Search Results

Search found 17845 results on 714 pages for 'python social auth'.

Page 401/714 | < Previous Page | 397 398 399 400 401 402 403 404 405 406 407 408  | Next Page >

  • twisted reactor stops too early

    - by pygabriel
    I'm doing a batch script to connect to a tcp server and then exiting. My problem is that I can't stop the reactor, for example: cmd = raw_input("Command: ") # custom factory, the protocol just send a line reactor.connectTCP(HOST,PORT, CommandClientFactory(cmd) d = defer.Deferred() d.addCallback(lambda x: reactor.stop()) reactor.callWhenRunning(d.callback,None) reactor.run() In this code the reactor stops before that the tcp connection is done and the cmd is passed. How can I stop the reactor after that all the operation are finished?

    Read the article

  • How to replace empty string with zero in comma-separated string?

    - by dsaccount1
    "8,5,,1,4,7,,,,7,,1,9,3,6,,,8,6,3,9,,2,5,4,,,,,3,2,,,7,4,1,1,,4,,6,9,,5,,,,5,,,1,,6,3,,,6,5,,,,7,4,,1,7,6,,,,8,,5,,,7,1,,3,9," I'm doing a programming challenge where i need to parse this sequence into my sudoku script. Need to get the above sequence into 8,5,0,1,4,7,0,0,0,7,0,1,9,3,6,0,0,8......... I tried re but without success, help is appreciated, thanks.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Django says the "id may not be NULL" but why is it?

    - by Oli
    I'm going crazy today. I just tried to insert a new record and it threw back a "post_blogpost.id may not be NULL" error. Here's my model: class BlogPost(models.Model): title = models.CharField(max_length=100) slug = models.SlugField(max_length=100) who = models.ForeignKey(User, default=1) when = models.DateTimeField() intro = models.TextField(blank=True, null=True) content = models.TextField(blank=True, null=True) counter = models.PositiveIntegerField(default=0) published = models.BooleanField(default=False) css = models.TextField(blank=True, null=True) class Meta: ordering = ('-when', 'id') There are a number of functions beneath the model too but I won't include them in full here. Their names are: content_cache_key, clear_cache, __unicode__, reads, read, processed_content. I'm adding through the admin... And I'm running out of hair.

    Read the article

  • Filter zipcodes by proximity in Django with the Spherical Law of Cosines

    - by spiffytech
    I'm trying to handle proximity search for a basic store locater in Django. Rather than haul PostGIS around with my app just so I can use GeoDjango's distance filter, I'd like to use the Spherical Law of Cosines distance formula in a model query. I'd like all of the calculations to be done in the database in one query, for efficiency. An example MySQL query from The Internet implementing the Spherical Law of Cosines like this: SELECT id, ( 3959 * acos( cos( radians(37) ) * cos( radians( lat ) ) * cos( radians( lng ) - radians(-122) ) + sin( radians(37) ) * sin( radians( lat ) ) ) ) AS distance FROM stores HAVING distance < 25 ORDER BY distance LIMIT 0 , 20; The query needs to reference the Zipcode ForeignKey for each store's lat/lng values. How can I make all of this work in a Django model query?

    Read the article

  • I am currently serving my static files in Django. How do I use Apache2 to do this?

    - by alex
    (r'^media/(?P<path>.*)$', 'django.views.static.serve',{'document_root': settings.MEDIA_ROOT}), As you can see, I have a directory called "media" under my Django project. I would like to delete this line in my urls.py and instead us Apache to serve my static files. What do I do to my Apache configs (which files do I change) in order to do this? By the way, I installed Apache2 like normal: sudo aptitude install apache2

    Read the article

  • Not able to pass multiple override parameters using nose-testconfig 0.6 plugin in nosetests

    - by Jaikit
    Hi, I am able to override multiple config parameters using nose-testconfig plugin only if i pass the overriding parameters on commandline. e.g. nosetests -c nose.cfg -s --tc=jack.env1:asl --tc=server2.env2:abc But when I define the same thing inside nose.cfg, than only the value for last parameter is modified. e.g. tc = server2.env2:abc tc = jack.env1:asl I checked the plugin code. It looks fine to me. I am pasting the part of plugin code below: parser.add_option( "--tc", action="append", dest="overrides", default = [], help="Option:Value specific overrides.") configure: if options.overrides: self.overrides = [] overrides = tolist(options.overrides) for override in overrides: keys, val = override.split(":") if options.exact: config[keys] = val else: ns = ''.join(['["%s"]' % i for i in keys.split(".") ]) # BUG: Breaks if the config value you're overriding is not # defined in the configuration file already. TBD exec('config%s = "%s"' % (ns, val)) Let me know if any one has any clue.

    Read the article

  • How small is *too small* for an opensource project?

    - by Adam Lewis
    I have a fair number of smaller projects / libraries that I have been using over the past 2 years. I am thinking about moving them to Google Code to make it easier to share with co-workers and easier to import them into new projects on my own environments. The are things like a simple FSMs, CAN (Controller Area Network) drivers, and GPIB drivers. Most of them are small (less than 500 lines), so it makes me wonder are these types of things too small for a stand alone open-source project? Note that I would like to make it opensource because it does not give me, or my company, any real advantage.

    Read the article

  • Problem with anchor tags in Django after using lighttpd + fastcgi

    - by Drew A
    I just started using lighttpd and fastcgi for my django site, but I've noticed my anchor links are no longer working. I used the anchor links for sorting links on the page, for example I use an anchor to sort links by the number of points (or votes) they have received. For example: the code in the html template: ... {% load sorting_tags %} ... {% ifequal sort_order "points" %} {% trans "total points" %} {% trans "or" %} {% anchor "date" "date posted" %} {% order_by_votes links request.direction %} {% else %} {% anchor "points" "total points" %} {% trans "or" %} {% trans "date posted" %} ... The anchor link on "www.mysite.com/my_app/" for total points will be directed to "my_app/?sort=points" But the correct URL should be "www.mysite.com/my_app/?sort=points" All my other links work, the problem is specific to anchor links. The {% anchor %} tag is taken from django-sorting, the code can be found at http://github.com/directeur/django-sorting Specifically in django-sorting/templatetags/sorting_tags.py Thanks in advance.

    Read the article

  • List Directories and get the name of the Directory

    - by chrissygormley
    Hello, I am trying to get the code to list all the directories in a folder, change directory into that folder and get the name of the current folder. The code I have so far is below and isn't working at the minute. I seem to be getting the parent folder name. import os for directories in os.listdir(os.getcwd()): dir = os.path.join('/home/user/workspace', directories) os.chdir(dir) current = os.path.dirname(dir) new = str(current).split("-")[0] print new I also have other files in the folder but I do not want to list them. I have tried the below code but I haven't got it working yet either. for directories in os.path.isdir(os.listdir(os.getcwd())): Can anyone see where I am going wrong? Thanks

    Read the article

  • Winforms vs WPF

    - by m0s
    I am a student and I do freelance here and there when I have opportunity. I believe my strongest language is C#. I don't really know what is going on in real programming world, so I was wondering if WPF did take over WinForms? I know the differences between two and how two can be used simultaneously but, I just don't want to invest my time in learning dying technologies, I hope you understand. So, for windows desktop programming what would you recommend to master WinForms, WPF or maybe both? I also get a lot that desktop programming is dead already and one should only care about learning web programming.

    Read the article

  • SQLAlchemy returns tuple not dictionary

    - by Ivan
    Hi everyone, I've updated SQLAlchemy to 0.6 but it broke everything. I've noticed it returns tuple not a dictionary anymore. Here's a sample query: query = session.query(User.id, User.username, User.email).filter(and_(User.id == id, User.username == username)).limit(1) result = session.execute(query).fetchone() This piece of code used to return a dictionary in 0.5. My question is how can I return a dictionary?

    Read the article

  • How can I lookup an attribute in any scope by name?

    - by Wai Yip Tung
    How can I lookup an attribute in any scope by name? My first trial is to use globals() and locals(). e.g. >>> def foo(name): ... a=1 ... print globals().get(name), locals().get(name) ... >>> foo('a') None 1 >>> b=1 >>> foo('b') 1 None >>> foo('foo') <function foo at 0x014744B0> None So far so good. However it fails to lookup any built-in names. >>> range <built-in function range> >>> foo('range') None None >>> int <type 'int'> >>> foo('int') None None Any idea on how to lookup built-in attributes?

    Read the article

  • PyParsing: Not all tokens passed to setParseAction()

    - by Rosarch
    I'm parsing sentences like "CS 2110 or INFO 3300". I would like to output a format like: [[("CS" 2110)], [("INFO", 3300)]] To do this, I thought I could use setParseAction(). However, the print statements in statementParse() suggest that only the last tokens are actually passed: >>> statement.parseString("CS 2110 or INFO 3300") Match [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] at loc 7(1,8) string CS 2110 or INFO 3300 loc: 7 tokens: ['INFO', 3300] Matched [{Suppress:("or") Re:('[A-Z]{2,}') Re:('[0-9]{4}')}] -> ['INFO', 3300] (['CS', 2110, 'INFO', 3300], {'Course': [(2110, 1), (3300, 3)], 'DeptCode': [('CS', 0), ('INFO', 2)]}) I expected all the tokens to be passed, but it's only ['INFO', 3300]. Am I doing something wrong? Or is there another way that I can produce the desired output? Here is the pyparsing code: from pyparsing import * def statementParse(str, location, tokens): print "string %s" % str print "loc: %s " % location print "tokens: %s" % tokens DEPT_CODE = Regex(r'[A-Z]{2,}').setResultsName("DeptCode") COURSE_NUMBER = Regex(r'[0-9]{4}').setResultsName("CourseNumber") OR_CONJ = Suppress("or") COURSE_NUMBER.setParseAction(lambda s, l, toks : int(toks[0])) course = DEPT_CODE + COURSE_NUMBER.setResultsName("Course") statement = course + Optional(OR_CONJ + course).setParseAction(statementParse).setDebug()

    Read the article

  • How to make scipy.interpolate give a an extrapolated result beyond the input range?

    - by Salim Fadhley
    I'm trying to port a program which uses a hand-rolled interpolator (developed by a mathematitian colleage) over to use the interpolators provided by scipy. I'd like to use or wrap the scipy interpolator so that it has as close as possible behavior to the old interpolator. A key difference between the two functions is that in our original interpolator - if the input value is above or below the input range, our original interpolator will extrapolate the result. If you try this with the scipy interpolator it raises a ValueError. Consider this program as an example: import numpy as np from scipy import interpolate x = np.arange(0,10) y = np.exp(-x/3.0) f = interpolate.interp1d(x, y) print f(9) print f(11) # Causes ValueError, because it's greater than max(x) Is there a sensible way to make it so that instead of crashing, the final line will simply do a linear extrapolate, continuing the gradients defined by the first and last two pouints to infinity. Note, that in the real software I'm not actually using the exp function - that's here for illustration only!

    Read the article

  • Locating file path from a <InMemoryUploadedFile> Djnago object

    - by PirosB3
    Hi all I have a Django app which, submitting a package, should return values that are inside it.. Submitted the form to a view called "insert": request.FILES['file'] returns the file objects, but it is of kind < InMemoryUploadedFile. What i need is a way to get the absolute path of the uploaded file, so that i can feed it to a method that will return the values needed Anyone know how i can accomplish this? Thanks

    Read the article

  • How to allow resizing of QMessageBox in PyQt4

    - by Simeon Fitch
    I'm using the nice feature in QMessageBox to optionally show detailed text to the user. However, the window after expansion is still fairly small, and one immediately tries to resize the window so more of the details are visible. Even after setting what I think are the proper settings it won't allow resizing. Here's the relevant snippet of PyQt4 code: mb = QMessageBox() mb.setText("Results written to '%s'" % filename) mb.setDetailedText(str(myData)) mb.setSizePolicy(QSizePolicy.Expanding, QSizePolicy.Expanding) mb.setSizeGripEnabled(True) Am I missing a step and/or is this at all possible?

    Read the article

  • CherryPy and RESTful web api

    - by hyperboreean
    What's the best approach of creating a RESTful web api in CherryPy? I've been looking around for a few days now and nothing seems great. For Django it seems that are lots of tools to do this, but not for CherryPy or I am not aware of them

    Read the article

  • Dynamically add items to Tkinter Canvas

    - by nick369
    I'm attempting to learn Tkinter with the goal of being able to create a 'real-time' scope to plot data. As a test, I'm trying to draw a polygon on the canvas every time the 'draw' button is pressed. The triangle position is randomized. I have two problems: There is a triangle on the canvas as soon as the program starts, why and how do I fix this? It doesn't draw any triangles when I press the button, at least none that I can see. CODE from Tkinter import * from random import randint class App: def __init__(self,master): #frame = Frame(master) #frame.pack(side = LEFT) self.plotspc = Canvas(master,height = 100, width = 200, bg = "white") self.plotspc.grid(row=0,column = 2, rowspan = 5) self.button = Button(master, text = "Quit", fg = "red", \ command = master.quit) self.button.grid(row=0,column=0) self.drawbutton = Button(master, text = "Draw", command = \ self.pt([50,50])) self.drawbutton.grid(row = 0, column = 1) def pt(self, coords): coords[0] = coords[0] + randint(-20,20) coords[1] = coords[1] + randint(-20,20) x = (0,5,10) y = (0,10,0) xp = [coords[0] + xv for xv in x] yp = [coords[1] + yv for yv in y] ptf = zip(xp,yp) self.plotspc.create_polygon(*ptf) if _name_ == "_main_": root = Tk() app = App(root) root.mainloop() The code is formatting strangely within the code tags, I have no idea how to fix this.

    Read the article

< Previous Page | 397 398 399 400 401 402 403 404 405 406 407 408  | Next Page >