section) will remain pointing as if it started at 0x0. which of course wouldn't work with DOS. and grdb apparently emulates some DOS features... sry for the language, thx everyone for effort, hope this will spare someone's time if having the same problem... heheh.. at least now i know the reason why to use .data section :))))

    Read the article

  • Spring MVC, REST, and HATEOAS

    - by SingleShot
    I'm struggling with the correct way to implement Spring MVC 3.x RESTful services with HATEOAS. Consider the following constraints: I don't want my domain entities polluted with web/rest constructs. I don't want my controllers polluted with view constructs. I want to support multiple views. Currently I have a nicely put together MVC app without HATEOAS. Domain entities are pure POJOs without any view or web/rest concepts embedded. For example: class User { public String getName() {...} public String setName(String name) {...} ... } My controllers are also simple. They provide routing and status, and delegate to Spring's view resolution framework. Note my application supports JSON, XML, and HTML, yet no domain entities or controllers have embedded view information: @Controller @RequestMapping("/users") class UserController { @RequestMapping public ModelAndView getAllUsers() { List<User> users = userRepository.findAll(); return new ModelAndView("users/index", "users", users); } @RequestMapping("/{id}") public ModelAndView getUser(@PathVariable Long id) { User user = userRepository.findById(id); return new ModelAndView("users/show", "user", user); } } So, now my issue - I'm not sure of a clean way to support HATEOAS. Here's an example. Let's say when the client asks for a User in JSON format, it comes out like this: { firstName: "John", lastName: "Smith" } Let's also say that when I support HATEOAS, I want the JSON to contain a simple "self" link that the client can then use to refresh the object, delete it, or something else. It might also have a "friends" link indicating how to get the user's list of friends: { firstName: "John", lastName: "Smith", links: [ { rel: "self", ref: "http://myserver/users/1" }, { rel: "friends", ref: "http://myserver/users/1/friends" } ] } Somehow I want to attach links to my object. I feel the right place to do this is in the controller layer as the controllers all know the correct URLs. Additionally, since I support multiple views, I feel like the right thing to do is somehow decorate my domain entities in the controller before they are converted to JSON/XML/whatever in Spring's view resolution framework. One way to do this might be to wrap the POJO in question with a generic Resource class that contains a list of links. Some view tweaking would be required to crunch it into the format I want, but its doable. Unfortunately nested resources could not be wrapped in this way. Other things that come to mind include adding links to the ModelAndView, and then customizing each of Spring's out-of-the-box view resolvers to stuff links into the generated JSON/XML/etc. What I don't want is to be constantly hand-crafting JSON/XML/etc. to accommodate various links as they come and go during the course of development. Thoughts?

    Read the article

  • Moving from Windows to Ubuntu.

    - by djzmo
    Hello there, I used to program in Windows with Microsoft Visual C++ and I need to make some of my portable programs (written in portable C++) to be cross-platform, or at least I can release a working version of my program for both Linux and Windows. I am total newcomer in Linux application development (and rarely use the OS itself). So, today, I installed Ubuntu 10.04 LTS (through Wubi) and equipped Code::Blocks with the g++ compiler as my main weapon. Then I compiled my very first Hello World linux program, and I confused about the output program. I can run my program through the "Build and Run" menu option in Code::Blocks, but when I tried to launch the compiled application externally through a File Browser (in /media/MyNTFSPartition/MyProject/bin/Release; yes, I saved it in my NTFS partition), the program didn't show up. Why? I ran out of idea. I need to change my Windows and Microsoft Visual Studio mindset to Linux and Code::Blocks mindset. So I came up with these questions: How can I execute my compiled linux programs externally (outside IDE)? In Windows, I simply run the generated executable (.exe) file How can I distribute my linux application? In Windows, I simply distribute the executable files with the corresponding DLL files (if any) What is the equivalent of LIBs (static library) and DLLs (dynamic library) in linux and how to use them? In Windows/Visual Studio, I simply add the required libraries to the Additional Dependencies in the Project Settings, and my program will automatically link with the required static library(-ies)/DLLs. Is it possible to use the "binary form" of a C++ library (if provided) so that I wouldn't need to recompile the entire library source code? In Windows, yes. Sometimes precompiled *.lib files are provided. If I want to create a wxWidgets application in Linux, which package should I pick for Ubuntu? wxGTK or wxX11? Can I run wxGTK program under X11? In Windows, I use wxMSW, Of course. If question no. 4 is answered possible, are precompiled wxX11/wxGTK library exists out there? Haven't tried deep google search. In Windows, there is a project called "wxPack" (http://wxpack.sourceforge.net/) that saves a lot of my time. Sorry for asking many questions, but I am really confused on these linux development fundamentals. Any kind of help would be appreciated =) Thanks.

    Read the article

  • boost::spirit::karma using the alternatives operator (|) with conditions

    - by Ingemar
    I'm trying to generate a string from my own class called Value using boost::spirit::karma, but i got stuck with this. I've tried to extract my problem into a simple example. I want to generate a String with karma from instances of the following class: class Value { public: enum ValueType { BoolType, NumericType }; Value(bool b) : type_(BoolType), value_(b) {} Value(const double d) : type_(NumericType), value_(d) {}; ValueType type() { return type_; } operator bool() { return boost::get<bool>(value_); } operator double() { return boost::get<double>(value_); } private: ValueType type_; boost::variant<bool, double> value_; }; Here you can see what I'm tying to do: int main() { using karma::bool_; using karma::double_; using karma::rule; using karma::eps; std::string generated; std::back_insert_iterator<std::string> sink(generated); rule<std::back_insert_iterator<std::string>, Value()> value_rule = bool_ | double_; Value bool_value = Value(true); Value double_value = Value(5.0); karma::generate(sink, value_rule, bool_value); std::cout << generated << "\n"; generated.clear(); karma::generate(sink, value_rule, double_value); std::cout << generated << "\n"; return 0; } The first call to karma::generate() works fine because the value is a bool and the first generator in my rule also "consumes" a bool. But the second karma::generate() fails with boost::bad_get because karma tries to eat a bool and calls therefore Value::operator bool(). My next thought was to modify my generator rule and use the eps() generator together with a condition but here i got stuck: value_rule = (eps( ... ) << bool_) | (eps( ... ) << double_); I'm unable to fill the brackets of the eps generator with sth. like this (of course not working): eps(value.type() == BoolType) I've tried to get into boost::phoenix, but my brain seems not to be ready for things like this. Please help me! here is my full example (compiling but not working): main.cpp

    Read the article

  • sed - trying to replace first occurrence after a match

    - by wakkaluba
    I am facing a situation that drives me nuts. I am setting up an update server which uses a json file. Don't ask why or how, it sucks and is my only possibility to achieve it. I have been trying and researching for HOURS (many) because I went ballistic and wanted to crack this on my own. But I have to realize I got stuck and need help. So sorry for this chunk but I think it is somewhat important to see... The file is a one liner and repeating the following sequence with changing values (of course). "plugin_name_foo_bar": {"buildDate": "bla", "dependencies": [{"name": "bla", "optional": true, "version": "1.00"}], "developers": [{"developerId": "bla", "email": "[email protected]", "name": "Bla bla2nd"}], "excerpt": "some text {excerpt} !bla.png|thumbnail,border=1! ", "gav": "bla", "labels": ["report", "scm-related"], "name": "plugin_name_foo_bar", "previousTimestamp": "bla", "previousVersion": "1.0", "releaseTimestamp": "bla", "requiredCore": "1", "scm": "github.com", "sha1": "ynnBM2jWo25ZLDdP3ybBOnV/Pio=", "title": "bla", "url": "http://bla.org", "version": "1.0", "wiki": "https://bla.org"}, "Exclusion": {"buildDate": "bla", "dependencies": [], and the next plugin block is glued straight afterwards. What I now want to do is to search for "plugin_foo_bar": {" as this is the unique identifier for a new plugin description block. I want to replace the first sha1 value occuring afterwards. That's where I keep failing. I always grab the first,last or any occurrence in the entire file and not the block :( "title" is the unique identifier after the sha1 value. So I tried to make the .* less greedy but it ain't working out. last attempt was heading towards: sed -i 's/("name": "plugin_name_foo_bar.*sha1": ")([a-zA-Z0-9!@#\$%^&*()\[\]]*)(", "title"\)/\1blablabla\2/1' default.json to find the sha1 value of that plugin but still no joy. I hope someone knows - preferably a simpler approach - before I now continue with trial and error until I have to puke and freakout. I am working with SED on Windows, so Unix approach might help me to figure out how to achieve this in batch but please make it as one-liner if possible. Scripts are a real pain to convert. And I just need SED and no other solution with other tools like AWK. That is absolutely out of discussion. Any help is appreciated :) Cheers Jan

    Read the article

< Previous Page | 387 388 389 390 391 392 393 394 395 396 397 398  | Next Page >