Search Results

Search found 1636 results on 66 pages for 'wildcard subdomain'.

Page 41/66 | < Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >

  • Linux Port 80 to redirect to a Windows box

    - by Richard Staehler
    I have 2 servers here at work. One is a Windows 2008 Server R2 (for safety's sake, lets use 192.168.1.100) and the other is a Fedora 14 (192.168.1.101). Currently when you hit our subdomain, x.test.com, our routers tell it to go to our Fedora box, and since Apache is installed and listening to port 80, it displays the Fedora Apache Test Page. It's obvious that I don't use port 80 for this machine, however I do use NAGIOS on it and its always nice to be able to access that from anywhere in the world. So when I want to access it, I just type x.test.com/nagios. Now here comes the dilemma.... On the Windows R2 box, we recently have installed a program that requires us to setup a web server using IIS7. Because of this application, I'm going to be creating a new subdomain called y.test.com, but since we only have 1 WAN/router, it will still get pointed to our Fedora box. That being said, it wants to use port 80 as well (or whatever port I damn well wish to assign it). So my question is: since our router is pointing to the Fedora 14 box (.101), and I want to make sure I can access NAGIOS from anywhere in the world, how do I tell Apache (httpd) to redirect port 80 to the other server (.100)? If not possible, what are my other options? I have rinetd installed on Fedora and have even tried the option 192.168.1.101 80 192.168.1.100 80 and it didn't seem to work "because port 80 was already bound" Thoughts? and Thanks!

    Read the article

  • Intermittent CNAME forwarding

    - by Godric Seer
    I host a personal website on an old desktop that is LAMP based. Since I have a dynamic IP, I use no-ip to make sure I have a working domain name at all times. I also have a domain I have bought on GoDaddy where I have a CNAME record forwarding the www subdomain to my no-ip domain. At all times, I can connect to my website through the no-ip domain without issue. For the past several weeks, I never had an issue using the GoDaddy domain to connect (ssh or https). As of today, however, the GoDaddy domain only works for about 10 minutes at a time. I get server not found errors most of the time. Also, if I happen to be using the GoDaddy domain for an ssh connection, the connection will freeze. I have attempted to run tests using a couple of online DNS check websites, but have not gotten any errors at any time. I also contacted GoDaddy support but they had no issues connecting to the website, and therefore did not see any issues. I would like advice on how I could debug/resolve this issue. Since the problem appeared without me changing anything on my end, I hope it will resolve itself, but knowing the cause in case it happens again would be preferable. EDIT: I changed the configuration in GoDaddy to create an A (Host) that points at my current IP. This works fine, so I can access the site through the GoDaddy domain without the preceding www. I am currently waiting for a new CNAME record to propagate that points the www subdomain at the main host, rather than my no-ip domain.

    Read the article

  • Concerns about Apache per-Vhost logging setup

    - by etienne
    I'm both senior developer and sysadmin in my company, so i'm trying to deal with the needs of both activities. I've set up our apache box, wich deals with 30-50 domains atm (and hopefully will grow larger) and hosts both production and development sites, with this directory structure: domains/ domains/domain.ext/ #FTPS chroot for user domain.ext domains/domain.ext/public #the DocumentRoot of http://domain.ext domains/domain.ext/logs domains/domain.ext/subdomains/sub.domain.ext domains/domain.ext/subdomains/sub.domain.ext/public #DocumentRoot of http://sub.domain.ext Each domain.ext Vhost runs with his dedicated user and group via mpm-itk, umask being 027, and the logs are stored via a piped sudo command, like this: ErrorLog "| /usr/bin/sudo -u nobody -g domain.ext tee -a domains/domain.ext/logs/sub.domain.ext_error.log" CustomLog "| /usr/bin/sudo -u nobody -g domain.ext tee -a domains/domain.ext/logs/sub.domain.ext_access.log" combined Now, i've read a lot about not letting the logs out of a very restricted directory, but the developers often need to give a quick look to a particular subdomain error log, and i don't really want to give them admin rights to look into /var/logs. Having them available into the ftp account is REALLY handy during development stages. Do you think this setup is viable and safe enough? To me it is apparently looking good, but i'm concerned about 3 security issues: -is the sudo pipe enough to deal with symlink exploits? Any catches i'm missing? -log dos: logs are in the same partition of all domains. got hundreds of gigs, but still, if one get disk-space dos'd, everything will break. Any workaround? Will a short timed logrotate suffice? -file descriptors limits: AFAIK the default limit for Apache on Ubuntu Server is currently 8192, which should be plenty enough to handle 2 log files per subdomain. Is it? Am i missing something? I hope to read some thoughts on the matter!

    Read the article

  • Walkthrough/guide building aplication server for multi tenant web app [on hold]

    - by Khalid Adisendjaja
    The web app will detect a subdomain such as tenant1.app.com, tenant2.app.com, etc to identify tenant environment, each tenant environment will have a different database credential (port,db name,etc) but still connecting to the same database server. Each tenant should use app.com for their main domain, using their own domain is prohibitted. Each tenant will have their own rest api endpoint such as tenant1.app.com/api/v1/xxxx, tenant2.app.com/api/v1/xxxx, tenant3.app.com/api/v1/xxxx I've come to a simple solution by setting a wildcard subdomain (*.app.com) on webserver Apache/Nginx vhost configuration file. I have googled so many concept for building a multi-tenant app server but still don't understand how to really done it, what is the right way to do it and what is actually required to do this task. So I've come to this questions, Do I need a proxy server, dns masking, etc.. How to monitor each tenants activity What about server performance, load balancing, and scalability How to setup ssl certificate for each tenant what about application cache for each tenant Is it reliable to use the setup for production etc ... I have a very litte experience on server infrastructure, so I'm looking for a DIY walkthrough, step by step guide, or sophisticate solution ready to implemented for production

    Read the article

  • Conditionally set an Apache environment variable

    - by Tom McCarthy
    I would like to conditionally set the value of an Apache2 environment variable and assign a default value if one of the conditions is not met. This example if a simplification of what I'm trying to do but, in effect, if the subdomain portion of the host name is hr, finance or marketing I want to set an environment var named REQUEST_TYPE to 2, 3 or 4 respectively. Otherwise it should be 1. I tried the following configuration in httpd.conf: <VirtualHost *:80> ServerName foo.com ServerAlias *.foo.com DocumentRoot /var/www/html SetEnv REQUEST_TYPE 1 SetEnvIfNoCase Host ^hr\. REQUEST_TYPE=2 SetEnvIfNoCase Host ^finance\. REQUEST_TYPE=3 SetEnvIfNoCase Host ^marketing\. REQUEST_TYPE=4 </VirtualHost> However, the variable is always assigned a value of 1. The only way I have so far been able get it to work is to replace: SetEnv REQUEST_TYPE 1 with a regular expression containing a negative lookahead: SetEnvIfNoCase Host ^(?!hr.|finance.|marketing.) REQUEST_TYPE=1 Is there a better way to assign the default value of 1? As I add more subdomain conditions the regular expression could get ugly. Also, if I want to allow another request attribute to affect the REQUEST_TYPE (e.g. if Remote_Addr = 192.168.1.[100-150] then REQUEST_TYPE = 5) then my current method of assigning a default value (i.e. using the regular expression with a negative lookahead) probaby won't work.

    Read the article

  • make file readable by other users

    - by Alaa Gamal
    i was trying to make one sessions for my all subdomains (one session across subdomains) subdomain number one auth.site.com/session_test.php session_set_cookie_params(0, '/', '.site.com'); session_start(); echo session_id().'<br />'; $_SESSION['stop']='stopsss this'; print_r($_SESSION); subdomain number two anscript.site.com/session_test.php session_set_cookie_params(0, '/', '.site.com'); session_start(); echo session_id().'<br />'; print_r($_SESSION); Now when i visit auth.site.com/session_test.php i get this result 06pqdthgi49oq7jnlvuvsr95q1 Array ( [stop] => stopsss this ) And when i visit anscript.site.com/session_test.php i get this result 06pqdthgi49oq7jnlvuvsr95q1 Array () session id is same! but session is empty after two days of failed trys, finally i detected the problem the problem is in file promissions the file is not readable by the another user session file on my server -rw------- 1 auth auth 25 Jul 11 11:07 sess_06pqdthgi49oq7jnlvuvsr95q1 when i make this command on the server chmod 777 sess_06pqdthgi49oq7jnlvuvsr95q1 i get the problem fixed!! the file is became readable by (anscript.site.com) So, how to fix this problem? How to set the default promissions on session files? this is the promissions of the sessions directory Access: (0777/drwxrwxrwx) Uid: ( 0/ root) Gid: ( 0/ root)

    Read the article

  • nginx: Rewrite PHP does not work

    - by Ton Hoekstra
    I've a Suffix Proxy installed and I'm using the following rewrite with wildcard subdomain DNS on: location / { if (!-e $request_filename) { rewrite ^(.*)$ /index.php last; break; } } My suffix proxy has the following URL format: (subdomain and/or domain + domain extension to proxy).proxy.org/(request-uri to proxy) I've this php code in my index.php: if(preg_match('#([\w\.-]+)\.example\.com(.+)#', $_SERVER['SERVER_NAME'].$_SERVER['REQUEST_URI'], $match)) { header('Location: http://example.com/browse.php?u=http://'.$match[1].$match[2]); die; } But when requested a page with a .php extension I'll get a 404 not found error: http://www.php.net.proxy.org/docs.php - HTTP/1.1 404 Not Found http://www.utexas.edu.proxy.org/learn/php/ex3.php - HTTP/1.1 404 Not Found But everything else is working (also index.php is working): http://php.net.proxy.org/index.php - HTTP/1.1 200 OK http://www.php-scripts.com.proxy.org/php_diary/example2.php3 - HTTP/1.1 200 OK http://www.utexas.edu.proxy.org/learn/php/ex3.phps - HTTP/1.1 200 OK http://www.w3schools.com.proxy.org/html/default.asp - HTTP/1.1 200 OK Somebody has an answer? I don't know why it's not working, on apache it's working fine. Thanks in advance. I've removed the location and now it's working perfectly: if (!-e $request_filename) { rewrite ^(.*)$ /index.php last; break; }

    Read the article

  • Allow connections to only a specific URL via HTTPS with iptables, -m recent (potentially) and -m string (definitely)

    - by The Consumer
    Hello, Let's say that, for example, I want to allow connections only to subdomain.mydomain.com; I have it partially working, but it sometimes gets in a freaky loop with the client key exchange once the Client Hello is allowed. Ah, to make it even more annoying, it's a self-signed certificate, and the page requires authentication, and HTTPS is listening on a non-standard port... So the TCP/SSL Handshake experience will differ greatly for many users. Is -m recent the right route? Is there a more graceful method to allow the complete TCP stream once the string is seen? Here's what I have so far: #iptables -N SSL #iptables -A INPUT -i eth0 -p tcp -j SSL #iptables -A SSL -m recent --set -p tcp --syn --dport 400 #iptables -A SSL -m recent --update -p tcp --tcp-flags PSH,SYN,ACK SYN,ACK --sport 400 #iptables -A SSL -m recent --update -p tcp --tcp-flags PSH,SYN,ACK ACK --dport 400 #iptables -A SSL -m recent --remove -p tcp --tcp-flags PSH,ACK PSH,ACK --dport 400 -m string --algo kmp --string "subdomain.mydomain.com" -j ACCEPT Yes, I have tried to get around this with nginx tweaks, but I can't get nginx to return a 444 or abrupt disconnect before the client hello, if you can think of a way to achieve this instead, I'm all ears, err, eyes. (As suggested by a user, bringing this inquiry over from http://stackoverflow.com/questions/4628157/allow-connections-to-only-a-specific-url-via-https-with-iptables-m-recent-pote)

    Read the article

  • Choosing local versus public domain name for Active Directory

    - by DSO
    What are the pros and cons of choosing a local domain name such as mycompany.local versus a publicly registered domain name such as mycompany.com (assuming that your org has registered the public name)? When would you choose one over the other? UPDATE Thanks to Zoredache and Jay for pointing me to this question, which had the most useful responses. That also led me to find this Microsoft Technet article, which states: It is best to use DNS names that are registered with an Internet authority in the Active Directory namespace. Only registered names are guaranteed to be globally unique. If another organization later registers the same DNS domain name, or if your organization merges with, acquires, or is acquired by other company that uses the same DNS names, then the two infrastructures cannot interact with one another. Note Using single label names or unregistered suffixes, such as .local, is not recommended. Combining this with mrdenny's advice, I think the right approach is to use either: Registered domain name that will never be used publicly (e.g. mycompany.org, mycompany.info, etc). Subdomain of an existing public domain name which will never be used publicly (e.g. corp.mycompany.com). The "never used publicly" part is a business decision so its probably best to get sign off from those in the company authorized to reserve domain names and subdomains. E.g. you don't want to use a registered name or subdomain that the marketing dept later wants to use for some public marketing campaign.

    Read the article

  • Proper Rules For SSL Redirect For Subdomains

    - by Zac Cleaves
    RewriteCond %{HTTP_HOST} ^(.*\.)*subexample.example.com$ [NC] RewriteCond %{SERVER_PORT} !^443$ RewriteRule ^(.*)$ https://subexample.example.com/$1 [R] Is what I have been using. It works as long as I go to a specific page, like subexample.example.com/orders.php. But if you try to go to the root of the subdomain, it adds the extra "/example" at the end. Any suggestion on a set of rules that will work? Thank you so much for your responces! Actually, this is what I am trying to do: http://support.mydomain.net >> https://support.mydomain.net AND(!) http://support.mydomain.net/anypage* >> https://support.mydomain.net/anypage* > RewriteCond %{HTTPS} off RewriteRule (.*) > https://%{HTTP_HOST}%{REQUEST_URI} Works, except I need it to only do it for the support.mydomain.net With the above set up, you get a certificate warning if you try to go just mydomain.net, which I do not have or need an SSL certificate installed on. UPDATE! The other issue with the rule I have written above, is that if you try to go to the root of the subdomain (i.e. support.mydomain.net) it goes to https://support.mydomain.net/support This is driving me crazy, help! =) Any help would be greatly appreciated!

    Read the article

  • Routes for IIS Classic and Integrated Mode

    - by imran_ku07
         Introduction:             ASP.NET MVC Routing feature makes it very easy to provide clean URLs. You just need to configure routes in global.asax file to create an application with clean URLs. In most cases you define routes works in IIS 6, IIS 7 (or IIS 7.5) Classic and Integrated mode. But in some cases your routes may only works in IIS 7 Integrated mode, like in the case of using extension less URLs in IIS 6 without a wildcard extension map. So in this article I will show you how to create different routes which works in IIS 6 and IIS 7 Classic and Integrated mode.       Description:             Let's say that you need to create an application which must work both in Classic and Integrated mode. Also you have no control to setup a wildcard extension map in IIS. So you need to create two routes. One with extension less URL for Integrated mode and one with a URL with an extension for Classic Mode.   routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional } // Parameter defaults );               Now you have set up two routes, one for Integrated mode and one for Classic mode. Now you only need to ensure that Integrated mode route should only match if the application is running in Integrated mode and Classic mode route should only match if the application is running in Classic mode. For making this work you need to create two custom constraint for Integrated and Classic mode. So replace the above routes with these routes,     routes.MapRoute( "DefaultClassic", // Route name "{controller}.aspx/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new ClassicModeConstraint() }// Constraints ); routes.MapRoute( "DefaultIntegrated", // Route name "{controller}/{action}/{id}", // URL with parameters new { controller = "Home", action = "Index", id = UrlParameter.Optional }, // Parameter defaults new { mode = new IntegratedModeConstraint() }// Constraints );            The first route which is for Classic mode adds a ClassicModeConstraint and second route which is for Integrated mode adds a IntegratedModeConstraint. Next you need to add the implementation of these constraint classes.     public class ClassicModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return !HttpRuntime.UsingIntegratedPipeline; } } public class IntegratedModeConstraint : IRouteConstraint { public bool Match(HttpContextBase httpContext, Route route, string parameterName, RouteValueDictionary values, RouteDirection routeDirection) { return HttpRuntime.UsingIntegratedPipeline; } }             HttpRuntime.UsingIntegratedPipeline returns true if the application is running on Integrated mode; otherwise, it returns false. So routes for Integrated mode only matched when the application is running on Integrated mode and routes for Classic mode only matched when the application is not running on Integrated mode.       Summary:             During developing applications, sometimes developers are not sure that whether this application will be host on IIS 6 or IIS 7 (or IIS 7.5) Integrated mode or Classic mode. So it's a good idea to create separate routes for both Classic and Integrated mode so that your application will use extension less URLs where possible and use URLs with an extension where it is not possible to use extension less URLs. In this article I showed you how to create separate routes for IIS Integrated and Classic mode. Hope you will enjoy this article too.   SyntaxHighlighter.all()

    Read the article

  • SQL SERVER – Query Hint – Contest Win Joes 2 Pros Combo (USD 198) – Day 1 of 5

    - by pinaldave
    August 2011 we ran a contest where every day we give away one book for an entire month. The contest had extreme success. Lots of people participated and lots of give away. I have received lots of questions if we are doing something similar this month. Absolutely, instead of running a contest a month long we are doing something more interesting. We are giving away USD 198 worth gift every day for this week. We are giving away Joes 2 Pros 5 Volumes (BOOK) SQL 2008 Development Certification Training Kit every day. One copy in India and One in USA. Total 2 of the giveaway (worth USD 198). All the gifts are sponsored from the Koenig Training Solution and Joes 2 Pros. The books are available here Amazon | Flipkart | Indiaplaza How to Win: Read the Question Read the Hints Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India residents only) 2 Winners will be randomly selected announced on August 20th. Question of the Day: Which of the following queries will return dirty data? a) SELECT * FROM Table1 (READUNCOMMITED) b) SELECT * FROM Table1 (NOLOCK) c) SELECT * FROM Table1 (DIRTYREAD) d) SELECT * FROM Table1 (MYLOCK) Query Hints: BIG HINT POST Most SQL people know what a “Dirty Record” is. You might also call that an “Intermediate record”. In case this is new to you here is a very quick explanation. The simplest way to describe the steps of a transaction is to use an example of updating an existing record into a table. When the insert runs, SQL Server gets the data from storage, such as a hard drive, and loads it into memory and your CPU. The data in memory is changed and then saved to the storage device. Finally, a message is sent confirming the rows that were affected. For a very short period of time the update takes the data and puts it into memory (an intermediate state), not a permanent state. For every data change to a table there is a brief moment where the change is made in the intermediate state, but is not committed. During this time, any other DML statement needing that data waits until the lock is released. This is a safety feature so that SQL Server evaluates only official data. For every data change to a table there is a brief moment where the change is made in this intermediate state, but is not committed. During this time, any other DML statement (SELECT, INSERT, DELETE, UPDATE) needing that data must wait until the lock is released. This is a safety feature put in place so that SQL Server evaluates only official data. Additional Hints: I have previously discussed various concepts from SQL Server Joes 2 Pros Volume 1. SQL Joes 2 Pros Development Series – Dirty Records and Table Hints SQL Joes 2 Pros Development Series – Row Constructors SQL Joes 2 Pros Development Series – Finding un-matching Records SQL Joes 2 Pros Development Series – Efficient Query Writing Strategy SQL Joes 2 Pros Development Series – Finding Apostrophes in String and Text SQL Joes 2 Pros Development Series – Wildcard – Querying Special Characters SQL Joes 2 Pros Development Series – Wildcard Basics Recap Next Step: Answer the Quiz in Contact Form in following format Question Answer Name of the country (The contest is open for USA and India) Bonus Winner Leave a comment with your favorite article from the “additional hints” section and you may be eligible for surprise gift. There is no country restriction for this Bonus Contest. Do mention why you liked it any particular blog post and I will announce the winner of the same along with the main contest. Reference: Pinal Dave (http://blog.sqlauthority.com) Filed under: Joes 2 Pros, PostADay, SQL, SQL Authority, SQL Puzzle, SQL Query, SQL Server, SQL Tips and Tricks, T SQL, Technology

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • html5 cache -> "network: *" doesn't work

    - by Greg
    Hello all, I am trying a simple test with the html 5 cache. Here is a simple web page : <!DOCTYPE html> <html manifest="test.manifest"> <head> </head> <body> <img src="http://www.somewebsite.com/picture.jpg"/> </body> </html> With the following manifest : CACHE MANIFEST #v0.1 NETWORK: http://www.somewebsite.com/ This work fine, the picture is displayed. My problem is that I won't be able to know from where the picture will come. Here comes the online whitelist wildcard flag, that is supposed to solve my problem. But with the manifest : CACHE MANIFEST #v0.1 NETWORK: * The image is not displayed (tested on safari / safari mobile / firefox). What is not working ? Is there another way to turn the online whitelist wildcard flag on ?

    Read the article

  • Can't deploy rails 4 app on Bluehost with Passenger 4 and nginx

    - by user2205763
    I am at Bluehost (dedicated server) trying to run a rails 4 app. I asked to have my server re-imaged, specifying that I do not want rails, ruby, or passenger install automatically as I wanted to install the latest versions myself using a version manager (Bluehost by default offers rails 2.3, ruby 1.8, and passenger 3, which won't work with my app). I installed ruby 1.9.3p327, rails 4.0.0, and passenger 4.0.5. I can verify this by typing, "ruby -v", "rails -v", and "passenger -v" (also "gem -v"). I made sure to install these not as root, so that I don't get a 403 forbidden error when trying to deploy the app. I installed passenger by typing "gem install passenger", and then installed the nginx passenger module (into "/nginx") with "passenger-install-nginx-module". I am trying to run my rails app on a subdomain, http://development.thegraduate.hk (I am using the subdomain to show my client progress on the website). In bluehost I created that subdomain, and had it point to "public_html/thegraduate". I then created a symlink from "rails_apps/thegraduate/public" to "public_html/thegraduate" and verified that the symlink exists. The problem is: when I go to http://development.thegraduate.hk, I get a directory listing. There is nothing resembling a rails app. I have not added a .htaccess file to /rails_apps/thegraduate/public, as that was never specified in the installation of passenger. It was meant to be 'install and go'. When I type "passenger-memory-status", I get 3 things: - Apache processes (7) - Nginx processes (0) - Passenger processes (0) So it appears that nginx and passenger are not running, and I can't figure out how to get it to run (I'm not looking to have it run as a standalone server). Here is my nginx.conf file (/nginx/conf/nginx.conf): #user nobody; worker_processes 1; #error_log logs/error.log; #error_log logs/error.log notice; #error_log logs/error.log info; #pid logs/nginx.pid; events { worker_connections 1024; } http { passenger_root /home/thegrad4/.rbenv/versions/1.9.3-p327/lib/ruby/gems/1.9.1/gems/passenger-4.0.5; passenger_ruby /home/thegrad4/.rbenv/versions/1.9.3-p327/bin/ruby; include mime.types; default_type application/octet-stream; #log_format main '$remote_addr - $remote_user [$time_local] "$request" ' # '$status $body_bytes_sent "$http_referer" ' # '"$http_user_agent" "$http_x_forwarded_for"'; #access_log logs/access.log main; sendfile on; #tcp_nopush on; #keepalive_timeout 0; keepalive_timeout 65; #gzip on; server { listen 80; server_name development.thegraduate.hk; root ~/rails_apps/thegraduate/public; passenger_enabled on; #charset koi8-r; #access_log logs/host.access.log main; location / { root html; index index.html index.htm; } #error_page 404 /404.html; # redirect server error pages to the static page /50x.html # error_page 500 502 503 504 /50x.html; location = /50x.html { root html; } # proxy the PHP scripts to Apache listening on 127.0.0.1:80 # #location ~ \.php$ { # proxy_pass http://127.0.0.1; #} # pass the PHP scripts to FastCGI server listening on 127.0.0.1:9000 # #location ~ \.php$ { # root html; # fastcgi_pass 127.0.0.1:9000; # fastcgi_index index.php; # fastcgi_param SCRIPT_FILENAME /scripts$fastcgi_script_name; # include fastcgi_params; #} # deny access to .htaccess files, if Apache's document root # concurs with nginx's one # #location ~ /\.ht { # deny all; #} } # another virtual host using mix of IP-, name-, and port-based configuration # #server { # listen 8000; # listen somename:8080; # server_name somename alias another.alias; # location / { # root html; # index index.html index.htm; # } #} # HTTPS server # #server { # listen 443; # server_name localhost; # ssl on; # ssl_certificate cert.pem; # ssl_certificate_key cert.key; # ssl_session_timeout 5m; # ssl_protocols SSLv2 SSLv3 TLSv1; # ssl_ciphers HIGH:!aNULL:!MD5; # ssl_prefer_server_ciphers on; # location / { # root html; # index index.html index.htm; # } #} } I don't get any errors, just the directory listing. I've tried to be as detailed as possible. Any help on this issue would be greatly appreciated as I've been stumped for the past 3 days. Scouring the web has not helped as my issue seems to be specific to me. Thanks so much. If there are any potential details I forgot to specify, just ask. ** ADDITIONAL INFORMATION ** Going to development.thegraduate.hk/public/ will correctly display the index.html page in /rails_apps/thegraduate/public. However, changing root in the routes.rb file to "root = 'home#index'" does nothing.

    Read the article

  • Add Free Google Apps to Your Website or Blog

    - by Matthew Guay
    Would you like to have an email address from your own domain, but prefer Gmail’s interface and integration with Google Docs?  Here’s how you can add the free Google Apps Standard to your site and get the best of both worlds. Note: To signup for Google Apps and get it setup on your domain, you will need to be able to add info to your WordPress blog or change Domain settings manually. Getting Started Head to the Google Apps signup page (link below), and click the Get Started button on the right.  Note that we are signing up for the free Google Apps which allows a max of 50 users; if you need more than 50 email addresses for your domain, you can choose Premiere Edition instead for $50/year. Select that you are the Administrator of the domain, and enter the domain or subdomain you want to use with Google Apps.  Here we’re adding Google Apps to the techinch.com site, but we could instead add Apps to mail.techinch.com if needed…click Get Started. Enter your name, phone number, an existing email address, and other Administrator information.  The Apps signup page also includes some survey questions about your organization, but you only have to fill in the required fields. On the next page, enter a username and password for the administrator account.  Note that the user name will also be the administrative email address as [email protected]. Now you’re ready to authenticate your Google Apps account with your domain.  The steps are slightly different depending on whether your site is on WordPress.com or on your own hosting service or server, so we’ll show how to do it both ways.   Authenticate and Integrate Google Apps with WordPress.com To add Google Apps to a domain you have linked to your WordPress.com blog, select Change yourdomain.com CNAME record and click Continue. Copy the code under #2, which should be something like googleabcdefg123456.  Do not click the button at the bottom; wait until we’ve completed the next step.   Now, in a separate browser window or tab, open your WordPress Dashboard.  Click the arrow beside Upgrades, and select Domains from the menu. Click the Edit DNS link beside the domain name you’re adding to Google Apps. Scroll down to the Google Apps section, and paste your code from Google Apps into the verification code field.  Click Generate DNS records when you’re done. This will add the needed DNS settings to your records in the box above the Google Apps section.  Click Save DNS records. Now, go back to the Google Apps signup page, and click I’ve completed the steps above. Authenticate Google Apps on Your Own Server If your website is hosted on your own server or hosting account, you’ll need to take a few more steps to add Google Apps to your domain.  You can add a CNAME record to your domain host using the same information that you would use with a WordPress account, or you can upload an HTML file to your site’s main directory.  In this test we’re going to upload an HTML file to our site for verification. Copy the code under #1, which should be something like googleabcdefg123456.  Do not click the button at the bottom; wait until we’ve completed the next step first. Create a new HTML file and paste the code in it.  You can do this easily in Notepad: create a new document, paste the code, and then save as googlehostedservice.html.  Make sure to select the type as All Files or otherwise the file will have a .txt extension. Upload this file to your web server via FTP or a web dashboard for your site.  Make sure it is in the top level of your site’s directory structure, and try visiting it at yoursite.com/googlehostedservice.html. Now, go back to the Google Apps signup page, and click I’ve completed the steps above. Setup Your Email on Google Apps When this is done, your Google Apps account should be activated and ready to finish setting up.  Google Apps will offer to launch a guide to step you through the rest of the process; you can click Launch guide if you want, or click Skip this guide to continue on your own and go directly to the Apps dashboard.   If you choose to open the guide, you’ll be able to easily learn the ropes of Google Apps administration.  Once you’ve completed the tutorial, you’ll be taken to the Google Apps dashboard. Most of the Google Apps will be available for immediate use, but Email may take a bit more setup.  Click Activate email to get your Gmail-powered email running on your domain.    Add Google MX Records to Your Server You will need to add Google MX records to your domain registrar in order to have your mail routed to Google.  If your domain is hosted on WordPress.com, you’ve already made these changes so simply click I have completed these steps.  Otherwise, you’ll need to manually add these records before clicking that button.   Adding MX Entries is fairly easy, but the steps may depend on your hosting company or registrar.  With some hosts, you may have to contact support to have them add the MX records for you.  Our site’s host uses the popular cPanel for website administration, so here’s how we added the MX Entries through cPanel. Add MX Entries through cPanel Login to your site’s cPanel, and click the MX Entry link under Mail. Delete any existing MX Records for your domain or subdomain first to avoid any complications or interactions with Google Apps.  If you think you may want to revert to your old email service in the future, save a copy of the records so you can switch back if you need. Now, enter the MX Records that Google listed.  Here’s our account after we added all of the entries to our account. Finally, return to your Google Apps Dashboard and click the I have completed these steps button at the bottom of the page. Activating Service You’re now officially finished activating and setting up your Google Apps account.  Google will first have to check the MX records for your domain; this only took around an hour in our test, but Google warns it can take up to 48 hours in some cases. You may then see that Google is updating its servers with your account information.  Once again, this took much less time than Google’s estimate. When everything’s finished, you can click the link to access the inbox of your new Administrator email account in Google Apps. Welcome to Gmail … at your own domain!  All of the Google Apps work just the same in this version as they do in the public @gmail.com version, so you should feel right at home. You can return to the Google Apps dashboard from the Administrative email account by clicking the Manage this domain at the top right. In the Dashboard, you can easily add new users and email accounts, as well as change settings in your Google Apps account and add your site’s branding to your Apps. Your Google Apps will work just like their standard @gmail.com counterparts.  Here’s an example of an inbox customized with the techinch logo and a Gmail theme. Links to Remember Here are the common links to your Google Apps online.  Substitute your domain or subdomain for yourdomain.com. Dashboard https://www.google.com/a/cpanel/yourdomain.com Email https://mail.google.com/a/yourdomain.com Calendar https://www.google.com/calendar/hosted/yourdomain.com Docs https://docs.google.com/a/yourdomain.com Sites https://sites.google.com/a/yourdomain.com Conclusion Google Apps offers you great webapps and webmail for your domain, and let’s you take advantage of Google’s services while still maintaining the professional look of your own domain.  Setting up your account can be slightly complicated, but once it’s finished, it will run seamlessly and you’ll never have to worry about email or collaboration with your team again. Signup for the free Google Apps Standard Similar Articles Productive Geek Tips Mysticgeek Blog: Create Your Own Simple iGoogle GadgetAccess Your Favorite Google Services in Chrome the Easy WayRevo Uninstaller Pro [REVIEW]Mysticgeek Blog: A Look at Internet Explorer 8 Beta 1 on Windows XPFind Similar Websites in Google Chrome TouchFreeze Alternative in AutoHotkey The Icy Undertow Desktop Windows Home Server – Backup to LAN The Clear & Clean Desktop Use This Bookmarklet to Easily Get Albums Use AutoHotkey to Assign a Hotkey to a Specific Window Latest Software Reviews Tinyhacker Random Tips Xobni Plus for Outlook All My Movies 5.9 CloudBerry Online Backup 1.5 for Windows Home Server Snagit 10 Video preview of new Windows Live Essentials 21 Cursor Packs for XP, Vista & 7 Map the Stars with Stellarium Use ILovePDF To Split and Merge PDF Files TimeToMeet is a Simple Online Meeting Planning Tool Easily Create More Bookmark Toolbars in Firefox

    Read the article

  • how to insert many similar records in mysql at a time using phpmyadmin?

    - by Networker
    we know that we can insert multiple records at a time using this query: INSERT INTO `TABLE1` (`First`,`Last`) VALUES ('name1','surname1'), ('name2','surname2'), ('name3','surname3'), ('name4','surname4'); but what if we want to add 1000 similar records as above (name*,surname*) do we have to write down all the records or we can use something like wildcard? or is there any other solution using mysql?

    Read the article

  • NTPD issue - syncs then slowly loses ground

    - by ethrbunny
    RHEL 5 workstation. Has been running smoothly for years. I did a 'pup' recently and followed with a nice, cleansing reboot. Afterwards the system had some startup issues: namely MySQL refused to start. It just went "...." for 5-10 minutes before I did another boot and skipped that step (using 'interactive'). This was the only service that didn't wan't to start normally. So now that the system is booted I've found that it doesn't want to stay in sync with the NTP master and after 48 hours is refusing any SSH other than root. NTPD: this service starts normally and gets a lock on 4 servers. Almost immediately it starts to lose ground and now (after 3 days) is almost 40 hours behind. If I stop/start the service it gets the lock, resets the system clock and starts losing ground again. The 'hwclock' is set properly and maintains its time. Login: when I (re)start the ntp server I am able to login normally. I assume this problem is due to losing sync with LDAP. This appears to be verified by LDAP errors in /var/log/messages. Suggestions on where to look? ADDENDA: Tried deleting the 'drift' file. After a bit it gets recreated with 0.000. from /var/log/messages: Jan 17 06:54:01 aeolus ntpdate[5084]: step time server 129.95.96.10 offset 30.139216 sec Jan 17 06:54:01 aeolus ntpd[5086]: ntpd [email protected] Tue Oct 25 12:54:17 UTC 2011 (1) Jan 17 06:54:01 aeolus ntpd[5087]: precision = 1.000 usec Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface wildcard, 0.0.0.0#123 Disabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface wildcard, ::#123 Disabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface lo, ::1#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface eth0, fe80::213:72ff:fe20:4080#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface lo, 127.0.0.1#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: Listening on interface eth0, 10.127.24.81#123 Enabled Jan 17 06:54:01 aeolus ntpd[5087]: kernel time sync status 0040 Jan 17 06:54:02 aeolus ntpd[5087]: frequency initialized 0.000 PPM from /var/lib/ntp/drift Jan 17 06:54:02 aeolus ntpd[5087]: system event 'event_restart' (0x01) status 'sync_alarm, sync_unspec, 1 event, event_unspec' (0xc010) You can see the 30 second offset. This was after about one minute of operation.

    Read the article

  • Rsync and wildcards

    - by Jay White
    I am trying to back up both the "Last Session" and "Current Session" files for Google Chrome in one command, but using a wildcard doesn't seem to work. I am trying with the following command rsync -e "ssh -i new.key" -r --verbose -tz --stats --progress --delete '/cygdrive/c/Users/jay/AppData/Local/Google/Chrome/User Data/Default/*Session' user@host:"/chrome\ sessions/" and get the following error rsync: link_stat "/cygdrive/c/Users/jay/AppData/Local/Google/Chrome/User Data/Default/*Session" failed: No such file or directory (2) What am I doing wrong?

    Read the article

< Previous Page | 37 38 39 40 41 42 43 44 45 46 47 48  | Next Page >