Search Results

Search found 30457 results on 1219 pages for 'program manager'.

Page 403/1219 | < Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >

  • Count Clicks in excel

    - by rockbala
    Hi, Can some one recommend any free program which counts the number of clicks Clicked inside a cell. For Example Imagine something like Spreadsheet I click on A1 cell the value shows 1 Then I click A1 cell again the value shows 2 and so on If I click A3 cell somewhere in between the click count on Cell A3 shows 1 and so on If something like this can be achieved as a macro with in excel (2003 please) please suggest or any other free program that you might be aware about, please do let me know. I appreciate all your help and thank you in advance. rockbala

    Read the article

  • soft stoppped working

    - by Jack Morton
    this is might be really weird, but I have no idea what kinda wizardry of this. Basically, my Visual Studio stopped responding to my changes, it stopped building solution. I can comment code, which would completely ruin the logic of program, and Visual Studio will still run program that I guess it has in memory. It's really annoying, and I have no idea what it is. I keep restarting software, but it's still does the same. It's a licensed software. I was wondering If someone knew what was going on. Thanks!

    Read the article

  • Python: How to quit CLI when stuck in blocking raw_input?

    - by christianschluchter
    I have a GUI program which should also be controllable via CLI (for monitoring). The CLI is implemented in a while loop using raw_input. If I quit the program via a GUI close button, it hangs in raw_input and does not quit until it gets an input. How can I immediately abort raw_input without entering an input? I run it on WinXP but I want it to be platform independent, it should also work within Eclipse since it is a developer tool. Python version is 2.6. I searched stackoverflow for hours and I know there are many answers to that topic, but is there really no platform independent solution to have a non-blocking CLI reader? If not, what would be the best way to overcome this problem? Thanks

    Read the article

  • Execute a line in a text file

    - by apophis
    Hi I have a program that reads text files filled with code designed to be executed line by line by the program, like a script file. The problem is that I don't no how to do the line executing part. Here is my code, I thought using the \r would fool the console. But it just shows me a list of lines in the file. if (tok[0] == "read" && length == 2) { try { StreamReader tr = new StreamReader(@"C:\Users\Public\"+tok[1]+".txt"); while (!tr.EndOfStream) { Console.WriteLine(tr.ReadLine()); } } catch { Console.WriteLine("No such text file.\n"); } Prompt(); If I knew what to search for to fix my problem in Google, I would have. But I've got no idea. Thanks

    Read the article

  • In .NET Xml Serialization, is it possible to serialize a class with an enum property with different

    - by Lasse V. Karlsen
    I have a class, containing a list property, where the list contains objects that has an enum property. When I serialize this, it looks like this: <?xml version="1.0" encoding="ibm850"?> <test> <events> <test-event type="changing" /> <test-event type="changed" /> </events> </test> Is it possible, through attributes, or similar, to get the Xml to look like this? <?xml version="1.0" encoding="ibm850"?> <test> <events> <changing /> <changed /> </events> </test> Basically, use the property value of the enum as a way to determine the tag-name? Is using a class hierarchy (ie. creating subclasses instead of using the property value) the only way? Edit: After testing, it seems even a class-hierarchy won't actually work. If there is a way to structure the classes to get the output I want, even with sub-classes, that is also an acceptable answer. Here's a sample program that will output the above Xml (remember to hit Ctrl+F5 to run in Visual Studio, otherwise the program window will close immediately): using System; using System.Collections.Generic; using System.Xml.Serialization; namespace ConsoleApplication18 { public enum TestEventTypes { [XmlEnum("changing")] Changing, [XmlEnum("changed")] Changed } [XmlType("test-event")] public class TestEvent { [XmlAttribute("type")] public TestEventTypes Type { get; set; } } [XmlType("test")] public class Test { private List<TestEvent> _Events = new List<TestEvent>(); [XmlArray("events")] public List<TestEvent> Events { get { return _Events; } } } class Program { static void Main(string[] args) { Test test = new Test(); test.Events.Add(new TestEvent { Type = TestEventTypes.Changing }); test.Events.Add(new TestEvent { Type = TestEventTypes.Changed }); XmlSerializer serializer = new XmlSerializer(typeof(Test)); XmlSerializerNamespaces ns = new XmlSerializerNamespaces(); ns.Add("", ""); serializer.Serialize(Console.Out, test, ns); } } }

    Read the article

  • Highest value datatype can store in c#

    - by user472832
    I am writing a small program for my assignment to find the primitive roots of a prime number. So far, the program works for smaller prime numbers till 13 and gives correct number of roots. But for higher primes numbers, it is showing only fewer primitive roots. And now i got stuck for the prime number 41, shows no primitive roots for it. I used DOUBLE datatype for the calculation, and again tried with the datatype DECIMAL, but no luck. Does anyone know about this kind of problem??? Thank you.

    Read the article

  • Python structure mistake

    - by jaddy123
    I'm writing a program in which I can Reverse the sequence and Replace all As with Ts, all Cs with Gs, all Gs with Cs, and all Ts with As. the program is to read a sequence of bases and output the reverse complement sequence. I am having trouble to do it so can anyone please help me with this by having a look on my code: word = raw_input("Enter sequence: ") a = word.replace('A', 'T') b = word.replace('C', 'G') c = word.replace('G', 'C') d = word.replace('T', 'A') if a == word and b == word and c == word and d == word: print "Reverse complement sequence: ", word And I want this sort of output: Enter sequence: CGGTGATGCAAGG Reverse complement sequence: CCTTGCATCACCG Regards

    Read the article

  • input tags with array

    - by Dumbledore of flash
    Hi , Recently i am doing a project in which i encountered a strange problem this is the program which previous programmer did MPAN <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2" > ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="3" size="3"> <input name="mpan[]" id="mpan[]" value="" maxlength="2" size="2"> ///this one to read <input name="mpan[]" id="mpan[]" value="" maxlength="11" size="12"> i have to read it from a javascript what i did 1) document.getElementById("mpan").value == not reading script does not work 2) document.getElementById("mpan[]").value == reading first one 3) document.getElementById("mpan[0]").value == script does not work 4) document.getElementById("mpan[3]").value == script does not work can any body tell me how to read this from a javascript program

    Read the article

  • What's this UI pattern called?

    - by Bears will eat you
    I'm trying to figure out what this sort of thing is called, and eventually how I can create one in a web browser. It looks like this (screenshot of the first app that came to mind): The specific component/pattern I'm looking for is the two list boxes ("Included Gear" and "Excluded Gear") that represent inclusion/exclusion of items from a set. I'm not really looking for the WPF name (if there is one) but it might be helpful. I am looking for the name of this thingy, if there is one, and if you really want to make my day, you can point me toward a jQuery or YUI way of making one of these dealies in a browser. In case you were wondering, the screenshot is a World of Warcraft gear optimization program. Go figure why it was the first program that came to mind when I was trying to think of an example.

    Read the article

  • Ruby on Rails: Modules vs. Classes

    - by Jack
    I'm trying to add a function that will be accessible throughout all parts of my program. I want something like: def GlobalFunctions.my_function(x,y) puts x + y end to be accessible for all models. Specifically I am trying to use a function like this in my seeds.rb file but I am most likely going to be reusing the code and don't want any redundancy. Now I know I can make a simple class, but I could also make a module. What are some reasons to go in either direction? And once I've decided on which type to use, how do I make it accessible throughout the whole program? I have tried a module, but I keep getting " Expected app/[module file] to define [ModuleName]"

    Read the article

  • Boost Shared Pointers and Memory Management

    - by Izza
    I began using boost rather recently and am impressed by the functionality and APIs provided. In using boost::shared_ptr, when I check the program with Valgrind, I found a considerable number of "Still reachable" memory leaks. As per the documentation of Valgrind, these are not a problem. However, since I used to use the standard C++ library only, I always made sure that any program written is completely free from memory leaks. My question is, are these memory leaks something to worry about? I tried using reset(), however it only decrements the reference count, doesn't deallocate memory. Can I safely ignore these, or any way to forcibly deallocate the memory allocated by boost::shared_ptr? Thank you.

    Read the article

  • unittest in python: ignore an import from the code I want to test

    - by vaidab
    I have a python program that imports pythoncom (and uses pythoncom.CoCreateInstance from it). I want to create a unittest for the program logic without it importing pythoncom (so I can run the test on Linux as well). What options are there? Can I do it without modifying the system under test? What I found so far: sys.modules["pythoncom"] = "test" import module_that_imports_pythoncom My problem with it is if I have: from pythoncom.something import something I'll get: ImportError: No module named something.something And sys.modules["something.something"] or sys.modules["pythoncom.something.something"] doesn't work. Any ideas?

    Read the article

  • finding the numbers in a given range?

    - by Jamis
    Hi Friends, kindly tel me the concept to write a perl program behind this ? 167 GATCAAAATACTTGCTGGA 185 192 TAGTAGATAGATAGATAGTAGTAG 228 in a fileA i ve a range from 167 to 185 as given as above and also 192 to 228 in another fileB i ve set of numbers 2 3 4 5 6 7 8 168 169 179 185 193 1000 now from the above set of numbers in file B, i need to find out which are the numbers present between the range of 167 to 185 and print those numbers in the output. so, output will be 168,169,179,185, 193 what will be the concept behind writing this program?

    Read the article

  • Change Dll loaded with MEF

    - by Tim
    Hi all, I'm using MEF and the System.ComponentModel.Composition.dll to load some dll. I'm doing something like : AggregateCatalog catalog = new AggregateCatalog(new AssemblyCatalog(Assembly.GetExecutingAssembly()), new DirectoryCatalog(directory)); _container = new CompositionContainer(catalog); _container.ComposeParts(this); to import my dll. After some times, I would like to update my dll but if I try to delete it, I have an access denied, because it's alrealdy used by the program. How can I release the dll, replace with a new dll and load the dll again ? (without closing the program) Thanks in advance for your help

    Read the article

  • Make a USB Device, Control It In Java

    - by yar
    I'm thinking about making a physical controller (device?) with knobs, buttons, and LEDs. I'd like to interact with it using Java (respond to the knobs, light up LEDs, etc). The reason I mention Java is two-fold: first, I know Java well1. Second, I've written the rest of the program I need to interface with in Java (though there are ways to talk to the Java program from another language). I would like the device to connect via USB and be (computer-)platform independent. I haven't the slightest idea of where to start, except to start reading the Arduino website. Is this my best/only option? Is there something better suited for communicating with Java? Note: I know that Arduino has something to do with Java (not sure what), but it seems like code must be written in a subset of C. How would I get moving on this topic? 1 - No laughter, please.

    Read the article

  • Making commercial Java software

    - by roddik
    Hi. I intend to make some software to be sold over internet. I've only created open-source before, so I have really no idea of how to protect it from being cracked and distributed as warez. Bearing in mind that I know like two programms that aren't either cracked or not really useful I decided that the only more or less reliable way may look like this: Connect to a server and provide licensing info and some sort of hardware summary info If everything is fine, the server returns some crucial missing parts of the program bound to that certain pc along with the usage limit of say 2 days That crucial stuff is not saved to hard drive, so it is downloaded every time the program starts, if the programm runs more than 2 days, data is downloaded again If the same info is used from different computers, suspend the customer account What do you think about this? It may seem a bit to restrictive, but I'd better make less sales at first then eventually see my precious killer app downloaded for free. Anyways, first I need some basic theory/tutorials/guides about how to ensure that user only uses a certain Java app if he has paid for it, so please suggest some. Thanks

    Read the article

  • Multithreaded SDL error in C++

    - by wyatt
    I'm building a program in C++, using SDL, and am occasionally receiving this error: * glibc detected * ./assistant: double free or corruption (!prev) It's difficult to replicate, so I can't find exactly what's causing it, but I just added a second thread to the program, and neither thread run on its own seems to cause the error. The threads don't share any variables, though they both run the functions SDL_BlitSurface and SDL_Flip. Could running these concurrently throw up such an error, or am I barking up the wrong tree? If this is the cause, should I simply throw a mutex around all SDL calls? Thanks

    Read the article

  • explain this macro

    - by deostroll
    #define __T(x) L ## x Found in code from one of the MFC source header file. It is mostly used for converting strings to ........ (I don't know what). If I am correct it converts strings to LPCTSTR...don't know what that type is either... I can't seem to convert char* into LPCTSTR. While MFC file handling, the following code will always return error while trying to open the file... char* filepath = "C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF"; if( !file.Open((LPCTSTR)filepath , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } But instead if I wrote it this way, it doesn't give error: if( !file.Open( _T("C:\\Program Files\\Microsoft Office\\Office12\\BITMAPS\\STYLES\\GLOBE.WMF") , CFile::modeRead, &fexp) ) { fexp.ReportError(); return 1; } I am looking at passing a variable as the first argument to the CFile::Open() method.

    Read the article

  • Using a database/index sequential file independently of the Unix distribution

    - by Helper Method
    What I'm planning to do is a) parse a file for some lines matching a regular expression b) store the match in some sort of database / file so I don't have to do the parsing again and again c) call another program passing the matches as arguments While I can imagine how to do a) and c), I'm a little bit unsure about b). The matches are of the form key:attribute1:attribute2:attribute3 where attribute 2 may be optional. I'm thinking of storing the results in a simple database but the problem is the database needs to available on a number of Unix platform for the program to work. Are there any (simple) databases which can be found on any Unix platforms? Or should I use some sort of index-sequential file?

    Read the article

  • [C++] Needed: A simple C++ container (stack, linked list) that is thread-safe for writing

    - by conradlee
    I am writing a multi-threaded program using OpenMP in C++. At one point my program forks into many threads, each of which need to add "jobs" to some container that keeps track of all added jobs. Each job can just be a pointer to some object. Basically, I just need the add pointers to some container from several threads at the same time. Is there a simple solution that performs well? After some googling, I found that STL containers are not thread-safe. Some stackoverflow threads address this question, but none form a consensus on a simple solution.

    Read the article

< Previous Page | 399 400 401 402 403 404 405 406 407 408 409 410  | Next Page >