Search Results

Search found 2947 results on 118 pages for 'partial specialization'.

Page 40/118 | < Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >

  • Ajax actionlinks straight from a DropDownList

    - by Ingó Vals
    I've got a small linkbox on the side of my page that is rendered as a PartialView. In it I have a dropDownlist the should change the routing value of the links in the box but I'm having difficulty doing so. My current plan is to call on something similar to a Ajax.ActionLink to reload the partial view into the with a different parameter based on the value of the dropdown selection. However I'm having multiple problems with this, for example as a novice in using dropdownlists I have no idea how to call on the selected value for example. <%= Html.DropDownList("DropDownList1", new SelectList(Model, "ID", "Name"), "--Pick--", new { AutoPostBack = "true", onchange = "maybe something here" })%> I tried putting in the sys.mvc.AsyncHyperlink into the onchange attribute and that worked except I don't know how to put in the route value for it. Sys.Mvc.AsyncHyperlink.handleClick(this, new Sys.UI.DomEvent(event), { insertionMode: Sys.Mvc.InsertionMode.replace, updateTargetId: 'SmallMenu' } Is there no straight Ajax drop down list that fires events onchange? Any way this is possible? I have later in the Partial view the Ajax actionlinks but they need to have their id's updated by the value in the dropdownlist and if I could do that somehow else I would appreciate a suggestion.

    Read the article

  • Primefaces, JavaScript, and JSF does not work well together or am I doing something wrong

    - by Harry Pham
    Here is something so simple <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <input id="tom"/> When u click on the Tom, the textbox get focus. Great, now try this <p:commandLink value="Tom" onclick="document.getElementById('tom').focus()"/><br/> <h:inputText id="tom"/> <br/> when I click nothing happen, I check firebug, I see document.getElementById("tom") is null When I try to use jQuery $('#tom').focus(), nothing happen, no error, but did not get focus either. This is the response (not sure if this is the response from the server) when I see from firebug <?xml version="1.0" encoding="utf-8"?> <partial-response> <changes> <update id="javax.faces.ViewState"><![CDATA[455334589763307998:-2971181471269134244]]></update> </changes> <extension primefacesCallbackParam="validationFailed">{"validationFailed":false}</extension> </partial-response>

    Read the article

  • Problem with custom Equality in Entity Framework

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • Automatic INotifyPropertyChanged Implementation through T4 code generation?

    - by chrischu
    I'm currently working on setting up a new project of mine and was wondering how I could achieve that my ViewModel classes do have INotifyPropertyChanged support while not having to handcode all the properties myself. I looked into AOP frameworks but I think they would just blow up my project with another dependency. So I thought about generating the property implementations with T4. The setup would be this: I have a ViewModel class that declares just its Properties background variables and then I use T4 to generate the Property Implementations from it. For example this would be my ViewModel: public partial class ViewModel { private string p_SomeProperty; } Then T4 would go over the source file and look for member declarations named "p_" and generate a file like this: public partial class ViewModel { public string SomeProperty { get { return p_SomeProperty; } set { p_SomeProperty= value; NotifyPropertyChanged("SomeProperty"); } } } This approach has some advantages but I'm not sure if it can really work. So I wanted to post my idea here on StackOverflow as a question to get some feedback on it and maybe some advice how it can be done better/easier/safer.

    Read the article

  • entity framework POCO template in a n-tiers design question

    - by bryan
    HI all I was trying to follow the POCO Template walkthrough . And now I am having problems using it in n-tiers design. By following the article, I put my edmx model, and the template generated context.tt in my DAL project, and moved the generated model.tt entity classes to my Business Logic layer (BLL) project. By doing this, I could use those entities inside my BLL without referencing the DAL, I guess that is the idea of PI; without knowing anything about the data source. Now, I want to extend the entities (inside the model.tt) to perform some CUD action in the BLL project,so I added a new partial class same name as the one generated from template, public partial class Company { public static IEnumerable AllCompanies() { using(var context = new Entities()){ var q = from p in context.Companies select p; return q.ToList(); } } } however visual studio won't let me do that, and I think it was because the context.tt is in the DAL project, and the BLL project could not add a reference to the DAL project as DAL has already reference to the BLL. So I tried to added this class to the DAL and it compiled, but intelisense won't show up the BLL.Company.AllCompanies() in my web service method from my webservice project which has reference to my BLL project. What should I do now? I want to add CUD methods to the template generated entities in my BLL project, and call them in my web services from another project. I have been looking for this answer a few days already, and I really need some guides from here please. Bryan

    Read the article

  • Rails 3 - yield return or callback won't call in view <%= yield(:sidebar) || render('shared/sidebar'

    - by rzar
    Hey folks, I'm migrating a Website from Rails 2 (latest) to Rails 3 (beta2). Testing with Ruby 1.9.1p378 and Ruby 1.9.2dev (2010-04-05 trunk 27225) Stuck in a situation, i don't know which part will work well. Suspect yield is the problem, but don't know exactly. In my Layout Files I use the following technique quite often: app/views/layouts/application.html.erb: <%= yield(:sidebar) || render('shared/sidebar') %> For Example the partial look like: app/views/shared/_sidebar.html.erb: <p>Default sidebar Content. Bla Bla</p> Now it is time for the key part! In any view, I want to create a content_for block (optional). This can contain a pice of HTML etc. example below. If this block is set, the pice HTML inside should render in application.html.erb. If not, Rails should render the Partial at shared/_sidebar.html.erb on the right hand side. app/views/books/index.html.erb: <% content_for :sidebar do %> <strong>You have to read REWORK, a book from 37signals!</strong> <% end %> So you've got the idea. Hopefully. This technique worked well in any Rails 2.x Application. Now, in Rails 3 (beta2) only the yield Part is working. || render('shared/sidebar') The or side will not process by rails or maybe ruby. Thanks for input and time!

    Read the article

  • can't get jquery livequery to with an update panel

    - by Jeremy
    I have some basic html inside an asp.net update panel. Using livequery, I set up autocomplete, blur and keydown events so that they all continue to be wired up after the update panel does a partial page load. When the page initially loads, all the events work fine but after the update panel does a partial page reload, none of the events wired up with livequery continue to work. Are there known issues with livequery and update panels? Html: <asp:UpdatePanel ID="upData" runat="server" UpdateMode="Conditional"> <ContentTemplate> <asp:DataList ID="dlData" runat="server" DataSource='<%# this.Data %>' DataKeyField="ID"> <ItemTemplate> <table> <tr> <th class="required">Location</th> <td><asp:TextBox ID="txtFromLocation" MaxLength="10" CssClass="searchlocation fromlocation required" runat="server" Text='<%# Eval("FromLocation")%>'/><asp:RequiredFieldValidator ID="rvalFromLocation" runat="server" ControlToValidate="txtFromLocation" ValidationGroup="leg">*</asp:RequiredFieldValidator></td> </tr> </table> </ItemTemplate> </asp:DataList> </ContentTemplate> </asp:UpdatePanel> And then I have my javascript. Normally it has a bunch of other code, but I can reduce it down to this and still have the problem: $(document).ready(function() { $(".searchlocation").livequery(function() { $(this).keydown(function(event) {alert('test');}); }); });

    Read the article

  • ASP.NET Content Web Form - content from placeholder disappears

    - by Naeem Sarfraz
    I'm attempting to set a class on the body tag in my asp.net site which uses a master page and content web forms. I simply want to be able to do this by adding a bodycssclass property (see below) to the content web form page directive. It works through the solution below but when i attempt to view Default.aspx the Content1 control loses its content. Any ideas why? Here is how I'm doing it. I have a master page with the following content: <%@ Master Language="C#" ... %> <html><head>...</head> <body id=ctlBody runat=server> <asp:ContentPlaceHolder ID="cphMain" runat="server" /> </body> </html> it's code behind looks like: public partial class Site : MasterPageBase { public override string BodyCssClass { get { return ctlBody.Attributes["class"]; } set { ctlBody.Attributes["class"] = value; } } } it inherits from: public abstract class MasterPageBase : MasterPage { public abstract string BodyCssClass { get; set; } } my default.aspx is defined as: <%@ Page Title="..." [master page definition etc..] bodycssclass="home" %> <asp:Content ID="Content1" ContentPlaceHolderID="cphMain" runat="server"> Some content </asp:Content> the code behind for this file looks like: public partial class Default : PageBase { ... } and it inherits from : public class PageBase : Page { public string BodyCssClass { get { MasterPageBase mpbCurrent = this.Master as MasterPageBase; return mpbCurrent.BodyCssClass; } set { MasterPageBase mpbCurrent = this.Master as MasterPageBase; mpbCurrent.BodyCssClass = value; } } }

    Read the article

  • How to copy the shipping address to billing address

    - by Jerry
    Hi all I like to know if I can copy the shipping address to billing address. I got most of the parts done but I am not sure how to copy select menu (states) value to billing address. I really appreciate any helps. My code $(document).ready(function(){ Jquery $('#same').click(function(){ if($('#same').attr('checked')){ $('#bfName').val($('#fName').val()); $('#blName').val($('#lName').val()); $('#baddress1').val($('#address1').val()); $('#baddress2').val($('#address2').val()); $('#bcity').val($('#city').val()); alert(($('#state option:selected').val())); //not sure what to do here $('#bzip').val($('#zip').val()); }; }); Html <td><select name="state"> //shipping states......only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> <td><select name="bstate"> //billing state................only partial codes. <option value="">None <option value="AL">Alabama <option value="AK">Alaska <option value="AZ">Arizona <option value="AR">Arkansas <option value="CA">California <option value="CO">Colorado <option value="CT">Connecticut </select></td> Thanks a lot!

    Read the article

  • Rails 3.2 Ajax Update Div when Text Field Populated

    - by ctilley79
    In the end I would like a text field that passes a client_id to the partial. I would like to do this asynchronously so the shipment_products partial would dynamically change when the textfield value was updated. What is the best way to do this? In index.html.erb <!-- Text Field Here--> <div id="available_products"> <%= render "shipment_products" %> </div> In _shipment_products.html.erb <div id="shipment_products_container"> <h3>Assign Products to Ship<\h3> <ul class="shipment_products" id="shipment_products"> <% Product.by_client(client_id).each do |product|%> <!-- TextField value passed here --> <%= content_tag_for :li, product, :value => product.id do %> <%= hidden_field_tag("shipment[product_ids][]", product.id) %> <%= product.product_name %> <% end %> <% end %> <\ul> </div> This is similar to what I want in the end.

    Read the article

  • How can I render a list of objects using DisplayFor but from the controller in ASP.NET MVC?

    - by Darragh
    Here's the scenaio, I have an Employee object and a Company object which has a list of employees. I have Company.aspx which inherits from ViewPage<Company>. In Company.aspx I call Html.DisplayFor(m => m.Employees). I have an Employee.ascx partial view which inherits from ViewUserControl<Employee in my DisplayTemplates folder. Everything works fine and Company.aspx renders the Employee.ascx partial for each employee. Now I have two additional methods on my controller called GetEmployees and GetEmployee(Id). In the GetEmployee(Id) action I want to return the markup to display this one employee, and in GetEmployees() I want to render the markup to display all the employees (these two action methods will be called via AJAX). In the GetEmployee action I call return PartialView("DisplayTemplates\Employee", employee) This works, although I'd prefer something like return PartialViewFor(employee) which would determine the view name by convention. Anwyay, my question is how should I implement the GetEmployees() action? I don't want to create any more views, because frankly, I don't see why I should have to. I've tried the following which fails miserably :) return Content(New HtmlHelper<IList<Of DebtDto>>(null, null).DisplayFor(m => debts)); However if I could create an instance of an HtmlHelper object in my controller, I suppose I could get it to work, but it feels wrong. Any ideas? Have i missed something obvious?

    Read the article

  • WPF binding fails with custom add and remove accessors for INotifyPropertyChanged.PropertyChanged

    - by emddudley
    I have a scenario which is causing strange behavior with WPF data binding and INotifyPropertyChanged. I want a private member of the data binding source to handle the INotifyPropertyChanged.PropertyChanged event. I get some exceptions which haven't helped me debug, even when I have "Enable .NET Framework source stepping" checked in Visual Studio's options: A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.ArgumentException' occurred in mscorlib.dll A first chance exception of type 'System.InvalidOperationException' occurred in PresentationCore.dll Here's the source code: XAML <Window xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.microsoft.com/winfx/2006/xaml" x:Class="TestApplication.MainWindow" DataContext="{Binding RelativeSource={RelativeSource Self}}" Height="100" Width="100"> <StackPanel> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="A" /> <CheckBox IsChecked="{Binding Path=CheckboxIsChecked}" Content="B" /> </StackPanel> </Window> Normal implementation works public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; public MainWindow() { InitializeComponent(); } } Desired implementation doesn't work public partial class MainWindow : Window, INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged { add { lock (this.mHandler) { this.mHandler.PropertyChanged += value; } } remove { lock (this.mHandler) { this.mHandler.PropertyChanged -= value; } } } public bool CheckboxIsChecked { get { return this.mHandler.CheckboxIsChecked; } set { this.mHandler.CheckboxIsChecked = value; } } private HandlesPropertyChangeEvents mHandler = new HandlesPropertyChangeEvents(); public MainWindow() { InitializeComponent(); } public class HandlesPropertyChangeEvents : INotifyPropertyChanged { public event PropertyChangedEventHandler PropertyChanged; public bool CheckboxIsChecked { get { return this.mCheckboxIsChecked; } set { this.mCheckboxIsChecked = value; PropertyChangedEventHandler handler = this.PropertyChanged; if (handler != null) handler(this, new PropertyChangedEventArgs("CheckboxIsChecked")); } } private bool mCheckboxIsChecked = false; } }

    Read the article

  • Ajax.BeginForm driving me crazy

    - by Fabio Milheiro
    ASP.NET MVC3 I have a partial view that is initially rendered inside a div. The following is the partial code: @model Venue.Models.Validation.CustomerRequestModel <script src="@Url.Content("~/Scripts/jquery-1.4.4.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.min.js")" type="text/javascript"></script> <script src="@Url.Content("~/Scripts/jquery.validate.unobtrusive.min.js")" type="text/javascript"></script> <script type="text/javascript" src="/Scripts/MicrosoftAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcAjax.js"></script> <script type="text/javascript" src="/Scripts/MicrosoftMvcValidation.js"></script> @{ Html.RenderPartial("Message"); } @Html.ValidationSummary() @using (Ajax.BeginForm( "Customer", "Service", null, new AjaxOptions() { HttpMethod = "post", InsertionMode = InsertionMode.Replace, LoadingElementDuration = 100, LoadingElementId = "loading-customer", OnBegin = "hideSubmitButton", OnSuccess = "hideForm", OnComplete = "showSubmitButton", OnFailure = "showErrorMessage", UpdateTargetId = "formclientes", }, new { id = "customer-form" })) { // Fields are all type="text" although some are numbers. <input type="text" name="Address" class="clientes_form" /> } The action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Customer(CustomerRequestModel customer) { // ... } In the immediate window, this is what I get: this.Request.IsAjaxRequest() false Why?!

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • Problem with custom Equality and GetHashCode in a mutable object

    - by Shimmy
    Hello! I am using Entity Framework in my application. I implemented with the partial class of an entity the IEquatable<T> interface: Partial Class Address : Implements IEquatable(Of Address) 'Other part generated Public Overloads Function Equals(ByVal other As Address) As Boolean _ Implements System.IEquatable(Of Address).Equals If ReferenceEquals(Me, other) Then Return True Return AddressId = other.AddressId End Function Public Overrides Function Equals(ByVal obj As Object) As Boolean If obj Is Nothing Then Return MyBase.Equals(obj) If TypeOf obj Is Address Then Return Equals(DirectCast(obj, Address)) Else Return False End Function Public Overrides Function GetHashCode() As Integer Return AddressId.GetHashCode End Function End Class Now in my code I use it this way: Sub Main() Using e As New CompleteKitchenEntities Dim job = e.Job.FirstOrDefault Dim address As New Address() job.Addresses.Add(address) Dim contains1 = job.Addresses.Contains(address) 'True e.SaveChanges() Dim contains2 = job.Addresses.Contains(address) 'False 'The problem is that I can't remove it: Dim removed = job.Addresses.Remoeve(address) 'False End Using End Sub Note (I checked in the debugger visualizer) that the EntityCollection class stores its entities in HashSet so it has to do with the GetHashCode function, I want it to depend on the ID so entities are compared by their IDs. The problem is that when I hit save, the ID changes from 0 to its db value. So the question is how can I have an equatable object, being properly hashed. Please help me find what's wrong in the GetHashCode function (by ID) and what can I change to make it work. Thanks a lot.

    Read the article

  • How do I expose the columns collection of GridView control that is inside a user control

    - by Christopher Edwards
    See edit. I want to be able to do this in the aspx that consumes the user control. <uc:MyControl ID="MyGrid" runat="server"> <asp:BoundField DataField="FirstColumn" HeaderText="FirstColumn" /> <asp:BoundField DataField="SecondColumn" HeaderText="SecondColumn" /> </uc> I have this code (which doesn't work). Any ideas what I am doing wrong? VB Partial Public Class MyControl Inherits UserControl <System.Web.UI.IDReferenceProperty(GetType(DataControlFieldCollection))> _ Public Property Columns() As DataControlFieldCollection Get Return MyGridView.Columns End Get Set(ByVal value As DataControlFieldCollection) ' The Columns collection of the GridView is ReadOnly, so I rebuild it MyGridView.Columns.Clear() For Each c As DataControlField In value MyGridView.Columns.Add(c) Next End Set End Property ... End Class C# public partial class MyControl : UserControl {         [System.Web.UI.IDReferenceProperty(typeof(DataControlFieldCollection))]     public DataControlFieldCollection Columns {         get { return MyGridView.Columns; }         set {             MyGridView.Columns.Clear();             foreach (DataControlField c in value) {                 MyGridView.Columns.Add(c);             }         }     } ... } EDIT: Actually it does work, but auto complete does not work between the uc:MyControl opening and closing tags and I get compiler warnings:- Content is not allowed between the opening and closing tags for element 'MyControl'. Validation (XHTML 1.0 Transitional): Element 'columns' is not supported. Element 'BoundField' is not a known element. This can occur if there is a compilation error in the Web site, or the web.config file is missing. So I guess I need to use some sort of directive to tell the complier to expect content between the tags. Any ideas?

    Read the article

  • LINQ Datacontext Disposal Issues

    - by Refracted Paladin
    I am getting a Cannot access object: DataContext after it's been disposed in the below DAL method. I thought that I would be okay calling dispose there. result is an IEnumurable and I thought it was IQueryable that caused these kinds of problems. What am I doing wrong? How SHOULD I be disposing of my DataContext. Is there something better to be returning then a DataTable? This is a Desktop app that points at SQL 2005. Example method that causes this error -- public static DataTable GetEnrolledMembers(Guid workerID) { var DB = CmoDataContext.Create(); var AllEnrollees = from enrollment in DB.tblCMOEnrollments where enrollment.CMOSocialWorkerID == workerID || enrollment.CMONurseID == workerID join supportWorker in DB.tblSupportWorkers on enrollment.EconomicSupportWorkerID equals supportWorker.SupportWorkerID into workerGroup from worker in workerGroup.DefaultIfEmpty() select new { enrollment.ClientID, enrollment.CMONurseID, enrollment.CMOSocialWorkerID, enrollment.EnrollmentDate, enrollment.DisenrollmentDate, ESFirstName = worker.FirstName, ESLastName = worker.LastName, ESPhone = worker.Phone }; var result = from enrollee in AllEnrollees.AsEnumerable() where (enrollee.DisenrollmentDate == null || enrollee.DisenrollmentDate > DateTime.Now) //let memberName = BLLConnect.MemberName(enrollee.ClientID) let lastName = BLLConnect.MemberLastName(enrollee.ClientID) let firstName = BLLConnect.MemberFirstName(enrollee.ClientID) orderby enrollee.DisenrollmentDate ascending, lastName ascending select new { enrollee.ClientID, //MemberName = memberName, LastName = lastName, FirstName = firstName, NurseName = BLLAspnetdb.NurseName(enrollee.CMONurseID), SocialWorkerName = BLLAspnetdb.SocialWorkerName(enrollee.CMOSocialWorkerID), enrollee.EnrollmentDate, enrollee.DisenrollmentDate, ESWorkerName = enrollee.ESFirstName + " " + enrollee.ESLastName, enrollee.ESPhone }; DB.Dispose(); return result.CopyLinqToDataTable(); } partial class where I create the DataContext -- partial class CmoDataContext { public static bool IsDisconnectedUser { get { return Settings.Default.IsDisconnectedUser; } } public static CmoDataContext Create() { var cs = IsDisconnectedUser ? Settings.Default.CMOConnectionString : Settings.Default.Central_CMOConnectionString; return new CmoDataContext(cs); }

    Read the article

  • Need advice on using Grails and Ajax to append to a div like in Rails

    - by Nate
    I'm just starting out in Grails and need some advice on using Ajax. I want to append some html to the bottom of a div inside a form. This is basically what I have: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields -/div- -form- -a-Add Child 4-/a- When I click on the "Add Child" I want to make an ajax call that results in a new childrow getting inserted into the "listOfchildren" div. So the document would look like this: -form- -div id="listOfchildren"- childrow 1 input fields childrow 2 input fields childrow 3 input fields childrow 4 input fields -/div- -form- -a-Add Child 5-/a- In Rails I would do something simple like this: render :update do |page| page.insert_html :bottom, "list_of_children", :partial = child_partial page.replace "add_link", :partial = 'add_link' end The previous code sends an javascript back to the browser with two commands. The first command tells the browser to append some html to the bottom of a div. The second command updates the "add link" counter. In grails I can only see how to replace an entire div (which would wipe out the user's existing input) and I don't see how I can call multiple functions from the ajax response. I can probably do this if I was to write some javascript functions in prototype or whatever, but I'd like to avoid that if there is a simpler way. Thanks! Nate

    Read the article

  • Windows Media Encoder object not created in ASP.NET on MS Server 2003 64 bit

    - by Ron
    Hello, I created (and used) a Windows Media Encoder object in Microsoft Visual C# 2008 Express Edition on MS Server 2003 64 bit. This worked fine. However, when I attempted to create the equivalent Windows Media Encoder object using Microsoft Visual Web Developer 2008 on MS Server 2003 64 bit, the following exception was thrown: "Retrieving the COM class factory for component with CLSID {632B606A-BBC6-11D2-A329-006097C4E476} failed due to the following error: 80040154." It cannot be that the component isn’t registered, because both have a reference to the same WMEncEng.dll file. The Microsoft Visual Web Developer 2008 code also worked fine on XP 32 bit. Could it be a problem with permissions? Regardless, anyone have any ideas why this problem is occurring and, more importantly, how to resolve it? Thank you. Here are the two code snippets from MS Server 2003 64 bit: Microsoft Visual Web Developer 2008 (did not work): using System; using WMEncoderLib; namespace TestWMEnc { public partial class _Default : System.Web.UI.Page { protected void Page_Load(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); //exception thrown // ... } catch (Exception err) { string exception = err.Message; } } } } Microsoft Visual C# 2008 Express Edition (worked fine): using System; using System.Windows.Forms; using WMEncoderLib; namespace testWMEncoder { public partial class Form1 : Form { public Form1() { InitializeComponent(); } private void button1_Click(object sender, EventArgs e) { try { WMEncoder encoder = new WMEncoder(); // ... } catch (Exception err) { string exception = err.Message; } } } }

    Read the article

  • Using of Templated Helpers in MVC 2.0 : How can use the name of the property that I'm rendering insi

    - by Andrey Tagaew
    Hi. I'm reviewing new features of ASP.NET MVC 2.0. During the review i found really interesting using Templated Helpers. As they described it, the primary reason of using them is to provide common way of how some datatypes should be rendered. Now i want to use this way in my project for DateTime datatype My project was written for the MVC 1.0 so generating of editbox is looking like this: <%= Html.TextBox("BirthDate", Model.BirthDate, new { maxlength = 10, size = 10, @class = "BirthDate-date" })%> <script type="text/javascript"> $(document).ready(function() { $(".BirthDate-date").datepicker({ showOn: 'button', buttonImage: '<%=Url.Content("~/images/i_calendar.gif") %>', buttonImageOnly: true }); }); </script> Now i want to use Template Helper, so i want to have above code once i type next sentence: <%=Html.EditorFor(f=>f.BirthDate) %> According to the manual I create DataTime.ascx partial view inside Shared/EditorTemplates folder. I put there above code and stacked with the problem. How can i pass the name of the property that I'm rendering with template helper? As you can see from my example, i really need it, since I'm using the name of the property to specify data value and parameter name that will be send during the POST requsest. Also, I'm using it to generate class name for JS calendar building. I tried to remove my partial class for template helper and made MVC to generate its default behavior. Here what it generated for me: <input type="text" value="04/29/2010" name="LoanApplicationDays" id="LoanApplicationDays" class="text-box single-line"> As you can see, it used the name of the property for "name" and "id" attributes. This example let me to presume that Template Helper knows about the name of the property. So, there should be some way of how to use it in custom implementation. Thanks for your help!

    Read the article

  • Delphi - Populate an imagelist with icons at runtime 'destroys' transparency

    - by ben
    Hi again, I've spended hours for this (simple) one and don't find a solution :/ I'm using D7 and the TImageList. The ImageList is assigned to a toolbar. When I populate the ImageList at designtime, the icons (with partial transparency) are looking fine. But I need to populate it at runtime, and when I do this the icons are looking pretty shitty - complete loose of the partial transparency. I just tried to load the icons from a .res file - with the same result. I've tried third party image lists also without success. I have no clue what I could do :/ Thanks 2 all ;) edit: To be honest I dont know exactly whats going on. Alpha blending is the correkt term... Here are 2 screenies: Icon added at designtime: Icon added at runtime: Your comment that alpha blending is not supported just brought the solution: I've edited the image in an editor and removed the "alpha blended" pixels - and now it looks fine. But its still strange that the icons look other when added at runtime instead of designtime. If you (or somebody else ;) can explain it, I would be happy ;) thanks for you support!

    Read the article

  • What is the correct way to create dynamic javascript in ASP.net MVC2?

    - by sabbour
    I'm creating a Google Maps partial view/user control in my project that is passed a strongly typed list of objects containing latitude and longitude values. Currently, this is the code I have for the partial: <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<IEnumerable<Project.Models.Entities.Location>>" %> <!-- Place for google to put the map --> <div id="report_map_canvas" style="width: 100%; height: 728px; margin-bottom: 2px;"> </div> <script type='text/javascript'> google.load("maps", "2"); $(document).ready(initializeMap); function initializeMap() { if (GBrowserIsCompatible()) { var map = new GMap2(document.getElementById('report_map_canvas')); map.setCenter(new GLatLng(51.5, -0.1167), 2); <% foreach (var item in Model) { %> map.addOverlay(new GMarker(new GLatLng('<%= Html.Encode(item.latitude)%>','<%= Html.Encode(item.longitude)%>'),{ title: '<%= Html.Encode(String.Format("{0:F}",item.speed)) %> km/h '})); <% } %> map.setUIToDefault(); } } </script> Is it right to dynamically create the javascript file this way by looping over the list and emitting javascript? Is there a better way to do it?

    Read the article

  • Rails ajax jquery problem

    - by user283179
    Ok I have this problem I'm trying to use Jquery to load a partial in replace of a listed object. loadshow: $(function() { $(".style_image_<%= style.id %> a").click(function() { $(".style_image_<%= style.id %>").html("loading... ") $(".style_image_<%= style.id %>").html("<%= escape_javascript(render("show")) %>") $.get(this.href, null, null, "html"); return false; }); }); _show.html.erb: <%=link_to image_tag(style.cover.pic.url(:normal)), style %> I'm getting this error: missing ) after argument list [Break on this error] $(".style_image_<%= style.id %>").htm...scape_javascript(render("show")) %>")\n There is two problems with my code here the first is the click function is not targeting the .style_image_<%= style.id % .... i.e (.style_image_42) if I replace the css target with 42 instead of _style.id the click target works; why is this? And with or without this change the _show partial is not render and the above error is given. Not really that good with Javascript any help would be great! P.s. The effect I really want is like one of those super cool cargo themes: http://cargocollective.com/publikspace Thanks Dan!

    Read the article

  • How to include a child object's child object in Entity Framework 5

    - by Brendan Vogt
    I am using Entity Framework 5 code first and ASP.NET MVC 3. I am struggling to get a child object's child object to populate. Below are my classes.. Application class; public class Application { // Partial list of properties public virtual ICollection<Child> Children { get; set; } } Child class: public class Child { // Partial list of properties public int ChildRelationshipTypeId { get; set; } public virtual ChildRelationshipType ChildRelationshipType { get; set; } } ChildRelationshipType class: public class ChildRelationshipType { public int Id { get; set; } public string Name { get; set; } } Part of GetAll method in the repository to return all the applications: return DatabaseContext.Applications .Include("Children"); The Child class contains a reference to the ChildRelationshipType class. To work with an application's children I would have something like this: foreach (Child child in application.Children) { string childName = child.ChildRelationshipType.Name; } I get an error here that the object context is already closed. How do I specify that each child object must include the ChildRelationshipType object like what I did above?

    Read the article

  • alternative to JQuery form.submit() to do ajax post

    - by BluntTool
    Hello, I have a mvc2 application with a view like this <% using (Ajax.BeginForm("UserApprove", new { id = Model.id }, new AjaxOptions() { UpdateTargetId = "statusLights", OnSuccess = "HideButtons" }, new { id = "UserApprove" })) {%> <input type="button" value="Approve" onclick="$('#dialogApprove').dialog('open')" /> <div id="dialogApprove" title="Confirm"> <p> Are you sure you want to approve this request? </p> </div> <% } %> FYI, the controller returns a partial view back. I used to not have the jquery dialog and just simple a <input type="Submit" value="Approve" /> that used to work fine I added the jquery dialog and I have something like this to initialize the dialog. $("#dialogApprove").dialog({ autoOpen: false, draggable: true, resizable: false, buttons: { "Cancel": function() { $(this).dialog("close") }, "Approve": function() { $("#UserApprove").submit(); $(this).dialog("close"); } } }); The $("#UserApprove").submit(); does not seem to be doing an ajax post. It comes back with just the text from the partial view returned in a new page. I dont want to use the jquery form plugin which has .ajaxSubmit(). Is there any other way to force an ajax post from the jquery dialog "approve" button?

    Read the article

< Previous Page | 36 37 38 39 40 41 42 43 44 45 46 47  | Next Page >