Search Results

Search found 11042 results on 442 pages for 'side'.

Page 410/442 | < Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >

  • WPF Binding when setting DataTemplate Programically

    - by Daniel
    Hello, I have my little designer tool (my program). On the left side I have TreeView and on the right site I have Accordion. When I select a node I want to dynamically build Accordion Items based on Properties from DataContext of selected node. Selecting nodes works fine, and when I use this sample code for testing it works also. XAML code: <layoutToolkit:Accordion x:Name="accPanel" SelectionMode="ZeroOrMore" SelectionSequence="Simultaneous"> <layoutToolkit:AccordionItem Header="Controller Info"> <StackPanel Orientation="Horizontal" DataContext="{Binding}"> <TextBlock Text="Content:" /> <TextBlock Text="{Binding Path=Name}" /> </StackPanel> </layoutToolkit:AccordionItem> </layoutToolkit:Accordion> C# code: private void treeSceneNode_SelectedItemChanged(object sender, RoutedPropertyChangedEventArgs<object> e) { if (e.NewValue != e.OldValue) { if (e.NewValue is SceneNode) { accPanel.DataContext = e.NewValue; //e.NewValue is a class that contains Name property } } } But the problem occurs when I'm trying to achive this using DateTemplate and dynamically build AccordingItem, the Binding is not working: <layoutToolkit:Accordion x:Name="accPanel" SelectionMode="ZeroOrMore" SelectionSequence="Simultaneous"> </layoutToolkit:Accordion> and DateTemplate in my ResourceDictionary <DataTemplate x:Key="dtSceneNodeContent"> <StackPanel Orientation="Horizontal" DataContext="{Binding}"> <TextBlock Text="Content:" /> <TextBlock Text="{Binding Path=Name}" /> </StackPanel> </DataTemplate> and C# code: private void treeSceneNode_SelectedItemChanged(object sender, RoutedPropertyChangedEventArgs<object> e) { if (e.NewValue != e.OldValue) { ResourceDictionary rd = new ResourceDictionary(); rd.Source = new Uri("/SilverGL.GUI;component/SilverGLDesignerResourceDictionary.xaml", UriKind.RelativeOrAbsolute); if (e.NewValue is SceneNode) { accPanel.DataContext = e.NewValue; AccordionItem accController = new AccordionItem(); accController.Header = "Controller Info"; accController.ContentTemplate = rd["dtSceneNodeContent"] as DataTemplate; accPanel.Items.Add(accController); } else { // Other type of node } } } I really need help with this issue. Thanks for any support. Daniel

    Read the article

  • Infinite loop when adding a row to a list in a class in python3

    - by Margaret
    I have a script which contains two classes. (I'm obviously deleting a lot of stuff that I don't believe is relevant to the error I'm dealing with.) The eventual task is to create a decision tree, as I mentioned in this question. Unfortunately, I'm getting an infinite loop, and I'm having difficulty identifying why. I've identified the line of code that's going haywire, but I would have thought the iterator and the list I'm adding to would be different objects. Is there some side effect of list's .append functionality that I'm not aware of? Or am I making some other blindingly obvious mistake? class Dataset: individuals = [] #Becomes a list of dictionaries, in which each dictionary is a row from the CSV with the headers as keys def field_set(self): #Returns a list of the fields in individuals[] that can be used to split the data (i.e. have more than one value amongst the individuals def classified(self, predicted_value): #Returns True if all the individuals have the same value for predicted_value def fields_exhausted(self, predicted_value): #Returns True if all the individuals are identical except for predicted_value def lowest_entropy_value(self, predicted_value): #Returns the field that will reduce <a href="http://en.wikipedia.org/wiki/Entropy_%28information_theory%29">entropy</a> the most def __init__(self, individuals=[]): and class Node: ds = Dataset() #The data that is associated with this Node links = [] #List of Nodes, the offspring Nodes of this node level = 0 #Tree depth of this Node split_value = '' #Field used to split out this Node from the parent node node_value = '' #Value used to split out this Node from the parent Node def split_dataset(self, split_value): fields = [] #List of options for split_value amongst the individuals datasets = {} #Dictionary of Datasets, each one with a value from fields[] as its key for field in self.ds.field_set()[split_value]: #Populates the keys of fields[] fields.append(field) datasets[field] = Dataset() for i in self.ds.individuals: #Adds individuals to the datasets.dataset that matches their result for split_value datasets[i[split_value]].individuals.append(i) #<---Causes an infinite loop on the second hit for field in fields: #Creates subnodes from each of the datasets.Dataset options self.add_subnode(datasets[field],split_value,field) def add_subnode(self, dataset, split_value='', node_value=''): def __init__(self, level, dataset=Dataset()): My initialisation code is currently: if __name__ == '__main__': filename = (sys.argv[1]) #Takes in a CSV file predicted_value = "# class" #Identifies the field from the CSV file that should be predicted base_dataset = parse_csv(filename) #Turns the CSV file into a list of lists parsed_dataset = individual_list(base_dataset) #Turns the list of lists into a list of dictionaries root = Node(0, Dataset(parsed_dataset)) #Creates a root node, passing it the full dataset root.split_dataset(root.ds.lowest_entropy_value(predicted_value)) #Performs the first split, creating multiple subnodes n = root.links[0] n.split_dataset(n.ds.lowest_entropy_value(predicted_value)) #Attempts to split the first subnode.

    Read the article

  • Stretch panel with splitter

    - by user1153896
    I want to implement a basic WPF layout with three panels and two splitters (Horizontal and Vertical splitter). Two panels on the left and on the bottom has to be callapsable and one panel has to stretch accordingly. Here is a simple XAML: <Grid> <Grid.ColumnDefinitions> <ColumnDefinition Width="*"/> <ColumnDefinition Width="5"/> <ColumnDefinition Width="*"/> </Grid.ColumnDefinitions> <StackPanel Background="Aqua" Grid.Column="0" Name="leftPanel" > <TextBlock FontSize="35" Foreground="#58290A" TextWrapping="Wrap">Left Hand Side</TextBlock> </StackPanel> <GridSplitter Grid.Column="1" HorizontalAlignment="Stretch"/> <Grid Grid.Column="2" HorizontalAlignment="Stretch" VerticalAlignment="Stretch"> <Grid.RowDefinitions> <RowDefinition Height="*" /> <RowDefinition Height="5" /> <RowDefinition Height="*" /> </Grid.RowDefinitions> <StackPanel HorizontalAlignment="Stretch" VerticalAlignment="Stretch"> <Label Content="... Clien Area .. Has to Stretch vertically and horizontally" Margin="10"></Label> <Button Click="LeftButton_Click" Margin="10">Close Left Panel</Button> <Button Click="BottomButton_Click" Margin="10">Close Bottom Panel</Button> </StackPanel> <GridSplitter Grid.Row="1" Background="Gray" HorizontalAlignment="Stretch"/> <ListBox Grid.Row="2" Background="Violet" Name="bottomPanel"> <ListBoxItem>Hello</ListBoxItem> <ListBoxItem>World</ListBoxItem> </ListBox> </Grid> </Grid> and codebehind: private void LeftButton_Click(object sender, RoutedEventArgs e) { leftPanel.Visibility = (leftPanel.Visibility == System.Windows.Visibility.Visible)? System.Windows.Visibility.Collapsed : System.Windows.Visibility.Visible; } private void BottomButton_Click(object sender, RoutedEventArgs e) { bottomPanel.Visibility = (bottomPanel.Visibility == System.Windows.Visibility.Visible) ? System.Windows.Visibility.Collapsed : System.Windows.Visibility.Visible; } This code doesn't work as expected :(. Any WPF experts around? to suggest a solution for having Client Area (stretched) and splitter at the same time? DockPanel will work perfectly, but I need splitter! Thanks.

    Read the article

  • Why won't C# accept a (seemingly) perfectly good Sql Server CE Query?

    - by VoidKing
    By perfectly good sql query, I mean to say that, inside WebMatrix, if I execute the following query, it works to perfection: SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER('o'), ''))) / len('o') AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%o%' UNION SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER('o'), ''))) / len('o') AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%o%' UNION SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER('o'), ''))) / len('o') AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%o%' Here i am using 'o' as a static search string to search upon. No problem, but not exeactly very dynamic. Now, when I write this query as a string in C# and as I think it should be (and even as I have done before) I get a server-side error indicating that the string was not in the correct format. Here is a pic of that error: And (although I am only testing the output, should I get it to quit erring), here is the actual C# (i.e., the .cshtml) page that queries the database: @{ Layout = "~/Layouts/_secondaryMainLayout.cshtml"; var db = Database.Open("Content"); string searchText = Request.Unvalidated["searchText"]; string selectQueryString = "SELECT page AS location, (len(page) - len(replace(UPPER(page), UPPER(@0), ''))) / len(@0) AS occurences, 'pageSettings' AS tableName FROM PageSettings WHERE page LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT pageTitle AS location, (len(pageTitle) - len(replace(UPPER(pageTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'ExternalSecondaryPages' AS tableName FROM ExternalSecondaryPages WHERE pageTitle LIKE '%' + @0 + '%' "; selectQueryString += "UNION "; selectQueryString += "SELECT eventTitle AS location, (len(eventTitle) - len(replace(UPPER(eventTitle), UPPER(@0), ''))) / len(@0) AS occurences, 'MainStreetEvents' AS tableName FROM MainStreetEvents WHERE eventTitle LIKE '%' + @0 + '%'"; @:beginning <br/> foreach (var row in db.Query(selectQueryString, searchText)) { @:entry @:@row.location &nbsp; @:@row.occurences &nbsp; @:@row.tableName <br/> } } Since it is erring on the foreach (var row in db.Query(selectQueryString, searchText)) line, that heavily suggests that something is wrong with my query, however, everything seems right to me about the syntax here and it even executes to perfection if I query the database (mind you, un-parameterized) directly. Logically, I would assume that I have erred somewhere with the syntax involved in parameterizing this query, however, my double and triple checking (as well as, my past experience at doing this) insists that everything looks fine here. Have I messed up the syntax involved with parameterizing this query, or is something else at play here that I am overlooking? I know I can tell you, for sure, as it has been previously tested, that the value I am getting from the query string is, indeed, what I would expect it to be, but as there really isn't much else on the .cshtml page yet, that is about all I can tell you.

    Read the article

  • What's wrong with this code? Values not saved to db

    - by Scott B
    Been trying to get this code to work for several days now to no avail. I'm at wits end. I've managed, with the code below, to create a customized category picker widget that appears on the PAGE editor. However, for the life of me, I cannot get the checked categories to save. function my_post_options_box() { if ( function_exists('add_meta_box') ) { //add_meta_box( $id, $title, $callback, $page, $context, $priority ); add_meta_box('categorydiv', __('Page Options'), 'post_categories_meta_box_modified', 'page', 'side', 'core'); } } //adds the custom categories box function post_categories_meta_box_modified($post) { $noindexCat = get_cat_ID('noindex'); $nofollowCat = get_cat_ID('nofollow'); if(in_category("noindex")){ $noindexChecked = " checked='checked'";} else {$noindexChecked = "";} if(in_category("nofollow")){ $nofollowChecked = " checked='checked'";} else {$noindexChecked = "";} ?> <div id="categories-all" class="ui-tabs-panel"> <ul id="categorychecklist" class="list:category categorychecklist form-no-clear"> <li id='category-<?php echo $noindexCat ?>' class="popular-category"><label class="selectit"><input value="<?php echo $noindexCat ?>" type="checkbox" name="post_category[]" id="in-category-<?php echo $noindexCat ?>"<?php echo $noindexChecked ?> /> noindex</label></li> <li id='category-<?php echo $nofollowCat ?>' class="popular-category"><label class="selectit"><input value="<?php echo $noindexCat ?>" type="checkbox" name="post_category[]" id="in-category-<?php echo $nofollowCat ?>"<?php echo $nofollowChecked ?> /> nofollow</label></li> <li id='category-1' class="popular-category"><label class="selectit"><input value="1" type="checkbox" name="post_category[]" id="in-category-1" checked="checked"/> Uncategorized</label></li> </ul> </div> <?php }

    Read the article

  • Monitoring UDP socket in glib(mm) eats up CPU time

    - by Gyorgy Szekely
    Hi, I have a GTKmm Windows application (built with MinGW) that receives UDP packets (no sending). The socket is native winsock and I use glibmm IOChannel to connect it to the application main loop. The socket is read with recvfrom. My problem is: this setup eats 25% percent CPU time on a 3GHz workstation. Can somebody tell me why? The application is idle in this case, and if I remove the UDP code, CPU usage drops down to almost zero. As the application has to perform some CPU intensive tasks, I could image better ways to spend that 25% Here are some code excerpts: (sorry for the printf's ;) ) /* bind */ void UDPInterface::bindToPort(unsigned short port) { struct sockaddr_in target; WSADATA wsaData; target.sin_family = AF_INET; target.sin_port = htons(port); target.sin_addr.s_addr = 0; if ( WSAStartup ( 0x0202, &wsaData ) ) { printf("WSAStartup failed!\n"); exit(0); // :) WSACleanup(); } sock = socket( AF_INET, SOCK_DGRAM, 0 ); if (sock == INVALID_SOCKET) { printf("invalid socket!\n"); exit(0); } if (bind(sock,(struct sockaddr*) &target, sizeof(struct sockaddr_in) ) == SOCKET_ERROR) { printf("failed to bind to port!\n"); exit(0); } printf("[UDPInterface::bindToPort] listening on port %i\n", port); } /* read */ bool UDPInterface::UDPEvent(Glib::IOCondition io_condition) { recvfrom(sock, (char*)buf, BUF_SIZE*4, 0, NULL, NULL); /* process packet... */ } /* glibmm connect */ Glib::RefPtr channel = Glib::IOChannel::create_from_win32_socket(udp.sock); Glib::signal_io().connect( sigc::mem_fun(udp, &UDPInterface::UDPEvent), channel, Glib::IO_IN ); I've read here in some other question, and also in glib docs (g_io_channel_win32_new_socket()) that the socket is put into nonblocking mode, and it's "a side-effect of the implementation and unavoidable". Does this explain the CPU effect, it's not clear to me? Whether or not I use glib to access the socket or call recvfrom() directly doesn't seem to make much difference, since CPU is used up before any packet arrives and the read handler gets invoked. Also glibmm docs state that it's ok to call recvfrom() even if the socket is polled (Glib::IOChannel::create_from_win32_socket()) I've tried compiling the program with -pg and created a per function cpu usage report with gprof. This wasn't usefull because the time is not spent in my program, but in some external glib/glibmm dll.

    Read the article

  • Cannot export a fusionchart with 'Embedding Charts Using <OBJECT>/<EMBED> Tags'

    - by zoom_pat277
    I am trying to export a fusion chart created using 'Embedding Charts Using / Tags'. Export works just perfect with the right click (on the chart) and chose a pdf to export. But I am not able to make this work via javascript. I have a button outside the chart which upon clicking calls the function below function myexport() { var object = getChartFromId('myChartid'); if( object.hasRendered() ) object.exportChart({exportFormat: 'PDF'}); } the object above returned is null and this fails on the next line here is the full prototype <html> <head> <title>My Chart</title> <script type="text/javascript" src="fusionCharts.debug.js"></script> <script type="text/javascript" src="fusionChartsExportComponent.js"></script> <script type="text/javascript"> function ExportMyChart() { var cObject = getChartFromId('Column3D'); if( cObject.hasRendered() ) cObject.exportChart({exportFormat: 'PDF'}); } </script> </head> <body> <object width="400" height="400" id="Column3D" classid="clsid:d27cdb6e-ae6d-11cf-96b8-444553540000" codebase="http://fpdownload.macromedia.com/pub/shockwave/cabs/flash/swflash.cab#version=8,0,0,0" > <param name="testname" value="Column3D.swf" /> <param name="FlashVars" value="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0"> <param name="quality" value="high" /> <embed src="Column3D.swf" flashVars="&dataURL=testData.xml&chartWidth=400&chartHeight=300&DOMId=myChart1&registerWithJS=1&debugMode=0" width="400" height="300" name="Column3D" quality="high" type="application/x-shockwave-flash" pluginspage="http://www.macromedia.com/go/getflashplayer" /> </object> <!-- We also create a DIV to contain the FusionCharts client-side exporter component --> <div id="holderDiv" align="center">FusionCharts Export Handler Component</div> <script type="text/javascript"> var myExportComponent = new FusionChartsExportObject("testExporter1", "FCExporter.swf"); //Render the exporter SWF in our DIV fcexpDiv myExportComponent.Render("holderDiv"); </script> <input type="button" value="Export My Chart" onclick="ExportMyChart()" />

    Read the article

  • Selecting the contents of an ASP.NET TextBox in an UpdatePanel after a partial page postback

    - by Scott Mitchell
    I am having problems selecting the text within a TextBox in an UpdatePanel. Consider a very simple page that contains a single UpdatePanel. Within that UpdatePanel there are two Web controls: A DropDownList with three statically-defined list items, whose AutoPostBack property is set to True, and A TextBox Web control The DropDownList has a server-side event handler for its SelectedIndexChanged event, and in that event handler there's two lines of code: TextBox1.Text = "Whatever"; ScriptManager.RegisterStartupScript(this, this.GetType(), "Select-" + TextBox1.ClientID, string.Format("document.getElementById('{0}').select();", TextBox1.ClientID), true); The idea is that whenever a user chooses and item from the DropDownList there is a partial page postback, at which point the TextBox's Text property is set and selected (via the injected JavaScript). Unfortunately, this doesn't work as-is. (I have also tried putting the script in the pageLoad function with no luck, as in: ScriptManager.RegisterStartupScript(..., "function pageLoad() { ... my script ... }");) What happens is the code runs, but something else on the page receives focus at the conclusion of the partial page postback, causing the TextBox's text to be unselected. I can "fix" this by using JavaScript's setTimeout to delay the execution of my JavaScript code. For instance, if I update the emitted JavaScript to the following: setTimeout("document.getElementById('{0}').select();", 111); It "works." I put works in quotes because it works for this simple page on my computer. In a more complex page on a slower computer with more markup getting passed between the client and server on the partial page postback, I have to up the timeout to over a second to get it to work. I would hope that there is a more foolproof way to achieve this. Rather than saying, "Delay for X milliseconds," it would be ideal to say, "Run this when you're not going to steal the focus." What's perplexing is that the .Focus() method works beautifully. That is, if I scrap my JavaScript and replace it with a call to TextBox1.Focus(); then the TextBox receives focus (although the text is not selected). I've examined the contents of MicrosoftAjaxWebForms.js and see that the focus is set after the registered scripts run, but I'm my JavaScript skills are not strong enough to decode what all is happening here and why the selected text is unselected between the time it is selected and the end of the partial page postback. I've also tried using Firebug's JavaScript debugger and see that when my script runs the TextBox's text is selected. As I continue to step through it the text remains selected, but then after stepping off the last line of script (apparently) it all of the sudden gets unselected. Any ideas? I am pulling my hair out. Thanks in advance...

    Read the article

  • How to stream semi-live audio over internet

    - by Thomas Tempelmann
    I want to write something like Skype, i.e. I have a constant audio stream on one computer and then recompress it in a format that's suitable for a latent internet connection, receive it on the other end and play it. Let's also assume that the internet connection is fairly modern and fast, i.e. DSL or alike, no slow connections over phone and such. The involved computers will also be rather modern (Dual Core Intel CPUs at 2GHz or more). I know how to handle the audio on the machines. What I don't know is how to transmit the audio in an efficient way. The challenges are: I'd like get good audio quality across the line. The stream should be received without drops. The stream may, however, be received with a little delay (a second delay is acceptable). I imagine that the transport software could first determine the average (and max) latency, then start the stream and tell the receiver to wait for that max latency before starting to play the audio. With that, if the latency doesn't get any higher, the entire stream will be playable on the other side without stutter or drops. If, due to unexpected IP latencies or blockages, the stream does get cut off, I want to be able to notice this so that I can take actions (e.g. abort the stream) and eventually start a new transmission. What are my options if I want do use ready-made software for the compression and tranmission? I have no intention to write my own audio compression engine, really. OTOH, I plan to sell the solution in a vertical market, meaning I can afford a few dollars of license fees per copy, but not $100s. I guess the simplest solution would be to just open a TCP stream, send a few packets back and forth to determine their running time (or even use UDP for that), then use the results as the guide for my max latency value, then simply fire the audio data in its raw form (uncompressed 16 bit stereo), along with a timing code over the TCP connection. The receiver reads the data and plays it with the pre-determined delay. That might just work with the type of fast connection I expect. I just wonder if there are better solutions to reach this goal, with better performance (lower latency) and less data (compressed). BTW, I first try to implement this on OS X, but might want to do it on Windows, too, if it proves successful.

    Read the article

  • Navigation bar(s) disappear when the window gets too small

    - by Leron
    The title maybe is a little misleading but I'm not 100% sure how this effect is called. I'm pretty sure what I meant is that my navigation bar is disappearing instead of collapsing. However my set up is this - I am working on the Layout view of ASP.NET MVC 4 project. I'm using bootstrap 3x but also have included jQuery libs so my <head> part is like this: @Scripts.Render("~/Scripts/bootstrap.min.js") @Styles.Render("~/Content/bootstrap.css") @Styles.Render("~/Content/themes/base/jquery.ui.smoothness.css") @Scripts.Render("~/Scripts/jquery-2.0.3.min.js") @Scripts.Render("~/Scripts/jquery-ui-1.10.3.min.js") //just skipped the standard stuff In the body I want to have two navbars and one side menu which will be the same for all my pages but I've noticed that when I start to narrow the window at some point instead of getting an effect similar to this example (noticed how the elements get repositioned) I just got both my navbars gone, I can't see them. The markup for my first navbar is this : <div class="navbar navbar-static-top navbar-inverse navbar-collapse collapse" role="navigation"> <ul class="nav navbar-nav "> <li><a href="#">Info</a></li> <li><a href="#">Info</a></li> </ul> </div> and the second one is : <div class="navbar navbar-collapse collapse" role="navigation" id="main-navigation-bar"> <ul class="nav nav-pills nav-justified"> <li style="border: 1px solid grey"><a href="#">Link</a></li> <li><a href="#">Link</a></li> <li><a href="#">Link</a></li> </ul> In fact the only thing left in my _Layout body is this: <div class="container-fluid"> @RenderBody() </div> which is just for compiling purposes and renders this view : <p>1</p> <p>2</p> <p>3</p> <p>4</p> <p>5</p> So when I make the window small enough so that my navbars disappear the only thing left is 1..5 numbers from the rendered view. I tested with only one navbar (commented the other) - no matter which one is commented, when I narrow the window I loose the navbar. How can I keep them using bootstrap 3x?

    Read the article

  • .Net Remote Log Querying

    - by jlafay
    I have a Win Service that I'm working on that consists of the service, WF Service (using WorkflowServiceHost), a Workflow (WorkflowApplication) that queries/processes data from a SQL Server DB, and a Comm Marshall class that handles data flow between the service and the WF. The WF does a lot of heavy data processing and the original app (early VB6) logged all the processing and displayed the results on the screen of the host machine. Critical events will be committed to eventlog because I strongly believe that should be common practice because admins naturally will look there and because it already has support for remote viewing. The workflow will also need to write logging events as it processes and iterates according to our business logic. Such as: records queried, records returned, processed records, etc. The data is very critical and we need to log actions as they occur. The logs are currently kept as text files on disk and I think that is ok. Ideally I would like to record log events in XML so it's easier to query and because it is less costly than a DB, especially since our DB servers do a lot of heavy processing anyways. Since we are replacing essentially a VB6 application with a robust windows service (taking advantage of WF 4.0), it has been requested that a remote client also be created. It receives callbacks from the service after subscribing to it and being added to a collection of subscribers. Basic statistics and summaries are updated client side after receiving basic monitoring data of what is going on with the service. We would like to also provide a way to provide details when we need to examine what is going on further because this is a long running data processing service and issues need to be addressed immediately. What is the best way to implement some type of query from the client that is sent to the service and returned to the client? Would it be efficient to implement another method to expose on the service and then have that pass that off to some querying class/object to examine the XML files by whichever specification and then return it to the client? That's the main concern. I don't want the service to processing to bottleneck much while this occurs. It seems that WF already auto-magically threads well for the most part but I want to make sure this is the right way to go about it. Any suggestions/recommendations on how to architect and implement a small log querying framework for a remote service would be awesome.

    Read the article

  • How should I handle the case in which a username is already in use?

    - by idealmachine
    I'm a JavaScript programmer and new to PHP and MySQL (want to get into server-side coding). Because I'm trying to learn PHP by building a simple online game (more specifically, correspondence chess), I'm starting by implementing a simple user accounts system. Of course, user registration comes first. What are the best practices for: How I should handle the (likely) possibility that when a user tries to register, the username he has chosen is already in use, particularly when it comes to function return values?($result === true is rather ugly, and I'm not sure whether checking the MySQL error code is the best way to do it either) How to cleanly handle varying page titles?($gPageTitle = '...'; require_once 'bgsheader.php'; is also rather ugly) Anything else I'm doing wrong? In some ways, PHP is rather different from JavaScript... Here is a (rather large) excerpt of the code I have written so far. Note that this is a work in progress and is missing security checks that I will add as my next step. function addUser( $username, $password ) { global $gDB, $gPasswordSalt; $stmt = $gDB->prepare( 'INSERT INTO user(user_name, user_password, user_registration) VALUES(?, ?, NOW())' ); $stmt || trigger_error( 'Failed to prepare statement: ' . htmlspecialchars( $gDB->error ) ); $hashedPassword = hash_hmac( 'sha256', $password, $gPasswordSalt, true ); $stmt->bind_param( 'ss', $username, $hashedPassword ); if( $stmt->execute() ) { return true; } elseif( $stmt->errno == 1062) { return 'exists'; } else { trigger_error( 'Failed to execute statement: ' . htmlspecialchars( $stmt->error ) ); } } $username = $_REQUEST['username']; $password = $_REQUEST['password']; $result = addUser( $username, $password ); if( $result === true ) { $gPageTitle = 'Registration successful'; require_once 'bgsheader.php'; echo '<p>You have successfully registered as ' . htmlspecialchars( $username ) . ' on this site.</p>'; } elseif( $result == 'exists' ) { $gPageTitle = 'Username already taken'; require_once 'bgsheader.php'; echo '<p>Someone is already using the username you have chosen. Please try using another one instead.'; } else { trigger_error('This should never happen'); } require_once 'bgsfooter.php';

    Read the article

  • HTTP Post requests using HttpClient take 2 seconds, why?

    - by pableu
    Update: You might better hold off this for a bit, I just noticed I could be my fault after all. Working on this all afternoon, and then I find a flaw ten minutes after posting here, ts. Hi, I'am currently coding an android app that submits stuff in the background using HTTP Post and AsyncTask. I use the org.apache.http.client Package for this. I based my code on this example. Basically, my code looks like this: public void postData() { // Create a new HttpClient and Post Header HttpClient httpclient = new DefaultHttpClient(); HttpPost httppost = new HttpPost("http://192.168.1.137:8880/form"); try { List<NameValuePair> nameValuePairs = new ArrayList<NameValuePair>(2); nameValuePairs.add(new BasicNameValuePair("id", "12345")); nameValuePairs.add(new BasicNameValuePair("stringdata", "AndDev is Cool!")); httppost.setEntity(new UrlEncodedFormEntity(nameValuePairs)); // Execute HTTP Post Request HttpResponse response = httpclient.execute(httppost); } catch (ClientProtocolException e) { Log.e(TAG,e.toString()); } catch (IOException e) { Log.e(TAG,e.toString()); } } The problem is that the httpclient.execute(..) line takes around 1.5 to 3 seconds, and I do not understand why. Just requesting a page with HTTP Get takes around 80 ms or so, so the problem doesn't seem to be the network latency itself. The problem doesn't seem to be on the server side either, I have also tried POSTing data to http://www.disney.com/ with similarly slow results. And Firebug shows 1 ms response time when POSTing data to my server locally. This happens on the Emulator and with my Nexus One (both with Android 2.2). If you want to look at the complete code, I've put it on GitHub. It's just a dummy program to do HTTP Post in the background using AsyncTask on the push of a button. It's my first Android app, and my first java code for a long time. And incidentially, also my first question on Stackoverflow ;-) Any ideas why httpclient.execute(httppost) takes so long?

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • How to reduce redundant code when adding new c++0x rvalue reference operator overloads

    - by Inverse
    I am adding new operator overloads to take advantage of c++0x rvalue references, and I feel like I'm producing a lot of redundant code. I have a class, tree, that holds a tree of algebraic operations on double values. Here is an example use case: tree x = 1.23; tree y = 8.19; tree z = (x + y)/67.31 - 3.15*y; ... std::cout << z; // prints "(1.23 + 8.19)/67.31 - 3.15*8.19" For each binary operation (like plus), each side can be either an lvalue tree, rvalue tree, or double. This results in 8 overloads for each binary operation: // core rvalue overloads for plus: tree operator +(const tree& a, const tree& b); tree operator +(const tree& a, tree&& b); tree operator +(tree&& a, const tree& b); tree operator +(tree&& a, tree&& b); // cast and forward cases: tree operator +(const tree& a, double b) { return a + tree(b); } tree operator +(double a, const tree& b) { return tree(a) + b; } tree operator +(tree&& a, double b) { return std::move(a) + tree(b); } tree operator +(double a, tree&& b) { return tree(a) + std::move(b); } // 8 more overloads for minus // 8 more overloads for multiply // 8 more overloads for divide // etc which also has to be repeated in a way for each binary operation (minus, multiply, divide, etc). As you can see, there are really only 4 functions I actually need to write; the other 4 can cast and forward to the core cases. Do you have any suggestions for reducing the size of this code? PS: The class is actually more complex than just a tree of doubles. Reducing copies does dramatically improve performance of my project. So, the rvalue overloads are worthwhile for me, even with the extra code. I have a suspicion that there might be a way to template away the "cast and forward" cases above, but I can't seem to think of anything.

    Read the article

  • Where are the function literals in c++?

    - by academicRobot
    First of all, maybe literals is not the right term for this concept, but its the closest I could think of (not literals in the sense of functions as first class citizens). The idea is that when you make a conventional function call, it compiles to something like this: callq <immediate address> But if you make a function call using a function pointer, it compiles to something like this: mov <memory location>,%rax callq *%rax Which is all well and good. However, what if I'm writing a template library that requires a callback of some sort with a specified argument list and the user of the library is expected to know what function they want to call at compile time? Then I would like to write my template to accept a function literal as a template parameter. So, similar to template <int int_literal> struct my_template {...};` I'd like to write template <func_literal_t func_literal> struct my_template {...}; and have calls to func_literal within my_template compile to callq <immediate address>. Is there a facility in C++ for this, or a work around to achieve the same effect? If not, why not (e.g. some cataclysmic side effects)? How about C++0x or another language? Solutions that are not portable are fine. Solutions that include the use of member function pointers would be ideal. I'm not particularly interested in being told "You are a <socially unacceptable term for a person of low IQ>, just use function pointers/functors." This is a curiosity based question, and it seems that it might be useful in some (albeit limited) applications. It seems like this should be possible since function names are just placeholders for a (relative) memory address, so why not allow more liberal use (e.g. aliasing) of this placeholder. p.s. I use function pointers and functions objects all the the time and they are great. But this post got me thinking about the don't pay for what you don't use principle in relation to function calls, and it seems like forcing the use of function pointers or similar facility when the function is known at compile time is a violation of this principle, though a small one.

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • css coding on Myspace - Problem

    - by Frederik Wessberg
    Hey Folks. I've read what I could, and I'm certainly no master, but I'm fixing up a colleagues profile on myspace.com, and im working with 2 divs in each side of the screen, and I want them to align so that they are next to each other. I've tried float: left; and float: right;, and I've tried margin: right; on div 1 and such. Could you help? Here's the site: http://www.myspace.com/jonasjohansen This is info for div1: <div class="textBox" align="left" style="width: 290px; word-wrap:break-word"> <span class="orangetext15"> BANDS </span> <b>MOVE</b><br /> Fredrik ....balbalbalbla </div> <style> .textBox { position: relative; left:-320px; top:0px; width: 290px; height: 350px; overflow-y: visible; overflow-x: visible; top: YYYpx; z-index: 3; background-color: transparent; border:none; } </style> This is info for div2: <style>.i {display:none;}{!-eliminate bio header!-}table table td.text table td.text {display:none;}{!-recover in shows and friends-!}table table td.text div table td.text,table table td.text table.friendSpace td.text {display:inline;}{! move up our custom section. You may change px value !}div.myDivR {position:relative; top:0px; margin-bottom:-300px; }{! you can apply style to the custom div !}div.myDivR {background-color:white; border:2px solid; border-color:darkgreen; float: right;}</style></td></tr></table></td></tr></table><span class="off">Re-Open Bio Table give it our own Class </span><table class="myBio" style="width:435px;"><tr><i class="i"></i><td class="myBioHead" valign="center" align="left" width="auto" bgcolor="ffcc99" height="17"> &nbsp;&nbsp;<span class="orangetext15"> ABOUT JONAS JOHANSEN</span> </td></tr><tr><td><table class="myBioI"><tr><td><span class="off"></span> blalbalbalbalbla <span class="off">END Bio Content </span>

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • how to animate 2 surfaces in Matlab?

    - by Kate
    Hi everyone, I've written this code which makes an animation of 2 ellipsoids. Parameter k1 of these ellipsoids must depend on time (so they'd move asynchronously), but I need to animate them in one figure. Can I use loop for it or is it better to use timer & some kind of callback functions? The second problem - I need to move inner ellipsoid so they would have one common side. How can I do this? a=5; b=a; c=10; u = (0:0.05*pi:2*pi)'; v = [0:0.05*pi:2*pi]; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; % cut upper V1=4/3*pi*a*b*c; d=1/2; e=2^d; a2=a/e; b2=a/e; c2=c; V2=4/3*pi*a2*b2*c2; X2 = a2*sin(u)*cos(v);%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; % cut h=1/3; for j = 1:20 k1=(sin(pi*j/20)+0.5)^h; a=a*k1; c=c*k1; X = a*sin(u)*cos(v); Y = a*sin(u)*sin(v); Z = c*cos(u)*ones(size(v)); Z(Z0)=0; a2=a2*k1; b2=a2*k1; c2=c2*k1; X2 = a2*sin(u)*cos(v)+5;%-2.5; Y2 = b2*sin(u)*sin(v); Z2 = c2*cos(u)*ones(size(v));%+0.25; Z2(Z20)=0; hS1=surf(X,Y,Z); alpha(.11) hold on hS2=surf(X2,Y2,Z2); hold off axis([-20 20 -20 20 -20 20]); F(j) = getframe; end movie(F,4)

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • SQL Server 2008: If Multiple Values Set In Other Mutliple Values Set

    - by AJH
    In SQL, is there anyway to accomplish something like this? This is based off a report built in SQL Server Report Builder, where the user can specify multiple text values as a single report parameter. The query for the report grabs all of the values the user selected and stores them in a single variable. I need a way for the query to return only records that have associations to EVERY value the user specified. -- Assume there's a table of Elements with thousands of entries. -- Now we declare a list of properties for those Elements to be associated with. create table #masterTable ( ElementId int, Text varchar(10) ) insert into #masterTable (ElementId, Text) values (1, 'Red'); insert into #masterTable (ElementId, Text) values (1, 'Coarse'); insert into #masterTable (ElementId, Text) values (1, 'Dense'); insert into #masterTable (ElementId, Text) values (2, 'Red'); insert into #masterTable (ElementId, Text) values (2, 'Smooth'); insert into #masterTable (ElementId, Text) values (2, 'Hollow'); -- Element 1 is Red, Coarse, and Dense. Element 2 is Red, Smooth, and Hollow. -- The real table is actually much much larger than this; this is just an example. -- This is me trying to replicate how SQL Server Report Builder treats -- report parameters in its queries. The user selects one, some, all, -- or no properties from a list. The written query treats the user's -- selections as a single variable called @Properties. -- Example scenario 1: User only wants to see Elements that are BOTH Red and Dense. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Dense in (select Text from #masterTable where ElementId = e.Id) --ideally a set containing only Red, Coarse, and Dense --Both Red and Dense are within Element 1's properties (Red, Coarse, Dense), so Element 1 gets returned, but not Element 2. -- Example scenario 2: User only wants to see Elements that are BOTH Red and Hollow. select e.* from Elements e where (@Properties) --ideally a set containing only Red and Hollow in (select Text from #masterTable where ElementId = e.Id) --Both Red and Hollow are within Element 2's properties (Red, Smooth, Hollow), so Element 2 gets returned, but not Element 1. --Example Scenario 3: User only picked the Red option. select e.* from Elements e where (@Properties) --ideally a set containing only Red in (select Text from #masterTable where ElementId = e.Id) --Red is within both Element 1 and Element 2's properties, so both Element 1 and Element 2 get returned. The above syntax doesn't actually work because SQL doesn't seem to allow multiple values on the left side of the "in" comparison. Error that returns: Subquery returned more than 1 value. This is not permitted when the subquery follows =, !=, <, <= , >, >= or when the subquery is used as an expression. Am I even on the right track here? Sorry if the example looks long-winded or confusing.

    Read the article

  • compressed archive with quick access to individual file

    - by eric.frederich
    I need to come up with a file format for new application I am writing. This file will need to hold a bunch other text files which are mostly text but can be other formats as well. Naturally, a compressed tar file seems to fit the bill. The problem is that I want to be able to retrieve some data from the file very quickly and getting just a particular file from a tar.gz file seems to take longer than it should. I am assumeing that this is because it has to decompress the entire file even though I just want one. When I have just a regular uncompressed tar file I can get that data real quick. Lets say the file I need quickly is called data.dat For example the command... tar -x data.dat -zf myfile.tar.gz ... is what takes a lot longer than I'd like. MP3 files have id3 data and jpeg files have exif data that can be read in quickly without opening the entire file. I would like my data.dat file to be available in a similar way. I was thinking that I could leave it uncompressed and seperate from the rest of the files in myfile.tar.gz I could then create a tar file of data.dat and myfile.tar.gz and then hopefully that data would be able to be retrieved faster because it is at the head of outer tar file and is uncompressed. Does this sound right?... putting a compressed tar inside of a tar file? Basically, my need is to have an archive type of file with quick access to one particular file. Tar does this just fine, but I'd also like to have that data compressed and as soon as I do that, I no longer have quick access. Are there other archive formats that will give me that quick access I need? As a side note, this application will be written in Python. If the solution calls for a re-invention of the wheel with my own binary format I am familiar with C and would have no problem writing the Python module in C. Idealy I'd just use tar, dd, cat, gzip, etc though. Thanks, ~Eric

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

< Previous Page | 406 407 408 409 410 411 412 413 414 415 416 417  | Next Page >