Search Results

Search found 20677 results on 828 pages for 'python team'.

Page 397/828 | < Previous Page | 393 394 395 396 397 398 399 400 401 402 403 404  | Next Page >

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Preserving the dimensions of a slice from a Numpy 3d array

    - by Brendan
    I have a 3d array, a, of shape say a.shape = (10, 10, 10) When slicing, the dimensions are squeezed automatically i.e. a[:,:,5].shape = (10, 10) I'd like to preserve the number of dimensions but also ensure that the dimension that was squeezed is the one that shows 1 i.e. a[:,:,5].shape = (10, 10, 1) I have thought of re-casting the array and passing ndmin but that just adds the extra dimensions to the start of the shape tuple regardless of where the slice came from in the array a.

    Read the article

  • how to make my method running on the template of google-app-engine..

    - by zjm1126
    the model is : class someModel(db.Model): name = db.StringProperty() def name_is_sss(self): return self.name=='sss' the view is : a=someModel() a.name='sss' path = os.path.join(os.path.dirname(__file__), os.path.join('templates', 'blog/a.html')) self.response.out.write(template.render(path, {'a':a})) and the html is : {{ a.name_is_sss }} the page shows : True so i want to make it more useful, and like this: the model: class someModel(db.Model): name = db.StringProperty() def name_is_x(self,x): return self.name==x the html is : {% a.name_is_x 'www'%} or {{ a.name_is_x 'www'}} but the error is : TemplateSyntaxError: Invalid block tag: 'a.name_is_x' or TemplateSyntaxError: Could not parse the remainder: 'www' so how to make my method running thanks

    Read the article

  • Conditional operator in Mako using Pylons

    - by Antoine Leclair
    In PHP, I often use the conditional operator to add an attribute to an html element if it applies to the element in question. For example: <select name="blah"> <option value="1"<?= $blah == 1 ? ' selected="selected"' : '' ?>> One </option> <option value="2"<?= $blah == 2 ? ' selected="selected"' : '' ?>> Two </option> </select> I'm starting a project with Pylons using Mako for the templating. How can I achieve something similar? Right now, I see two possibilities that are not ideal. Solution 1: <select name="blah"> % if blah == 1: <option value="1" selected="selected">One</option> % else: <option value="1">One</option> % endif % if blah == 2: <option value="2" selected="selected">Two</option> % else: <option value="2">Two</option> % endif </select> Solution 2: <select name="blah"> <option value="1" % if blah == 1: selected="selected" % endif >One</option> <option value="2" % if blah == 2: selected="selected" % endif >Two</option> </select> In this particular case, the value is equal to the variable tested (value="1" = blah == 1), but I use the same pattern in other situations, like <?= isset($variable) ? ' value="$variable" : '' ?>. I am looking for a clean way to achieve this using Mako.

    Read the article

  • Web2py controllers with parameters?

    - by nickfranceschina
    I am building an app using Web2py framework... I don't want to have to use the request object to get all of the querystring parameters, instead I'd like to build my controller with named parameters and have the router unpack the querystring (or form data) dictionary into the named parameters and call my controller. so instead of a controller method of create_user(): where I would use the global request() object and look through the vars list... I would prefer instead to have create_user(first_name, last_name, email): like I see in other MVC platforms. is this possible in Web2py already? or is there a plugin for it? or do I need to add that myself?

    Read the article

  • Rearranging a sequence

    - by sarah
    I'm have trouble rearranging sequences so the amount of letters in the given original sequence are the same in the random generated sequences. For example: If i have a string 'AAAC' I need that string rearranged randomly so the amount of A's and C's are the same.

    Read the article

  • Tkinter Packing Strangeness: Buttons packed above others

    - by Parand
    I'm sure I'm doing something obvious wrong here, but I can't see it. I end up with the "Should be on top" label packed at the bottom instead of at the top. What am I doing wrong? from Tkinter import * class SelectAction(Frame): buttons = {} def callback(self): print "Callback" def createWidgets(self): logo_label = Label(text="Should be on top").pack(fill=X) for name, text, callback in ( ('setup_account', 'Account Settings', self.callback), ('do_action', 'Do Something', self.callback), ): self.buttons[name] = Button(self, text=text, command=callback).pack(fill=X) def __init__(self, master=None): Frame.__init__(self, master) self.pack() self.createWidgets() if __name__ == "__main__": root = Tk() app = SelectAction(master=root) app.mainloop() root.destroy()

    Read the article

  • Performing non-blocking requests? - Django

    - by RadiantHex
    Hi folks, I have been playing with other frameworks, such as NodeJS, lately. I love the possibility to return a response, and still being able to do further operations. e.g. def view(request): do_something() return HttpResponse() do_more_stuff() #not possible!!! Maybe Django already offers a way to perform operations after returning a request, if that is the case that would be great. Help would be very much appreciated! =D

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • csrf error in django

    - by niklasfi
    Hello, I want to realize a login for my site. I basically copied and pasted the following bits from the Django Book together. However I still get an error (CSRF verification failed. Request aborted.), when submitting my registration form. Can somebody tell my what raised this error and how to fix it? Here is my code: views.py: # Create your views here. from django import forms from django.contrib.auth.forms import UserCreationForm from django.http import HttpResponseRedirect from django.shortcuts import render_to_response def register(request): if request.method == 'POST': form = UserCreationForm(request.POST) if form.is_valid(): new_user = form.save() return HttpResponseRedirect("/books/") else: form = UserCreationForm() return render_to_response("registration/register.html", { 'form': form, }) register.html: <html> <body> {% block title %}Create an account{% endblock %} {% block content %} <h1>Create an account</h1> <form action="" method="post">{% csrf_token %} {{ form.as_p }} <input type="submit" value="Create the account"> </form> {% endblock %} </body> </html>

    Read the article

  • django-uni-form helpers and CSRF tags over POST

    - by linked
    Hi, I'm using django-uni-forms to display my fields, with a rather rudimentary example straight out of their book. When I render the form fields using <form>{%csrf_tag%} {%form|as_uni_form%}</form>, everything works as expected. However, django-uni-form Helpers allow you to generate the form tag (and other helper-related content) using the following syntax -- {% with form.helper as helper %}{% uni_form form helper%}{%endwith%} -- This creates the <form> tag for me, so there's nowhere to embed my own CSRF_token. When I try to use this syntax, the form renders perfectly, but without a CSRF token, and so submitting the form fails every time. Does anyone have experience with this? Is there an established way to add the token? I much prefer the second syntax, for re-use reasons. Thanks!

    Read the article

  • Google App Engine with local Django 1.1 gets Intermittent Failures

    - by Jon Watte
    I'm using the Windows Launcher development environment for Google App Engine. I have downloaded Django 1.1.2 source, and un-tarrred the "django" subdirectory to live within my application directory (a peer of app.yaml) At the top of each .py source file, I do this: import settings import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' In my file settings.py (which lives at the root of the app directory, as well), I do this: DEBUG = True TEMPLATE_DIRS = ('html') INSTALLED_APPS = ('filters') import os os.environ["DJANGO_SETTINGS_MODULE"] = 'settings' from google.appengine.dist import use_library use_library('django', '1.1') from django.template import loader Yes, this looks a bit like overkill, doesn't it? I only use django.template. I don't explicitly use any other part of django. However, intermittently I get one of two errors: 1) Django complains that DJANGO_SETTINGS_MODULE is not defined. 2) Django complains that common.html (a template I'm extending in other templates) doesn't exist. 95% of the time, these errors are not encountered, and they randomly just start happening. Once in that state, the local server seems "wedged" and re-booting it generally fixes it. What's causing this to happen, and what can I do about it? How can I even debug it? Here is the traceback from the error: Traceback (most recent call last): File "C:\code\kwbudget\edit_budget.py", line 34, in get self.response.out.write(t.render(template.Context(values))) File "C:\code\kwbudget\django\template\__init__.py", line 165, in render return self.nodelist.render(context) File "C:\code\kwbudget\django\template\__init__.py", line 784, in render bits.append(self.render_node(node, context)) File "C:\code\kwbudget\django\template\__init__.py", line 797, in render_node return node.render(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 71, in render compiled_parent = self.get_parent(context) File "C:\code\kwbudget\django\template\loader_tags.py", line 66, in get_parent raise TemplateSyntaxError, "Template %r cannot be extended, because it doesn't exist" % parent TemplateSyntaxError: Template u'common.html' cannot be extended, because it doesn't exist And edit_budget.py starts with exactly the lines that I included up top. All templates live in a directory named "html" in my root directory, and "html/common.html" exists. I know the template engine finds them, because I start out with "html/edit_budget.html" which extends common.html. It looks as if the settings module somehow isn't applied (because that's what adds html to the search path for templates).

    Read the article

  • Auto filling polymorphic table on save or on delete in django

    - by Mo J. Mughrabi
    Hi, Am working on an project in which I made an app "core" it will contain some of the reused models across my projects, most of those are polymorphic models (Generic content types) and will be linked to different models. Example below am trying to create audit model and will be linked to several models which may require auditing. This is the polls/models.py from django.db import models from django.contrib.auth.models import User from core.models import * from django.contrib.contenttypes import generic class Poll(models.Model): ## TODO: Document question = models.CharField(max_length=300) question_slug=models.SlugField(editable=False) start_poll_at = models.DateTimeField(null=True) end_poll_at = models.DateTimeField(null=True) is_active = models.BooleanField(default=True) audit_obj=generic.GenericRelation(Audit) def __unicode__(self): return self.question class Choice(models.Model): ## TODO: Document choice = models.CharField(max_length=200) poll=models.ForeignKey(Poll) audit_obj=generic.GenericRelation(Audit) class Vote(models.Model): ## TODO: Document choice=models.ForeignKey(Choice) Ip_Address=models.IPAddressField(editable=False) vote_at=models.DateTimeField("Vote at", editable=False) here is the core/modes.py from django.db import models from django.contrib.auth.models import User from django.contrib.contenttypes.models import ContentType from django.contrib.contenttypes import generic class Audit(models.Model): ## TODO: Document # Polymorphic model using generic relation through DJANGO content type created_at = models.DateTimeField("Created at", auto_now_add=True) created_by = models.ForeignKey(User, db_column="created_by", related_name="%(app_label)s_%(class)s_y+") updated_at = models.DateTimeField("Updated at", auto_now=True) updated_by = models.ForeignKey(User, db_column="updated_by", null=True, blank=True, related_name="%(app_label)s_%(class)s_y+") content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField(unique=True) content_object = generic.GenericForeignKey('content_type', 'object_id') and here is polls/admin.py from django.core.context_processors import request from polls.models import Poll, Choice from core.models import * from django.contrib import admin class ChoiceInline(admin.StackedInline): model = Choice extra = 3 class PollAdmin(admin.ModelAdmin): inlines = [ChoiceInline] admin.site.register(Poll, PollAdmin) Am quite new to django, what am trying to do here, insert a record in audit when a record is inserted in polls and then update that same record when a record is updated in polls.

    Read the article

  • Tkinter Gui to read in csv file and generate buttons based on the entries in the first row

    - by Thomas Jensen
    I need to write a gui in Tkinter that can choose a csv file, read it in and generate a sequence of buttons based on the names in the first row of the csv file (later the data in the csv file should be used to run a number of simulations). So far I have managed to write a Tkinter gui that will read the csv file, but I am stomped as to how I should proceed: from Tkinter import * import tkFileDialog import csv class Application(Frame): def __init__(self, master = None): Frame.__init__(self,master) self.grid() self.createWidgets() def createWidgets(self): top = self.winfo_toplevel() self.menuBar = Menu(top) top["menu"] = self.menuBar self.subMenu = Menu(self.menuBar) self.menuBar.add_cascade(label = "File", menu = self.subMenu) self.subMenu.add_command( label = "Read Data",command = self.readCSV) def readCSV(self): self.filename = tkFileDialog.askopenfilename() f = open(self.filename,"rb") read = csv.reader(f, delimiter = ",") app = Application() app.master.title("test") app.mainloop() Any help is greatly appreciated!

    Read the article

  • How to retrieve view of MultiIndex DataFrame

    - by Henry S. Harrison
    This question was inspired by this question. I had the same problem, updating a MultiIndex DataFrame by selection. The drop_level=False solution in Pandas 0.13 will allow me to achieve the same result, but I am still wondering why I cannot get a view from the MultiIndex DataFrame. In other words, why does this not work?: >>> sat = d.xs('sat', level='day', copy=False) Traceback (most recent call last): File "<stdin>", line 1, in <module> File "C:\Python27\lib\site-packages\pandas\core\frame.py", line 2248, in xs raise ValueError('Cannot retrieve view (copy=False)') ValueError: Cannot retrieve view (copy=False) Of course it could be only because it is not implemented, but is there a reason? Is it somehow ambiguous or impossible to implement? Returning a view is more intuitive to me than returning a copy then later updating the original. I looked through the source and it seems this situation is checked explicitly to raise an error. Alternatively, is it possible to get the same sort of view from any of the other indexing methods? I've experimented but have not been successful. [edit] Some potential implementations are discussed here. I guess with the last question above I'm wondering what the current best solution is to index into arbitrary multiindex slices and cross-sections.

    Read the article

  • Removing specific ticks from matplotlib plot

    - by Jsg91
    I'm trying to remove the origin ticks from my plot below to stop them overlapping, alternatively just moving them away from each other would also be great I tried this: xticks = ax.xaxis.get_major_ticks() xticks[0].label1.set_visible(False) yticks = ax.yaxis.get_major_ticks() yticks[0].label1.set_visible(False) However this removed the first and last ticks from the y axis like so: Does anyone have an idea about how to do this? Any help would be greatly appreciated.

    Read the article

  • Django repeating vars/cache issue?

    - by Mark
    I'm trying to build a better/more powerful form class for Django. It's working well, except for these sub-forms. Actually, it works perfectly right after I re-start apache, but after I refresh the page a few times, my HTML output starts to look like this: <input class="text" type="text" id="pickup_addr-pickup_addr-pickup_addr-id-pickup_addr-venue" value="" name="pickup_addr-pickup_addr-pickup_addr-pickup_addr-venue" /> The pickup_addr- part starts repeating many times. I was looking for loops around the prefix code that might have cause this to happen, but the output isn't even consistent when I refresh the page, so I think something is getting cached somewhere, but I can't even imagine how that's possible. The prefix car should be reset when the class is initialized, no? Unless it's somehow not initializing something? class Form(object): count = 0 def __init__(self, data={}, prefix='', action='', id=None, multiple=False): self.fields = {} self.subforms = {} self.data = {} self.action = action self.id = fnn(id, 'form%d' % Form.count) self.errors = [] self.valid = True if not empty(prefix) and prefix[-1:] not in ('-','_'): prefix += '-' for name, field in inspect.getmembers(self, lambda m: isinstance(m, Field)): if name[:2] == '__': continue field_name = fnn(field.name, name) field.label = fnn(field.label, humanize(field_name)) field.name = field.widget.name = prefix + field_name + ife(multiple, '[]') field.id = field.auto_id = field.widget.id = ife(field.id==None, 'id-') + prefix + fnn(field.id, field_name) + ife(multiple, Form.count) field.errors = [] val = fnn(field.widget.get_value(data), field.default) if isinstance(val, basestring): try: val = field.coerce(field.format(val)) except Exception, err: self.valid = False field.errors.append(escape_html(err)) field.val = self.data[name] = field.widget.val = val for rule in field.rules: rule.fields = self.fields rule.val = field.val rule.name = field.name self.fields[name] = field for name, form in inspect.getmembers(self, lambda m: ispropersubclass(m, Form)): if name[:2] == '__': continue self.subforms[name] = self.__dict__[name] = form(data=data, prefix='%s%s-' % (prefix, name)) Form.count += 1 Let me know if you need more code... I know it's a lot, but I just can't figure out what's causing this!

    Read the article

< Previous Page | 393 394 395 396 397 398 399 400 401 402 403 404  | Next Page >