Search Results

Search found 2551 results on 103 pages for 'hailstone sequence'.

Page 40/103 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

• How to detect a WCF session crash before calling a contract method?

  - by brain_pusher

  I am using a session mode for my WCF service. The problem is the following: if session is broken and no longer exists, client can't know it before calling a contract. For example, if the service has been restarted, the client's session id is invalid, because that session has been closed on the server side. I check the channel state before calling the contract and its value is CommunicationState.Opened even if session is already broken. So, when I call the contract after this check I get a CommunicationException with this message: The remote endpoint no longer recognizes this sequence. This is most likely due to an abort on the remote endpoint. The value of wsrm:Identifier is not a known Sequence identifier. The reliable session was faulted. Is there any workaround? I need a way to get an appropriate session state before calling a contract so that I can restore it without getting an exception. P.S. The CommunicationException type is general, so I can't detect a session crash by catching this exception. P.P.S. I have asked the similar question here, but in that case I didn't know the reason, now I don't know how to evade it.

  Read the article

• Add child to existing parent record in entity framework.

  - by Shawn Mclean

  My relationship between the parent and child is that they are connected by an edge. It is similiar to a directed graph structure. DAL: public void SaveResource(Resource resource) { context.AddToResources(resource); //Should also add children. context.SaveChanges(); } public Resource GetResource(int resourceId) { var resource = (from r in context.Resources .Include("ToEdges").Include("FromEdges") where r.ResourceId == resourceId select r).SingleOrDefault(); return resource; } Service: public void AddChildResource(int parentResourceId, Resource childResource) { Resource parentResource = repository.GetResource(parentResourceId); ResourceEdge inEdge = new ResourceEdge(); inEdge.ToResource = childResource; parentResource.ToEdges.Add(inEdge); repository.SaveResource(parentResource); } Error: An object with the same key already exists in the ObjectStateManager. The existing object is in the Unchanged state. An object can only be added to the ObjectStateManager again if it is in the added state. Image: I have been told this is the sequence in submitting a child to an already existing parent: Get parent - Attach Child to parent - submit parent. That is the sequence I used. The code above is extracted from an ASP.NET MVC 2 application using the repository pattern.

  Read the article

• Deterministic and non uniform long string generation from seed

  - by Limonup

  I had this weird idea for an encryption that I wanted to try out, it may be bad, and it may have done before, but I'm just doing it for fun. The short version of the question is: Is it possible to generate a long, deterministic and non-uniformly distributed string/sequence of numbers from a small seed? Long(er) version: I was thinking to encrypt a text by changing encoding. The new encoding would be generated via Huffman algorithm. To work well, the Huffman algorithm would need a fairly long text with non uniform distribution. Then characters can have different bit-lengths which would be the primary strength of this encryption. The problem is that its impractical to enter in/remember a long text each time you want to decrypt the text. So I was wondering if it was possible to generate a text from password seed? It doesn't matter what the text is, as long as it has non uniform distribution of characters and that the exact same sequence can be recreated each time you give it the same seed. Preferably, are there any functions/extensions in Python that can do this? EDIT: To expand on the "strength" of varying bit length: if I have a string "test", ASCII values 116, 101, 115, 116, which gives bit values of 1110100 1100101 1110011 1110100 Then, say my Huffman algorithm generates encoding like t = 101 e = 1100111 s = 10001 The final string is 101 1100111 10001 101, if we encode this back to ASCII, we get 1011100 1111000 1101000, which is 3 entirely different characters. Obviously its impossible to perform any kind of frequency analysis or something like that on this.

  Read the article

• C# iterator is executed twice when composing two IEnumerable methods

  - by achristoph

  I just started learning about C# iterator but got confused with the flow of the program after reading the output of the program. The foreach with uniqueVals seems to be executed twice. My understanding is that the first few lines up to the line before "Nums in Square: 3" should not be there. Can anyone help to explain why this happens? The output is: Unique: 1 Adding to uniqueVals: 1 Unique: 2 Adding to uniqueVals: 2 Unique: 2 Unique: 3 Adding to uniqueVals: 3 Nums in Square: 3 Unique: 1 Adding to uniqueVals: 1 Square: 1 Number returned from Unique: 1 Unique: 2 Adding to uniqueVals: 2 Square: 2 Number returned from Unique: 4 Unique: 2 Unique: 3 Adding to uniqueVals: 3 Square: 3 Number returned from Unique: 9 static class Program { public static IEnumerable<T> Unique<T>(IEnumerable<T> sequence) { Dictionary<T, T> uniqueVals = new Dictionary<T, T>(); foreach (T item in sequence) { Console.WriteLine("Unique: {0}", item); if (!uniqueVals.ContainsKey(item)) { Console.WriteLine("Adding to uniqueVals: {0}", item); uniqueVals.Add(item, item); yield return item; Console.WriteLine("After Unique yield: {0}", item); } } } public static IEnumerable<int> Square(IEnumerable<int> nums) { Console.WriteLine("Nums in Square: {0}", nums.Count()); foreach (int num in nums) { Console.WriteLine("Square: {0}", num); yield return num * num; Console.WriteLine("After Square yield: {0}", num); } } static void Main(string[] args) { var nums = new int[] { 1, 2, 2, 3 }; foreach (int num in Square(Unique(nums))) Console.WriteLine("Number returned from Unique: {0}", num); Console.Read(); } }

  Read the article

• Performance: float to int cast and clipping result to range

  - by durandai

  I'm doing some audio processing with float. The result needs to be converted back to PCM samples, and I noticed that the cast from float to int is surprisingly expensive. Whats furthermore frustrating that I need to clip the result to the range of a short (-32768 to 32767). While I would normally instictively assume that this could be assured by simply casting float to short, this fails miserably in Java, since on the bytecode level it results in F2I followed by I2S. So instead of a simple: int sample = (short) flotVal; I needed to resort to this ugly sequence: int sample = (int) floatVal; if (sample > 32767) { sample = 32767; } else if (sample < -32768) { sample = -32768; } Is there a faster way to do this? (about ~6% of the total runtime seems to be spent on casting, while 6% seem to be not that much at first glance, its astounding when I consider that the processing part involves a good chunk of matrix multiplications and IDCT) EDIT The cast/clipping code above is (not surprisingly) in the body of a loop that reads float values from a float[] and puts them into a byte[]. I have a test suite that measures total runtime on several test cases (processing about 200MB of raw audio data). The 6% were concluded from the runtime difference when the cast assignment "int sample = (int) floatVal" was replaced by assigning the loop index to sample. EDIT @leopoldkot: I'm aware of the truncation in Java, as stated in the original question (F2I, I2S bytecode sequence). I only tried the cast to short because I assumed that Java had an F2S bytecode, which it unfortunately does not (comming originally from an 68K assembly background, where a simple "fmove.w FP0, D0" would have done exactly what I wanted).

  Read the article

• CCAnimate/CCAnimation cause inconsistent setTexture behavior in cocos2d on iPhone

  - by chillid

  Hi, I have a character that goes through multiple states. The state changes are reflected by means of a sprite image (texture) change. The state change is triggered by a user tapping on the sprite. This works consistently and quite well. I then added an animation during State0. Now, when the user taps - setTexture gets executed to change the texture to reflect State1, however some of the times (unpredictable) it does not change the texture. The code flows as below: // 1. // Create the animation sequence CGRect frame1Rect = CGRectMake(0,32,32,32); CGRect frame2Rect = CGRectMake(32,32,32,32); CCTexture2D* texWithAnimation = [[CCTextureCache sharedTextureCache] addImage:@"Frames0_1_thinkNthickoutline32x32.png"]; id anim = [[[CCAnimation alloc] initWithName:@"Sports" delay:1/25.0] autorelease]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame1Rect offset:ccp(0,0)]]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame2Rect offset:ccp(0,0)]]; // Make the animation sequence repeat forever id myAction = [CCAnimate actionWithAnimation: anim restoreOriginalFrame:NO]; // 2. // Run the animation: sports = [[CCRepeatForever alloc] init]; [sports initWithAction:myAction]; [self.sprite runAction:sports]; // 3. stop action on state change and change texture: NSLog(@"Stopping action"); [sprite stopAction:sports]; NSLog(@"Changing texture for kCJSports"); [self setTexture: [[CCTextureCache sharedTextureCache] addImage:@"SportsOpen.png"]]; [self setTextureRect:CGRectMake(0,0,32,64)]; NSLog(@"Changed texture for kCJSports"); Note that all the NSLog lines get logged - and the texture RECT changes - but the image/texture changes only some of the times - fails for around 10-30% of times. Locking/threading/timing issue somewhere? My app (game) is single threaded and I only use the addImage and not the Async version. Any help much appreciated.

  Read the article

• How to define multiple elements in XML Schema with the same name and different attribute value allow

  - by David Skyba

  I would like to create XML Schema for this chunk of xml, I would like to restrict the values of "name" attribute, so that in output document on and only one instance of day is allowed for each week day: <a> <day name="monday" /> <day name="tuesday" /> <day name="wednesday" /> </a> I have tried to use this: <xs:complexType name="a"> <xs:sequence> <xs:element name="day" minOccurs="1" maxOccurs="1"> <xs:complexType> <xs:attribute name="name" use="required"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="monday" /> </xs:restriction> </xs:simpleType> </xs:attribute> </xs:complexType> </xs:element> <xs:element name="day" minOccurs="1" maxOccurs="1"> <xs:complexType> <xs:attribute name="name" use="required"> <xs:simpleType> <xs:restriction base="xs:string"> <xs:enumeration value="tuesday" /> </xs:restriction> </xs:simpleType> </xs:attribute> </xs:complexType> </xs:element> </xs:sequence> </xs:complexType> but XML Schema validator in eclipse says error "Multiple elements with name 'day', with different types, appear in the model group.". Is there any other way?

  Read the article

• WSDL AXIS Arrays

  - by SKS

  I am trying to create wsdl definition for the below soap response, < reasonCode Required="TRUE" < ValidCodeRR< /ValidCode < ValidCodeRB< /ValidCode < ValidCodeRT< /ValidCode < ValidCodeAR< /ValidCode < /reasonCode Below is the wsdl definition I have, < xsd:complexType < xsd:sequence < xsd:element name="ValidCode" type="xsd:string" minOccurs="0" maxOccurs="20" / < /xsd:sequence < xsd:attribute name="Required" type="xsd:string" / < /xsd:complexType < /xsd:element I am using Axis 1 to generate the webservices client and for the above wsdl definition, the tool generates the reasonCode as a string array like below. private java.lang.String[] reasonCode It ignores the attribute required. Does anyone know how to write wsdl defintion, such that axis creates reasonCode as an element with an attribute "required". Any help on this would be greatly appreciated. Thanks, SK

  Read the article

• JQuery checkbox state is updated differently between group click() and $.each(obj.click())

  - by teerapap

  The code below doesn't work in the same behavior. The sequence of click event and calling foo() is different. I want to know why they behave different sequence between call click() and iterate the objects before call click() on each. <script type="text/javascript"> function foo(obj){ alert(obj.id+" ->"+obj.checked); } function clickAll(val){ if (val) { $(":checkbox").click(); } else { $(":checkbox").each(function(i,obj){ obj.click(); }); } } </script> </head> <body> <input type="checkbox" id="check1" onclick="foo(this)" /> a <input type="checkbox" id="check2" onclick="foo(this)" /> b <input type="checkbox" id="check3" onclick="foo(this)" /> c <input type="button" onclick="clickAll(true)" value="click all" /> <input type="button" onclick="clickAll(false)" value="click all each" /> </body>

  Read the article

• Problem: writing parameter values to data driven MSTEST output

  - by Shubh

  Hi, I am trying to extract some information about the parameter variants used in an MSTEST data driven test case from trx file. Currently, For data driven tests, I get the output of same testcase with different inputs as a sequence of tags , but there is no info about the value of the variants. Example: Suppose we have a [data driven]TestMethod1() and the data rows contain variations a and b. There are two variations a=1,b=2 for which the test passes and a=3,b=4 for which the test fails. If we can output the info that it was a=1,b=2 which passed and a=3 b=4 which failed in the trx file; the output will be meaningful. Better information about test case runs from the output file alone(without any dependencies). Investigating the test failure without rerunning the whole set If the data rows change in data source(now a=1,b=2 pass and a=5,b=6 fail) , easy to decipher that the errors are different; although the fail sequence is still the same(row 0 pass row 1 fail but now row1 is different) Has any of you gone through a similar problem? What did you follow? I tried to put the parameter value information in the Description attribute of TestMethod, it didnt work. Any other methods you think can work too? thanks, Shubhankar

  Read the article

• How to approach parallel processing of messages?

  - by Dan

  I am redesigning the messaging system for my app to use intel threading building blocks and am stumped trying to decide between two possible approaches. Basically, I have a sequence of message objects and for each message type, a sequence of handlers. For each message object, I apply each handler registered for that message objects type. The sequential version would be something like this (pseudocode): for each message in message_sequence <- SEQUENTIAL for each handler in (handler_table for message.type) apply handler to message <- SEQUENTIAL The first approach which I am considering processes the message objects in turn (sequentially) and applies the handlers concurrently. Pros: predictable ordering of messages (ie, we are guaranteed a FIFO processing order) (potentially) lower latency of processing each message Cons: more processing resources available than handlers for a single message type (bad parallelization) bad use of processor cache since message objects need to be copied for each handler to use large overhead for small handlers The pseudocode of this approach would be as follows: for each message in message_sequence <- SEQUENTIAL parallel_for each handler in (handler_table for message.type) apply handler to message <- PARALLEL The second approach is to process the messages in parallel and apply the handlers to each message sequentially. Pros: better use of processor cache (keeps the message object local to all handlers which will use it) small handlers don't impose as much overhead (as long as there are other handlers also to be run) more messages are expected than there are handlers, so the potential for parallelism is greater Cons: Unpredictable ordering - if message A is sent before message B, they may both be processed at the same time, or B may finish processing before all of A's handlers are finished (order is non-deterministic) The pseudocode is as follows: parallel_for each message in message_sequence <- PARALLEL for each handler in (handler_table for message.type) apply handler to message <- SEQUENTIAL The second approach has more advantages than the first, but non-deterministic ordering is a big disadvantage.. Which approach would you choose and why? Are there any other approaches I should consider (besides the obvious third approach: parallel messages and parallel handlers, which has the disadvantages of both and no real redeeming factors as far as I can tell)? Thanks!

  Read the article

• myXmlDataDoc.DataSet.ReadXml problem

  - by alex

  Hi: I am using myXmlDataDoc.DataSet.ReadXml(xml_file_name, XmlReadMode.InferSchema); to populate the tables within the dataset created by reading in a xml schema using: myStreamReader = new StreamReader(xsd_file_name); myXmlDataDoc.DataSet.ReadXmlSchema(myStreamReader); The problems I am facing is when it comes to read the xml tag: The readXml function puts the element in a different table and everything in the tables are 0s. Here is the print out of the datatable: TableName: test_data 100 2 1 TableName: parameters 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 10 0 11 0 12 0 In my xsd file, I represent an array using this: <xs:element name="test_data"> <xs:complexType> <xs:complexContent> <xs:extension base="test_base"> <xs:sequence> <xs:element name="a" type="xs:unsignedShort"/> <xs:element name="b" type="xs:unsignedShort"/> <xs:element name="c" type="xs:unsignedInt"/> <xs:element name="parameters" minOccurs="0" maxOccurs="12" type="xs:unsignedInt"/> </xs:sequence> </xs:extension> </xs:complexContent> </xs:complexType> And here is my xml file: 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 I am expecting after the readXml function call, the "parameters" is part of the test_data table. TableName: test_data 100 2 1 1 2 3 4 5 6 7 8 9 10 11 12 Does anyone knows what's wrong? Thanks

  Read the article

• How can you transform a set of numbers into mostly whole ones?

  - by Alice

  Small amount of background: I am working on a converter that bridges between a map maker (Tiled) that outputs in XML, and an engine (Angel2D) that inputs lua tables. Most of this is straight forward However, Tiled outputs in pixel offsets (integers of absolute values), while Angel2D inputs OpenGL units (floats of relative values); a conversion factor between these two is needed (for example, 32px = 1gu). Since OpenGL units are abstract, and the camera can zoom in or out if the objects are too small or big, the actual conversion factor isn't important; I could use a random number, and the user would merely have to zoom in or out. But it would be best if the conversion factor was selected such that most numbers outputted were small and whole (or fractions of small whole numbers), because that makes it easier to work with (and the whole point of the OpenGL units is that they are easy to work with). How would I find such a conversion factor reliably? My first attempt was to use the smallest number given; this resulted in no fractions below 1, but often lead to lots of decimal places where the factors didn't line up. Then I tried the mode of the sequence, which lead to the largest number of 1's possible, but often lead to very long floats for background images. My current approach gets the GCD of the whole sequence, which, when it works, works great, but can easily be thrown off course by a single bad apple. Note that while I could easily just pass the numbers I am given along, or pick some fixed factor, or use one of the conversions I specified above, I am looking for a method to reliably scale this list of integers to small, whole numbers or simple fractions, because this would most likely be unsurprising to the end user; this is not a one off conversion. The end users tend to use 1.0 as their "base" for manipulations (because it's simple and obvious), so it would make more sense for the sizes of entities to cluster around this.

  Read the article

• Latex - Apply an operation to every character in a string

  - by hroest

  Hi I am using LaTeX and I have a problem concerning string manipulation. I want to have an operation applied to every character of a string, specifically I want to replace every character "x" with "\discretionary{}{}{}x". I want to do this because I have a long string (DNA) which I want to be able to separate at any point without hyphenation. Thus I would like to have a command called "myDNA" that will do this for me instead of inserting manually \discretionary{}{}{} after every character. Is this possible? I have looked around the web and there wasnt much helpful information on this topic (at least not any I could understand) and I hoped that you could help. --edit To clarify: What I want to see in the finished document is something like this: the dna sequence is CTAAAGAAAACAGGACGATTAGATGAGCTTGAGAAAGCCATCACCACTCA AATACTAAATGTGTTACCATACCAAGCACTTGCTCTGAAATTTGGGGACTGAGTACACCAAATACGATAG ATCAGTGGGATACAACAGGCCTTTACAGCTTCTCTGAACAAACCAGGTCTCTTGATGGTCGTCTCCAGGT ATCCCATCGAAAAGGATTGCCACATGTTATATATTGCCGATTATGGCGCTGGCCTGATCTTCACAGTCAT CATGAACTCAAGGCAATTGAAAACTGCGAATATGCTTTTAATCTTAAAAAGGATGAAGTATGTGTAAACC CTTACCACTATCAGAGAGTTGAGACACCAGTTTTGCCTCCAGTATTAGTGCCCCGACACACCGAGATCCT AACAGAACTTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATT just plain linebreaks, without any hyphens. The DNA sequence will be one long string without any spaces or anything but it can break at any point. This is why my idea was to inesert a "\discretionary{}{}{}" after every character, so that it can break at any point without inserting any hyphens.

  Read the article

• Validating and filling default values in XML based on XSD in Python

  - by PoltoS

  I have an XML like <a> <b/> <b c="2"/> </a> I have my XSD <xs:element name="a"> <xs:complexType> <xs:sequence> <xs:element name="b" maxOccurs="unbounded"> <xs:attribute name="c" default="1"/> </xs:element> </xs:sequence> </xs:complexType> </xs:element> I want to use my XSD to validate my original XML and fill all default values: <a> <b c="1"/> <b c="2"/> </a> How do I get it in Python? With validation there is no problem (e.g. XMLSchema). The problem are the default values.

  Read the article

• git changes modification time of files

  - by tanascius

  In the GitFaq I can read, that Git sets the current time as the timestamp on every file it modifies, but only those. However, I tried this command sequence (EDIT: added complete command sequence) $ git init test && cd test Initialized empty Git repository in d:/test/.git/ exxxxxxx@wxxxxxxx /d/test (master) $ touch filea fileb exxxxxxx@wxxxxxxx /d/test (master) $ git add . exxxxxxx@wxxxxxxx /d/test (master) $ git commit -m "first commit" [master (root-commit) fcaf171] first commit 0 files changed, 0 insertions(+), 0 deletions(-) create mode 100644 filea create mode 100644 fileb exxxxxxx@wxxxxxxx /d/test (master) $ ls -l > filea exxxxxxx@wxxxxxxx /d/test (master) $ touch fileb -t 200912301000 exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 1 -rw-r--r-- 1 exxxxxxx Administ 132 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Dec 30 10:00 fileb exxxxxxx@wxxxxxxx /d/test (master) $ git status -a warning: LF will be replaced by CRLF in filea # On branch master warning: LF will be replaced by CRLF in filea # Changes to be committed: # (use "git reset HEAD <file>..." to unstage) # # modified: filea # exxxxxxx@wxxxxxxx /d/test (master) $ git checkout . exxxxxxx@wxxxxxxx /d/test (master) $ ls -l total 0 -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 filea -rw-r--r-- 1 exxxxxxx Administ 0 Feb 12 18:36 fileb Now my question: Why did git change the timestamp of file fileb? I'd expect the timestamp to be unchanged. Are my commands causing a problem? Maybe it is possible to do something like a git checkout . --modified instead? I am using git version 1.6.5.1.1367.gcd48 under mingw32/windows xp.

  Read the article

• Schema for element with Attributes and Child nodes

  - by Matthew

  I am trying to write xsd type schema for an element that has a custom type to include addition attributes to extend a base type. I am running into trouble getting the syntax right. <xs:element name="graphs"> <xs:complexType> <xs:sequence> <xs:element name="graph" minOccurs="1" maxOccurs="unbounded" type="graphType"> <!-- child elements --> </xs:element> </xs:sequence> </xs:complexType> </xs:element> <xs:complexType name="graphType"> <xs:simpleContent> <xs:extension base="xs:string"> <xs:attribute name="title" type="xs:string"/> <xs:attribute name="type" type="xs:string"/> </xs:extension> </xs:simpleContent> </xs:complexType> I thought this would be something very common, but having read many tuts and forums, I cant seem to find an answer that works for me.

  Read the article

• How to make write operation idempotent?

  - by Morgan Cheng

  I'm reading article about recently release Gizzard sharding framework by twitter(http://engineering.twitter.com/2010/04/introducing-gizzard-framework-for.html). It mentions that all write operations must be idempotent to make sure high reliability. According to wikipedia, "Idempotent operations are operations that can be applied multiple times without changing the result." But, IMHO, in Gazzard case, idempotent write operation should be operations that sequence doesn't matter. Now, my question is: How to make write operation idempotent? The only thing I can image is to have a version number attached to each write. For example, in blog system. Each blog must have a $blog_id and $content. In application level, we always write a blog content like this write($blog_id, $content, $version). The $version is determined to be unique in application level. So, if application first try to set one blog to "Hello world" and second want it to be "Goodbye", the write is idempotent. We have such two write operations: write($blog_id, "Hello world", 1); write($blog_id, "Goodbye", 2); These two operations are supposed to changed two different records in DB. So, no matter how many times and what sequence these two operations executed, the results are same. This is just my understanding. Please correct me if I'm wrong.

  Read the article

• Open closed prinicple, problem

  - by Marcus

  Hi, I'm trying to apply OCP to a code snippet I have that in it's current state is really smelly, but I feel I'm not getting all the way to the end. Current code: public abstract class SomeObject {} public class SpecificObject1 : SomeObject {} public class SpecificObject2 : SomeObject {} // Smelly code public class Model { public void Store(SomeObject someObject) { if (someObject is SpecificObject1) {} else if (someObject is SpecificObject2) {} } } That is really ugly, my new approach looks like this: // No so smelly code public class Model { public void Store(SomeObject someObject) { throw new Expception("Not allowed!"); } public void Store(SpecificObject1 someObject) {} public void Store(SpecificObject2 someObject) {} } When a new SomeObject type comes along I must implement how that specific object is stored, this will break OCP cause I need to alter the Model-class. To move the store logic to SomeObject also feels wrong cause then I will violate SRP (?), becuase in this case the SomeObject is almost like a DTO, it's resposibility it not how to know to store itself. If a new implementation to SomeObject comes along who's store implementation is missing I will get a runtime error due to exception in Store method in Model class, it also feels like a code smell. This is because calling code will in the form of IEnumerable<SomeObject> sequence; I will not know the specific types of the sequence objects. I can't seem to grasp the OCP-concept. Anyone has any concrete examples or links that is a bit more than just some Car/Fruit example?

  Read the article

• Reading a C/C++ data structure in C# from a byte array

  - by Chris Miller

  What would be the best way to fill a C# struct from a byte[] array where the data was from a C/C++ struct? The C struct would look something like this (my C is very rusty): typedef OldStuff { CHAR Name[8]; UInt32 User; CHAR Location[8]; UInt32 TimeStamp; UInt32 Sequence; CHAR Tracking[16]; CHAR Filler[12];} And would fill something like this: [StructLayout(LayoutKind.Explicit, Size = 56, Pack = 1)]public struct NewStuff{ [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(0)] public string Name; [MarshalAs(UnmanagedType.U4)] [FieldOffset(8)] public uint User; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 8)] [FieldOffset(12)] public string Location; [MarshalAs(UnmanagedType.U4)] [FieldOffset(20)] public uint TimeStamp; [MarshalAs(UnmanagedType.U4)] [FieldOffset(24)] public uint Sequence; [MarshalAs(UnmanagedType.ByValTStr, SizeConst = 16)] [FieldOffset(28)] public string Tracking;} What is best way to copy OldStuff to NewStuff, if OldStuff was passed as byte[] array? I'm currently doing something like the following, but it feels kind of clunky. GCHandle handle;NewStuff MyStuff;int BufferSize = Marshal.SizeOf(typeof(NewStuff));byte[] buff = new byte[BufferSize];Array.Copy(SomeByteArray, 0, buff, 0, BufferSize);handle = GCHandle.Alloc(buff, GCHandleType.Pinned);MyStuff = (NewStuff)Marshal.PtrToStructure(handle.AddrOfPinnedObject(), typeof(NewStuff));handle.Free(); Is there better way to accomplish this?

  Read the article

• Sum of even fibonacci numbers

  - by user300484

  This is a Project Euler problem. If you don't want to see candidate solutions don't look here. Hello you all! im developping an application that will find the sum of all even terms of the fibonacci sequence. The last term of this sequence is 4,000,000 . There is something wrong in my code but I cannot find the problem since it makes sense to me. Can you please help me? using System.Collections.Generic; using System.Linq; using System.Text; namespace ConsoleApplication1 { class Program { static void Main(string[] args) { long[] arr = new long [1000000] ; long i= 2; arr[i-2]=1; arr[i-1]=2; long n= arr[i]; long s=0; for (i=2 ; n <= 4000000; i++) { arr[i] = arr[(i - 1)] + arr[(i - 2)]; } for (long f = 0; f <= arr.Length - 1; f++) { if (arr[f] % 2 == 0) s += arr[f]; } Console.Write(s); Console.Read(); } } }

  Read the article

• Deleting While Iterating in Ruby?

  - by Jesse J

  I'm iterating over a very large set of strings, which iterates over a smaller set of strings. Due to the size, this method takes a while to do, so to speed it up, I'm trying to delete one of the strings from the smaller set that no longer needs to be used. Below is my current code: Ms::Fasta.foreach(@database) do |entry| all.each do |set| if entry.header[1..40].include? set[1] + "|" startVal = entry.sequence.scan_i(set[0])[0] if startVal != nil @locations << [set[0], set[1], startVal, startVal + set[1].length] all.delete(set) end end end end The problem I face is that the easy way, array.delete(string), effectively adds a break statement to the inner loop, which messes up the results. The only way I know how to fix this is to do this: Ms::Fasta.foreach(@database) do |entry| i = 0 while i < all.length set = all[i] if entry.header[1..40].include? set[1] + "|" startVal = entry.sequence.scan_i(set[0])[0] if startVal != nil @locations << [set[0], set[1], startVal, startVal + set[1].length] all.delete_at(i) i -= 1 end end i += 1 end end This feels kind of sloppy to me. Is there a better way to do this? Thanks.

  Read the article

• Is there a general-purpose printf-ish routine defined in any C standard

  - by supercat

  In many C libraries, there is a printf-style routine which is something like the following: int __vgprintf(void *info, (void)(*print_function(void*, char)), const char *format, va_list params); which will format the supplied string and call print_function with the passed-in info value and each character in sequence. A function like fprintf will pass __vgprintf the passed-in file parameter and a pointer to a function which will cast its void* to a FILE* and output the passed-in character to that file. A function like snprintf will create a struct holding a char* and length, and pass the address of that struct to a function which will output each character in sequence, space permitting. Is there any standard for such a function, which could be used if e.g. one wanted a function to output an arbitrary format to a TCP port? A common approach is to allocate a buffer one hopes is big enough, use snprintf to put the data there, and then output the data from the buffer. It would seem cleaner, though, if there were a standard way to to specify that the print formatter should call a user-supplied routine with each character.

  Read the article

• A generic C++ library that provides QtConcurrent functionality?

  - by Lucas

  QtConcurrent is awesome. I'll let the Qt docs speak for themselves: QtConcurrent includes functional programming style APIs for parallel list processing, including a MapReduce and FilterReduce implementation for shared-memory (non-distributed) systems, and classes for managing asynchronous computations in GUI applications. For instance, you give QtConcurrent::map() an iterable sequence and a function that accepts items of the type stored in the sequence, and that function is applied to all the items in the collection. This is done in a multi-threaded manner, with a thread pool equal to the number of logical CPU's on the system. There are plenty of other function in QtConcurrent, like filter(), filteredReduced() etc. The standard CompSci map/reduce functions and the like. I'm totally in love with this, but I'm starting work on an OSS project that will not be using the Qt framework. It's a library, and I don't want to force others to depend on such a large framework like Qt. I'm trying to keep external dependencies to a minimum (it's the decent thing to do). I'm looking for a generic C++ framework that provides me with the same/similar high-level primitives that QtConcurrent does. AFAIK boost has nothing like this (I may be wrong though). boost::thread is very low-level compared to what I'm looking for. I know C# has something very similar with their Parallel Extensions so I know this isn't a Qt-only idea. What do you suggest I use?

  Read the article

• inconsistent setTexture behavior in cocos2d on iPhone after using CCAnimate/CCAnimation

  - by chillid

  Hi, I have a character that goes through multiple states. The state changes are reflected by means of a sprite image (texture) change. The state change is triggered by a user tapping on the sprite. This works consistently and quite well. I then added an animation during State0. Now, when the user taps - setTexture gets executed to change the texture to reflect State1, however some of the times (unpredictable) it does not change the texture. The code flows as below: // 1. // Create the animation sequence CGRect frame1Rect = CGRectMake(0,32,32,32); CGRect frame2Rect = CGRectMake(32,32,32,32); CCTexture2D* texWithAnimation = [[CCTextureCache sharedTextureCache] addImage:@"Frames0_1_thinkNthickoutline32x32.png"]; id anim = [[[CCAnimation alloc] initWithName:@"Sports" delay:1/25.0] autorelease]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame1Rect offset:ccp(0,0)]]; [anim addFrame:[CCSpriteFrame frameWithTexture:texWithAnimation rect:frame2Rect offset:ccp(0,0)]]; // Make the animation sequence repeat forever id myAction = [CCAnimate actionWithAnimation: anim restoreOriginalFrame:NO]; // 2. // Run the animation: sports = [[CCRepeatForever alloc] init]; [sports initWithAction:myAction]; [self.sprite runAction:sports]; // 3. stop action on state change and change texture: NSLog(@"Stopping action"); [sprite stopAction:sports]; NSLog(@"Changing texture for kCJSports"); [self setTexture: [[CCTextureCache sharedTextureCache] addImage:@"SportsOpen.png"]]; [self setTextureRect:CGRectMake(0,0,32,64)]; NSLog(@"Changed texture for kCJSports"); Note that all the NSLog lines get logged - and the texture RECT changes - but the image/texture changes only some of the times - fails for around 10-30% of times. Locking/threading/timing issue somewhere? My app (game) is single threaded and I only use the addImage and not the Async version. Any help much appreciated.

  Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >