Search Results

Search found 82071 results on 3283 pages for 'file url'.

Page 410/3283 | < Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417 | Next Page >

Help setup my .git/config file for Heroku AND my Unfuddle Account

- by 05WRXSTi

Ok, I have three different computers that I work from and right now their configurations are all different so I have to push/pull a certain on each and its very bothersome. What I want to do is have ONE config file that I can use for all three that will allow me to do the following: git push unfuddle git pull heroku git push unfuddle git pull heroku And I'm new to git, so I know that maybe I need heroku master or 'heroku origin` or somethign? Here is what my config file looks like right now: [core] repositoryformatversion = 0 filemode = true bare = false logallrefupdates = true [remote "origin"] fetch = +refs/heads/*:refs/remotes/origin/* url = [email protected]:HEROKU-APP.git [branch "master"] remote = origin merge = refs/heads/master [remote "unfuddle"] fetch = +refs/heads/*:refs/remotes/origin/* url = [email protected]:UNFUDDLE-APP/UNFUDDLE-APP.git obviously the git urls were changed to protect the innocent. What should I change so that I can easily push and pull to/from both of these repos? Thanks!

Read the article
PHP uploads file - enctype="multipart/form-data" issue

- by user147685

Hi all, I have this upload code. there are no problem running it individually, but when i try to add into my other codes, it did not get the $_files parameter. Im guessing it was becoz of enctype="multipart/form-data" in the form tag, based on this post: http://stackoverflow.com/questions/1695246/why-file-upload-didnt-work-without-enctype the enctype is needed. SO my problem is, how can i do upload files without concern to this? can we juz change the code structure so that it will be compatible with other codes? if($_POST['check']){ $faillampiran=$_POST['faillampiran']; $file=$_FILES['faillampiran']["name"]; $fileSize = $_FILES['faillampiran']['size']; $fileType = $_FILES['faillampiran']['type']; if ($_FILES["faillampiran"]["error"] > 0 ) { echo "Return Code: " . $_FILES["faillampiran"]["error"] . "<br />"; } else { move_uploaded_file($_FILES["faillampiran"]["tmp_name"],"upload/" . $_FILES["faillampiran"]["name"]); echo '<table align = "center">'; echo "<tr><td>"; echo "Your file has been successfully stored."; echo "</td></tr>"; echo '</table>'; } } ?> <form method="post" name="form1" id="form1" enctype="multipart/form-data"> <tr><td></td><td><input type="hidden" name="MAX_FILE_SIZE" value=""> </td> </tr> <tr><td> Please choose a file</td><td>:</td></tr> <tr> <input type="file" size="50" name="faillampiran" alt="faillampiran" id="faillampiran" 1value= "<?=$faillampiran;?>" /> <tr align = "center"><td colspan = "3"><input type="submit" value="Hantar" name="check"/></td></tr> </tr></form> thank you.

Read the article
How can I limit the cache used by copying so there is still memory available for other cache?

- by Peter

Basic situation: I am copying some NTFS disks in openSuSE. Each one is 2TB. When I do this, the system runs slow. My guesses: I believe it is likely due to caching. Linux decides to discard useful cache (eg. kde4 bloat, virtual machine disks, LibreOffice binaries, Thunderbird binaries, etc.) and instead fill all available memory (24 GB total) with stuff from the copying disks, which will be read only once, then written and never used again. So then any time I use these apps (or kde4), the disk needs to be read again, and reading the bloat off the disk again makes things freeze/hiccup. Due to the cache being gone and the fact that these bloated applications need lots of cache, this makes the system horribly slow. Since it is USB,the disk and disk controller are not the bottleneck, so using ionice does not make it faster. I believe it is the cache rather than just the motherboard going too slow, because if I stop everything copying, it still runs choppy for a while until it recaches everything. And if I restart the copying, it takes a minute before it is choppy again. But also, I can limit it to around 40 MB/s, and it runs faster again (not because it has the right things cached, but because the motherboard busses have lots of extra bandwidth for the system disks). I can fully accept a performance loss from my motherboard's IO capability being completely consumed (which is 100% used, meaning 0% wasted power which makes me happy), but I can't accept that this caching mechanism performs so terribly in this specific use case. # free total used free shared buffers cached Mem: 24731556 24531876 199680 0 8834056 12998916 -/+ buffers/cache: 2698904 22032652 Swap: 4194300 24764 4169536 I also tried the same thing on Ubuntu, which causes a total system hang instead. ;) And to clarify, I am not asking how to leave memory free for the "system", but for "cache". I know that cache memory is automatically given back to the system when needed, but my problem is that it is not reserved for caching of specific things. Question: Is there some way to tell these copy operations to limit memory usage so some important things remain cached, and therefore any slowdowns are a result of normal disk usage and not rereading the same commonly used files? For example, is there a setting of max memory per process/user/file system allowed to be used as cache/buffers?

Read the article
How to play small sound file continuously in Silverlight?

- by ash

Hello, I have two questions regarding Silverlight's SoundPlay action and properties. My scenario is like: I have two story board: The first story board has an image and a sound file; when the silverlight application gets loaded, the sound starts to play automatically, but if someone clicks the image, the sound file will stop and the second storyboard will start with a new sound file. 1) My first question is how to stop the first sound file of first story board when the second story board starts with the second sound file. 2) My second question is how to play a sound file continuously; for example, in Silverlight we can play a story board continuously with RepeatBehavior="Forever"; but I cannot find a way to play my 10 second sound file forever or continuously. Note: I have attached a small XAML file to show what I am talking about; I am also stating that if instead of an image file, if there were a button, then I can stop the first music file after I click the button and start my second story board with a new sound file, but I would like to use image file instead of a button. Is it possible? If it is, how to do it? Therefore, please answer my following two questions or give big hint or website tutorial links on 1) How to stop the first sound file of first story board when the second story board starts with the second sound file ( When the clickable element is an image instead of a button) 2) How to play a 10 second sound file continuously? ............Code Snippet...................... XAML ............ <Grid x:Name="LayoutRoot" Background="Red"> <Button HorizontalAlignment="Left" Margin="212,0,0,111" VerticalAlignment="Bottom" Width="75" Content="Button" Click="onClick"/> <MediaElement x:Name="sound2_mp3" Height="0" HorizontalAlignment="Left" Margin="105,230,0,0" VerticalAlignment="Top" Width="0" Source="/sound2.mp3" Stretch="Fill"/> <MediaElement x:Name="sound1_mp1" Height="0" HorizontalAlignment="Left" Margin="190,164,0,0" VerticalAlignment="Top" Width="0" Source="/sound1.mp3" Stretch="Fill" AutoPlay="False"/> </Grid> ..................................................................................................................................................................................................................... using System; using System.Windows; using System.Windows.Controls; using System.Windows.Documents; using System.Windows.Ink; using System.Windows.Input; using System.Windows.Media; using System.Windows.Media.Animation; using System.Windows.Shapes; namespace testPrj { public partial class MainPage : UserControl { public MainPage() { // Required to initialize variables InitializeComponent(); } private void onClick(object sender, System.Windows.RoutedEventArgs e) { Storyboard1.Stop(); sound2_mp3.Stop(); sound1_mp1.Play(); } } } ...................................................................................................

Read the article
jquey ajax upload file in asp.net mvc

- by CoffeeCode

i have a file in my view <form id="upload" enctype="multipart/form-data"> <input type="file" name="fileUpload" id="fileUpload" size="23" /><br /> </form> and an ajax request $.ajax({ url: '<%=Url.Action("JsonSave","Survey") %>', dataType: 'json', processData: false, contentType: "multipart/mixed", data: { Id: selectedRow.Id, Value: 'some date was added by the user here :))' }, cache: false, success: function(data) { } }); but there is no file in the Request.Files. Whats wrong with the ajax request?

Read the article
Binary file reading problem

- by ScReYm0

Ok i have problem with my code for reading binary file... First i will show you my writing code: void book_saving(char *file_name, struct BOOK *current) { FILE *out; BOOK buf; out = fopen(file_name, "wb"); if(out != NULL) { printf_s("Writting to file..."); do { if(current != NULL) { strcpy(buf.catalog_number, current->catalog_number); strcpy(buf.author, current->author); buf.price = current->price; strcpy(buf.publisher, current->publisher); strcpy(buf.title, current->title); buf.price = current->year_published; fwrite(&buf, sizeof(BOOK), 1, out); } current = current->next; }while(current != NULL); printf_s("Done!\n"); fclose(out); } } and here is my "version" for reading it back: int book_open(struct BOOK *current, char *file_name) { FILE *in; BOOK buf; BOOK *vnext; int count; int i; in = fopen("west", "rb"); printf_s("Reading database from %s...", file_name); if(!in) { printf_s("\nERROR!"); return 1; } i = fread(&buf,sizeof(BOOK), 1, in); while(!feof(in)) { if(current != NULL) { current = malloc(sizeof(BOOK)); current->next = NULL; } strcpy(current->catalog_number, buf.catalog_number); strcpy(current->title, buf.title); strcpy(current->publisher, buf.publisher); current->price = buf.price; current->year_published = buf.year_published; fread(&buf, 1, sizeof(BOOK), in); while(current->next != NULL) current = current->next; fclose(in); } printf_s("Done!"); return 0; } I just need to save my linked list in binary file and to be able to read it back ... please help me. The program just don't read it or its crash every time different situation ...

Read the article
How do I make the directories in a zip file relative to the target directory instead of my working directory

- by Nathan

I'm calling the zip command from a script where I cannot change directory. I need to make a zip file of the stuff in data/kit123/ from the directory which data resides in, but I want the contents of the zip to only be the contents of kit123, with paths relative to kit123. This is the directory structure myworkingdir data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 ... kit124 ... My script runs in myworkingdir and cannot change directories. If I call zip -r kit123.zip data/kit123 then the structure in the zip file will be data kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 but I want it to be kit123 kitpart1 file.xcf anotherfile.xcf kitpart2 Is there a zip option I can use to accomplish this? It seems odd that it should depend on my working directory I know it's not -j. that one destroys the structure within kit123

Read the article
phonegap crossplatform redirection to local file

- by Marco Gagliardi

Hi I'm developing a phonegap + JQueryMobile app, which should be correctly executed on Android, iOs and WindowsPhone as well. I need to exploit an external service wich requires one callback url to redirect the app to in case of success, and one in case of error (pretty common situation. In my case both will be local files, say www/success.html and www/error.html). Of course I could write different paths for each device (e.g. file:///android_asset/www/success.html on Android), but i'm wondering if the framework provide a more simple elegant solution. So the questions is, how can i get a unique absolute URL wich allows me to perform a cross-platform HTTP redirection from a remote web page to a local file within a phonegap application? Thanks

Read the article
How to clear a Firefox address bar without selecting its content?

- by zuba

Sometimes I need to move an url from an app to a browser. I select the url, say in gvim, and make Firefox window active. Then I see that I should clear address bar before pasting the new url, which requires selecting existing url, which wipes the new url from PRIMARY clipboard out. What is the best way to put the new url from PRIMARY clipboard to address bar? Is there a shortcut to clear address bar and then to move focus there? ps I know I can use Ctrl-C to put the new url to CLIPBOARD clipboard, but I prefer to use PRIMARY clipboard.

Read the article
jquery to construct a string and pass it as a post argument for file

- by user253530

I have this js code: $("#startSearch").live("click", function(event){ $("input:checkbox[name='searchId']:checked").each(function(){ var searchId = $(this).val(); var host = ''; $.post("php/autosearch-get-host.php",{sId: searchId},function(data){ host = 'http://' + data + '/index.php'; }); //alert(host); $.getJSON(host,{searchId: $(this).val()},function(){ pagination("php/pagination.php", $('#currentPage').val(), $('#sortBy').val(), $("#sortMode").val(), "autosearch"); }); }); }); The php file php/autosearch-get-host.php returns a string with the host name. What i want is to get the host from the database, create the URL using string concatenation and pass it as an argument to another $.post. $.post should use that URL like this: $.getJSON(host,{searchId: $(this).val()},function() { pagination("php/pagination.php", $('#currentPage').val(), $('#sortBy').val(), $("#sortMode").val(), "autosearch"); });

Read the article
Server Error Message: No File Access

- by iMayne

Hello. Im having an issues but dont know where to solve it. My template works great in xampp but not on the host server. I get this message: Warning: file_get_contents() [function.file-get-contents]: URL file-access is disables in the server configuration in homepage/......./twitter.php. The error is on line 64. <?php /* For use in the "Parse Twitter Feeds" code below */ define("SECOND", 1); define("MINUTE", 60 * SECOND); define("HOUR", 60 * MINUTE); define("DAY", 24 * HOUR); define("MONTH", 30 * DAY); function relativeTime($time) { $delta = time() - $time; if ($delta < 2 * MINUTE) { return "1 min ago"; } if ($delta < 45 * MINUTE) { return floor($delta / MINUTE) . " min ago"; } if ($delta < 90 * MINUTE) { return "1 hour ago"; } if ($delta < 24 * HOUR) { return floor($delta / HOUR) . " hours ago"; } if ($delta < 48 * HOUR) { return "yesterday"; } if ($delta < 30 * DAY) { return floor($delta / DAY) . " days ago"; } if ($delta < 12 * MONTH) { $months = floor($delta / DAY / 30); return $months <= 1 ? "1 month ago" : $months . " months ago"; } else { $years = floor($delta / DAY / 365); return $years <= 1 ? "1 year ago" : $years . " years ago"; } } /* Parse Twitter Feeds */ function parse_cache_feed($usernames, $limit, $type) { $username_for_feed = str_replace(" ", "+OR+from%3A", $usernames); $feed = "http://twitter.com/statuses/user_timeline.atom?screen_name=" . $username_for_feed . "&count=" . $limit; $usernames_for_file = str_replace(" ", "-", $usernames); $cache_file = dirname(__FILE__).'/cache/' . $usernames_for_file . '-twitter-cache-' . $type; if (file_exists($cache_file)) { $last = filemtime($cache_file); } $now = time(); $interval = 600; // ten minutes // check the cache file if ( !$last || (( $now - $last ) > $interval) ) { // cache file doesn't exist, or is old, so refresh it $cache_rss = file_get_contents($feed); (this is line 64) Any help on how to give this access on my host server?

Read the article
How to change icons of specific file types on Ubuntu 11.10?

- by Curious Apprentice

I want to change file icons of some specific file types like- .html, .css etc. I have tried using "File Type Editor (assogiate)" which is not working. I have also tried using "Gnome Tweak Tool" using icon themes. But that also does not worked properly (Though I can change folder icons , dash menu icons but not file icons). Please suggest me a way so that I can change file icons properly. I have read some of the articles saying about some mime type changes. I could not get proper guide from any of those articles. If there is such a way then please write in detail. Many Many Thanks in Advance :)

Read the article
Download file using java apache commons?

- by Kyle

How can I use the library to download a file and print out bytes saved? I tried using import static org.apache.commons.io.FileUtils.copyURLToFile; public static void Download() { URL dl = null; File fl = null; try { fl = new File(System.getProperty("user.home").replace("\\", "/") + "/Desktop/Screenshots.zip"); dl = new URL("http://ds-forums.com/kyle-tests/uploads/Screenshots.zip"); copyURLToFile(dl, fl); } catch (Exception e) { System.out.println(e); } } but I cannot display bytes or a progress bar. Which method should I use?

Read the article
WCF REST Does Not Contain All of the Relative File Path

- by Brandon

I have a RESTful WCF 3.5 endpoint as such: System.Security.User.svc This is supposed to represent the namespace of the User class and is desired behavior by our client. I have another endpoint I created for testing called: Echo.svc I am writing an overridden IHttpModule and in my module, I follow what almost everyone does by doing: string path = HttpContext.Current.Request.AppRelativeCurrentExecutionFilePath; If I make a call to: http://localhost/services/Echo/test My path variable has a value of '~/echo/test' However, when I make a call to: http://localhost/services/System.Security.User/test My path variable has a value of '~/system.security.user' In my 2nd situation, it is stripping off the '/test' on the end of any endpoint that contains multiple periods. This is undesired behavior and the only solution I have found to fixing this is some ugly string manipulation using the property which does contain the complete URL path: string rawPath = HttpContext.Current.Request.RawUrl; This returns '/services/system.security.user/test'. Does anyone know why my first situation does not return the rest of the URL path for endpoints that contain multiple periods in the name?

Read the article
Is it possible to mod_rewrite BASED on the existence of a file/directory and uniqueID?

- by JM4

My site currently forces all non www. pages to use www. Ultimately, I am able to handle all unique subdomains and parse correctly but I am trying to achieve the following: (ideally with mod_rewrite): when a consumer visits www.site.com/john4, the server processes that request as: www.site.com?Agent=john4 Our requirements are: The URL should continue to show www.site.com/john4 even though it was redirected to www.site.com?index.php?Agent=john4 If a file (of any extension OR a directory) exists with the name, the entire process stops an it tries to pull that file instead: for example: www.site.com/file would pull up (www.site.com/file.php if file.php existed on the server. www.site.com/pages would go to www.site.com/pages/index.php if the pages directory exists). Thank you ahead of time. I am completely at a crapshot right now.

Read the article
Problem doing SVN Vendor Branch - merge

- by Gyan

Hi, I am trying to use the svn vendor branch to upgrade the third party library. (We have modified the source code) I followed all the steps to create the vendor branch:: created the vendor branch for old version (3rd party library) created the vendor branch for latest version (3rd party library) copied the latest version to current folder using (usign svn_load_dirs.pl script) structure of vendor repository in svn URL/vendor/library/3.5.0 URL/vendor/library/3.7.0 URL/vendor/library/current I have the library-3.5.0 used/modified at URL/trunk/library/customized-library I have a problem when I try to merge the difference between URL/vendor/library/3.7.0 and URL/vendor/library/3.5.0 to URL/trunk/library/customized-library I am at the folder where URL/trunk/library/customized-library is checked out and I use following command to do the merge svn merge URL/vendor/library/3.5.0 URL/vendor/library/current . --accept PARAMETERS when I use theirs-conflict for accept parameter, It ignores all of my changes to the old version and copies files from 3.7.0 when I user mine-conflict, it ignores the files in 3.7.0 when I use postpone, it throws exception "tree conflict" Thanks Gyan

Read the article
Is there a way to recover a file that I have deleted but is still open somewhere?

- by George Edison

This question is related to How to recover deleted files? but it is slightly different in nature. Suppose I have a file named ~/something open in a text editor. Further suppose that I open a terminal and run the following command while the file is still open in the text editor: rm ~/something This will delete the file. Now suppose that I changed my mind and wanted to get the file back. The file is still open in the text editor, so it hasn't been removed from the disk or filesystem yet. Is there any way to recover it?

Read the article
Will the app file be sync from dmgr side after we remove it from installedApps path in Websphere?

- by wing2ofsky

do you know whether the app file will be sync from dmgr side and regenerated after we remove it from installedApps path? i've got one issue recently from customer. That is, they uploaded one image file into WASNode installedApps app path manually. Afterwards, they removed that file manually again from installedApps app path. But after restarting the Application server process, that file has been regenerated under same installedApps path. So i suspect that file maybe has been resync from dmgr node, like app file under applications folder. However, first of all, i don't see that image file within application ear file from DMGR applications folder. Moreover, i made a test myself, if i deleted file from installedApps app path, that file never be regenerated any more even though the node sync completed. So does anybody know why? Thanks in advance

Read the article
Efficient file buffering & scanning methods for large files in python

- by eblume

The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

Read the article
A question about making a C# class persistent during a file load

- by Adam

Apologies for the indescriptive title, however it's the best I could think of for the moment. Basically, I've written a singleton class that loads files into a database. These files are typically large, and take hours to process. What I am looking for is to make a method where I can have this class running, and be able to call methods from within it, even if it's calling class is shut down. The singleton class is simple. It starts a thread that loads the file into the database, while having methods to report on the current status. In a nutshell it's al little like this: public sealed class BulkFileLoader { static BulkFileLoader instance = null; int currentCount = 0; BulkFileLoader() public static BulkFileLoader Instance { // Instanciate the instance class if necessary, and return it } public void Go() { // kick of 'ProcessFile' thread } public void GetCurrentCount() { return currentCount; } private void ProcessFile() { while (more rows in the import file) { // insert the row into the database currentCount++; } } } The idea is that you can get an instance of BulkFileLoader to execute, which will process a file to load, while at any time you can get realtime updates on the number of rows its done so far using the GetCurrentCount() method. This works fine, except the calling class needs to stay open the whole time for the processing to continue. As soon as I stop the calling class, the BulkFileLoader instance is removed, and it stops processing the file. What I am after is a solution where it will continue to run independently, regardless of what happens to the calling class. I then tried another approach. I created a simple console application that kicks off the BulkFileLoader, and then wrapped it around as a process. This fixes one problem, since now when I kick off the process, the file will continue to load even if I close the class that called the process. However, now the problem I have is that cannot get updates on the current count, since if I try and get the instance of BulkFileLoader (which, as mentioned before is a singleton), it creates a new instance, rather than returning the instance that is currently in the executing process. It would appear that singletons don't extend into the scope of other processes running on the machine. In the end, I want to be able to kick off the BulkFileLoader, and at any time be able to find out how many rows it's processed. However, that is even if I close the application I used to start it. Can anyone see a solution to my problem?

Read the article
UTF8 from web conten .xml file to NSString

- by mongeta

Hello, I can't find a way to convert some UTF8 encoding into NSString. I get some data from a URL, it's a .xml file and here is their content: <?xml version="1.0" encoding="UTF-8"?> <person> <name>Jim Fernández</name> <phone>555-1234</phone> </person> How I can convert the á into a á ? some code that doesn't work: NSString* newStr = [[NSString alloc] initWithData:[NSData dataWithContentsOfURL:URL] encoding:NSUTF8StringEncoding];

Read the article
Use matching value of a RegExp to name the output file.

- by fx42

I have this file "file.txt" which I want to split into many smaller ones. Each line of the file has an id field which looks like "id:1" for a line belonging to id 1. For each id in the file, I like to create a file named idid.txt and put all lines that belong to this id in that file. My brute force bash script solution reads as follows. count=1 while [ $count -lt 19945 ] do cat file.txt | grep "id:$count " >> ./sets/id$count.txt count='expr $count + 1' done Now this is very inefficient as I have do read through the file about 20.000 times. Is there a way to do the same operation with only one pass through the file? - What I'm probably asking for is a way to use the value that matches for a regular expression to name the associated output file.

Read the article
could not save the file /usr/... permission denied (13.04)

- by plaguedoctor

I am running Ubuntu 13.04 and am trying to create an .sh file for conky in /usr/bin using gedit. When trying to save I get the error dialogue: Could not save the file /usr/bin/conky-start.sh You do not have the permissions necessary to save the file. Please check that you typed the location correctly and try again." From searching, I think I have to run a command in terminal to allow permission, but I couldn't find out what that is. Edit: I'm trying to create the file conky-start.sh, not change or run it. Thus far, I've opened gedit, copied and pasted some required info from the net, and I'm trying to save-as /usr/bin/conky-start.sh Perhaps I need to create the file first in terminal, then edit it? How would I do that?

Read the article
Rails 3: How do I call a javascript function from a js.erb file

- by user321775

Now that I've upgraded to Rails 3, I'm trying to figure out the proper way to separate and reuse pieces of javascript. Here's the scenario I'm dealing with: I have a page with two areas: one with elements that should be draggable, the other with droppables. When the page loads I use jQuery to setup the draggables and droppables. Currently I have the script in the head portion of application.html.erb, which I'm sure is not the right solution but at least works. When I press a button on the page, an ajax call is made to my controller that replaces the draggables with a new set of elements that should also be draggable. I have a js.erb file that renders a partial in the correct location. After rendering I need to make the new elements draggable, so I'd like to reuse the code that currently lives in application.html.erb, but I haven't found the right way to do it. I can only make the new elements draggable by pasting the code directly into my js.erb file (yuck). What I'd like to have: - a javascript file that contains the functions prepdraggables() and prepdroppables() - a way to call either function from application.html.erb or from a js.erb file I've tried using :content_for to store and reuse the code, but can't seem to get it working correctly. What I currently have in the head section of application.html.erb <% content_for :drag_drop_prep do %> <script type="text/javascript" charset="utf-8"> $(document).ready(function () { // declare all DOM elements with class draggable to be draggable $( ".draggable" ).draggable( { revert : 'invalid' }); // declare all DOM elements with class legal to be droppable $(".legal").droppable({ hoverClass : 'legal_hover', drop : function(event, ui) { var c = new Object(); c['die'] = ui.draggable.attr("id"); c['cell'] = $(this).attr("id"); c['authenticity_token'] = encodeURIComponent(window._token); $.ajax({ type: "POST", url: "/placeDie", data: c, timeout: 5000 }); }}); }); </script> <% end %> undo.js.erb $("#board").html("<%= escape_javascript(render :partial => 'shared/board', :locals => { :playable => true, :restartable => !session[:challenge]}) %>") // This is where I want to prepare draggables. <%= javascript_include_tag "customdragdrop.js" %> // assuming this file had the draggables code from above in a prepdraggables() function prepdraggables();

Read the article
Can I copy large files faster without using the file cache?

- by Veazer

After adding the preload package, my applications seem to speed up but if I copy a large file, the file cache grows by more than double the size of the file. By transferring a single 3-4 GB virtualbox image or video file to an external drive, this huge cache seems to remove all the preloaded applications from memory, leading to increased load times and general performance drops. Is there a way to copy large, multi-gigabyte files without caching them (i.e. bypassing the file cache)? Or a way to whitelist or blacklist specific folders from being cached?

Read the article

< Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417 | Next Page >