Search Results

Search found 11140 results on 446 pages for 'side scroller'.

Page 415/446 | < Previous Page | 411 412 413 414 415 416 417 418 419 420 421 422  | Next Page >

  • Sessions not persisting between requests

    - by klonq
    My session objects are only stored within the request scope on google app engine and I can't figure out how to persist objects between requests. The docs are next to useless on this matter and I can't find anyone who's experienced a similar problem. Please help. When I store session objects in the servlet and forward the request to a JSP using: getServletContext().getRequestDispatcher("/example.jsp").forward(request,response); Everything works like it should. But when I store objects to the session and redirect the request using: response.sendRedirect("/example/url"); The session objects are lost to the ether. In fact when I dump session key/value pairs on new requests there is absolutely nothing, session objects only appear within the request scope of servlets which create session objects. It appears to me that the objects are not being written to Memcache or Datastore. In terms of configuring sessions for my application I have set <sessions-enabled>true</sessions-enabled> In appengine-web.xml. Is there anything else I am missing? The single paragraph of documentation on sessions also notes that only objects which implement Serializable can be stored in the session between requests. I have included an example of the code which is not working below. The obvious solution is to not use redirects, and this might be ok for the example given below but some application data does need to be stored in the session between requests so I need to find a solution to this problem. EXAMPLE: The class FlashMessage gives feedback to the user from server-side operations. if (email.send()) { FlashMessage flash = new FlashMessage(FlashMessage.SUCCESS, "Your message has been sent."); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message will not be available in the session object in the next request response.sendRedirect(URL.HOME); } else { FlashMessage flash = new FlashMessage(FlashMessage.ERROR, FlashMessage.INVALID_FORM_DATA); session.setAttribute(FlashMessage.SESSION_KEY, flash); // The flash message is displayed without problem getServletContext().getRequestDispatcher(Templates.CONTACT_FORM).forward(request,response); } FlashMessage.java import java.io.Serializable; public class FlashMessage implements Serializable { private static final long serialVersionUID = 8109520737272565760L; // I have tried using different, default and no serialVersionUID public static final String SESSION_KEY = "flashMessage"; public static final String ERROR = "error"; public static final String SUCCESS = "success"; public static final String INVALID_FORM_DATA = "Your request failed to validate."; private String message; private String type; public FlashMessage (String type, String message) { this.type = type; this.message = message; } public String display(){ return "<div id='flash' class='" + type + "'>" + message + "</div>"; } }

    Read the article

  • jQuery UI dialog + WebKit + HTML response with script

    - by Anthony Koval'
    Once again I am faced with a great problem! :) So, here is the stuff: on the client side, I have a link. By clicking on it, jQuery makes a request to the server, gets response as HTML content, then popups UI dialog with that content. Here is the code of the request-function: function preview(){ $.ajax({ url: "/api/builder/", type: "post", //dataType: "html", data: {"script_tpl": $("#widget_code").text(), "widgets": $.toJSON(mwidgets), "widx": "0"}, success: function(data){ //console.log(data) $("#previewArea").dialog({ bgiframe: true, autoOpen: false, height: 600, width: 600, modal: true, buttons: { "Cancel": function() { $(this).dialog('destroy'); } } }); //console.log(data.toString()); $('#previewArea').attr("innerHTML", data.toString()); $("#previewArea").dialog("open"); }, error: function(){ console.log("shit happens"); } }) } The response (data) is: <html> <head> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <script type="text/javascript">var smakly_widget_sid = 0 ,widgets = [{"cols": "2","rows": "2","div_id": "smakly_widget","wid": "0","smakly_style": "small_image",}, ] </script> <script type="text/javascript" src="/media/js/smak/smakme.js"></script> </head> <body> preview <div id="smakly_widget" style="width:560px;height:550px"> </div> </body> </html> As you see, there is a script to load: smakme.js, somehow it doesn't execute in WebKit-based browsers (I tried in Safari and Chrome), but in Firefox, Internet Explorer and Opera it works as expected! Here is that script: String.prototype.format = function(){ var pattern = /\{\d+\}/g; var args = arguments; return this.replace(pattern, function(capture){ return args[capture.match(/\d+/)]; }); } var turl = "/widget" var widgetCtrl = new(function(){ this.render_widget = function (w, content){ $("#" + w.div_id).append(content); } this.build_widgets = function(){ for (var widx in widgets){ var w = widgets[widx], iurl = '{0}?sid={1}&wid={2}&w={3}&h={4}&referer=http://ya.ru&thrash={5}'.format( turl, smakly_widget_sid, w.wid, w.cols, w.rows, Math.floor(Math.random()*1000).toString()), content = $('<iframe src="{0}" width="100%" height="100%"></iframe>'.format(iurl)); this.render_widget(w, content); } } }) $(document).ready(function(){ widgetCtrl.build_widgets(); }) Is that some security issue, or anything else?

    Read the article

  • Recommended ASP.NET Shared Hosting

    - by coffeeaddict
    Ok, I have to admit I'm getting fed up with www.discountasp.net's pricing model and this annoyance has built up over the past 8 years or so. I've been with them for years and absolutely love them on the technical side, however it's getting ridiculously expensive for so little that you get. I mean here's my scenario: 1) I am running 2 SQL Server databases which costs me $10/ea per month so that's $20/month for 2 and I only get 500 mb disk space which is horrible 2) I am paying $10/mo just for the hosting itself which I only get 1 gig of disk space! I mean common! 3) I am simply running 2 small apps (Screwturn Wiki & Subtext Blog)...so I don't really care if it's up 99% or not, it's not worth paying a total of $300 just to keep these 2 apps running over discountasp.net Anyone else feel the same? Yes, I know they have great support, probably have great servers running behind this but in the end I really don't care as long as my site is up 95% or better. Yes, the hosting toolset rocks. But you know I bet you I can find a similar set somewhere else. I like how I can totally control IIS 7 at discountasp and I can control my own app pool etc. That's very powerful and essential. But anyone have any good alternatives to discountasp that gives me close to the same at a much more reasonable cost point? I mean http://www.m6.net/prices.aspx gives you 10 SQL Databases for $7 and 200 gigs disk space! I don't know about their tools or support but just looking at those numbers and some other hosts I've seen, I feel that discountasp.net is way out of line. They don't even offer any purchasing discounts such as it would be nice if my 2nd SQL Server is only $5/month not $10...stuff like this, to make it much more realistic and fair. Opinions (people who do have discountasp.net, people who have left them, or people who have another host they like)??? But geez $300 just to host a couple DBs and lightweight open source apps? Not worth the price they are charging. I'm almost at a price point that enables me to get a decent dedicated server! I really don't care about beta support. Not a big deal to me.

    Read the article

  • Strategies for "Always-Connected" Windows Client Data Architecture

    - by magz2010
    Hi. Let me start by saying: this is my 1st post here, this is a bit lenghty, and I havent done Windows Forms development in years....with that in mind please excuse me if this isn't directly a programming question and please bear with me as I really need the help!! I have been asked to develop a Windows Forms app for our company that talks to a central (local area network) Linux Server hosting a PostgreSQL database. The app is to allow users to authenticate themselves into the system and thereafter conduct the usual transactions with the PG database. Ordinarily, I would propose writing a webforms app against Mono, but the clients need to utilise local resources such as USB peripheral devices, so that is out of the question. While it might not seem clear, my questions are italised below: Dilemma #1: The application is meant to be always connected. How should I structure my DAL/BLL - Should this reside on the server or with the client? Dilemma #2: I have been reading up on Client Application Services (CAS), and it seems like a great fit for authentication, as everything is exposed via URIs. I know that a .NET Data Provider exists for PostgreSQL, but not too sure if CAS will all work on a Linux (Debian) server? Believe me, I would get my hands dirty and try myself, but I need to come up with a logical design first before resources are allocated to me for "trial purposes"! Dilemma #3: If the DAL/BLL is to reside on the server, is there any way I can create data services, and expose only these services to authenticated clients. There is a (security) requirement whereby a connection string with username and password to the database cannot be present on any client machines...even if security on the database side is quite rigid. I'm guessing that the only way for this to work would be to create the various CRUD data service methods that are exposed by an ASP.NET app, and have the WindowsForms make a request for data or persist data to the ASP.NET app (thru a URI) and have that return a resultset or value. Would I be correct in assuming this? Should I be looking into WCF Data Services? and will WCF work with a non-SQL Server database? Thank you for taking the time out to read this, but know that I am desperately seeking any advice on this! THANKS A MILLION!!!!

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • How do you select form elements in JQuery based upon an html table?

    - by Swoop
    I am working on some ASP.NET web forms which involves some dynamic generation, and I need to add some onClick helpers on the client side. I have a basic outline of something working, except for one huge problem. There are multiple HTML tables, each generated by a different ASP.NET web control. Each table can contain overlapping field names, which is causing a problem with my JQuery click event handlers. The click event handler is linking to unintended form fields in addition to the intended form field. I have provided a simplified sample version of the code below. This code is trying to set the value of textbox box1 when a particular radiobutton is selected in the table with id=thing1. Obviously, the jquery code will be triggered for the form fields in both tables. The tables are dynamically added to the webpage based upon different conditions. It is possible that no tables will be loaded, only 1 table, or both tables might load. In the future, other tables could be added. Each table comes from a different .net web control. Other than renaming the form fields to make sure they are unique across all user controls, is there a way to have JQuery act only on the intended form fields? In other words, could the table ID be incorporated into the JQuery code in a manner that does not become a nightmare to maintain later? <script> $(document).ready(function() { $("[id$=radio1_0]").click(function() { $("[id$=box1]").attr("value", ""); }); $("[id$=radio1_1]").click(function() { $("[id$=box1]").attr("value", "N/A"); }); </script> <table id="thing1"> <tr><td> <radiobuttonlist id="radio1"/> <listitem>yes</listitem> <listitem>no</listitem> </td></tr> <tr><td> <textbox id="box1"/> </td></tr> </table> <table id="thing2"> <tr><td> <radiobuttonlist id="radio1"/> <listitem>yes</listitem> <listitem>no</listitem> </td></tr> <tr><td> <textbox id="box1"/> </tr></td> </table>

    Read the article

  • Can someone who understands C code help me understand this code?

    - by Benjamin
    INT GetTree (HWND hWnd, HTREEITEM hItem, HKEY *pRoot, TCHAR *pszKey, INT nMax) { TV_ITEM tvi; TCHAR szName[256]; HTREEITEM hParent; HWND hwndTV = GetDlgItem (hWnd, ID_TREEV); memset (&tvi, 0, sizeof (tvi)); hParent = TreeView_GetParent (hwndTV, hItem); if (hParent) { // Get the parent of the parent of the... GetTree (hWnd, hParent, pRoot, pszKey, nMax); // Get the name of the item. tvi.mask = TVIF_TEXT; tvi.hItem = hItem; tvi.pszText = szName; tvi.cchTextMax = dim(szName); TreeView_GetItem (hwndTV, &tvi); //send the TVM_GETITEM message? lstrcat (pszKey, TEXT ("\\")); lstrcat (pszKey, szName); } else { *pszKey = TEXT ('\0'); szName[0] = TEXT ('\0'); // Get the name of the item. tvi.mask = TVIF_TEXT | TVIF_PARAM; tvi.hItem = hItem; tvi.pszText = szName; tvi.cchTextMax = dim(szName); if (TreeView_GetItem (hwndTV, &tvi)) //*pRoot = (HTREEITEM)tvi.lParam; //original hItem = (HTREEITEM)tvi.lParam; else { INT rc = GetLastError(); } } return 0; } The block of code that begins with the comment "Get the name of the item" does not make sense to me. If you are getting the listview item why does the code set the parameters of the item being retrieved, because if you already had the values there would be no need to retrieve them. Secondly near the comment "original" is the original line of code which will compile with a varning under embedded visual c++, but if you copy the exact same code into visual studio 2008 it will not compile. Since I did not write any of this code and am trying to learn is it possible the original author made a mistake on this line, since the *pRoot should point to and HKEY type yet he is casting to an HTREEITEM type which should never work since the data types don't match? (Side note someone with a better reputation should add a windows ce tag to SO since windows mobile is not the same as windows ce.)

    Read the article

  • Java - is this an idiom or pattern, behavior classes with no state

    - by Berlin Brown
    I am trying to incorporate more functional programming idioms into my java development. One pattern that I like the most and avoids side effects is building classes that have behavior but they don't necessarily have any state. The behavior is locked into the methods but they only act on the parameters passed in. The code below is code I am trying to avoid: public class BadObject { private Map<String, String> data = new HashMap<String, String>(); public BadObject() { data.put("data", "data"); } /** * Act on the data class. But this is bad because we can't * rely on the integrity of the object's state. */ public void execute() { data.get("data").toString(); } } The code below is nothing special but I am acting on the parameters and state is contained within that class. We still may run into issues with this class but that is an issue with the method and the state of the data, we can address issues in the routine as opposed to not trusting the entire object. Is this some form of idiom? Is this similar to any pattern that you use? public class SemiStatefulOOP { /** * Private class implies that I can access the members of the <code>Data</code> class * within the <code>SemiStatefulOOP</code> class and I can also access * the getData method from some other class. * * @see Test1 * */ class Data { protected int counter = 0; public int getData() { return counter; } public String toString() { return Integer.toString(counter); } } /** * Act on the data class. */ public void execute(final Data data) { data.counter++; } /** * Act on the data class. */ public void updateStateWithCallToService(final Data data) { data.counter++; } /** * Similar to CLOS (Common Lisp Object System) make instance. */ public Data makeInstance() { return new Data(); } } // End of Class // Issues with the code above: I wanted to declare the Data class private, but then I can't really reference it outside of the class: I can't override the SemiStateful class and access the private members. Usage: final SemiStatefulOOP someObject = new SemiStatefulOOP(); final SemiStatefulOOP.Data data = someObject.makeInstance(); someObject.execute(data); someObject.updateStateWithCallToService(data);

    Read the article

  • how to change color of text following function in javascript

    - by OVERTONE
    Ok before i make spaghetti of this code i thought id ask around here. ive made a quiz for an online site. The answers are stored in an array, and ive a function that checks the answers array to what youve clicked. then it counts them and gives you your score. but i want to change the clor of the right answer wen the user clicks the score button. so the correct answers are highlighted. something like this https://www.shutterpoint.com/Home-Quiz.cfm (just hit submit at the bottom, no need to do the quiz). the little answer icon at the side looks flashy but id rather just have the text change color. heres how my questions are formatted <p>Depth of field is controlled by :?</p> <p id = "question2"><input type="radio" name="question2" id="Answer1" value = "a" onClick ="recordAnswer(2,this.value)"/> The focal length of the lens. <br/> <input type="radio" name="question2" id="Answer2" value = "b" onClick = "recordAnswer(2,this.value)"/> The size of the aperture opening. <br/> <input type="radio" name="question2" id="Answer3" value = "c" onClick = "recordAnswer(2,this.value)"/> The distance between the camera and lens. <br/> <input type="radio" name="question2" id="Answer4" value = "d" onClick = "recordAnswer(2,this.value)"/> All of these. <br/></p> and these are the two functions that are called throughout. record answer is called every time the user clicks a button function recordAnswer(question,answer) { answers[question-1] = answer; } this is the final button which calculates the score function scoreQuiz() { var totalCorrect = 0; for(var count = 0; count<correctAnswers.length;count++) { if(answers[count]== correctAnswers[count]) totalCorrect++; } <!-- alert("You scored " + totalCorrect + " out of 12 correct!"); --> } another function is best i think. ive already made attemots at it and know i have to set the color using document.getElementById('question2').style.color = '#0000ff'; question2 being the p id i think if i take in the value part of (input type....) ill be able to compare it to the answers array. but im not quite sure how to do this. any helpers? maybe something like this document.getElementById("Answer1").style.color = '#0000ff'; using the id part of the (input type line) i think i got it actually. ill post my answer in a sec

    Read the article

  • Issues in Ajax based applications

    - by Sinuhe
    I'm very interested in developing Ajax based applications. This is, loading almost all of the content of the application via XMLHttpRequest, instead of only some combos and widgets. But if I try to do this form scratch, soon I find some problems without an easy solution. I wonder if there is some framework (both client and server side) to deal with this issues. As far as I know, there isn't (but I've searched mainly in Java world). So I am seriously thinking of doing my own framework, at least for my projects. Therefore, in this question I ask for several things. First, the possible problems of an ajax based development. Then, I'm looking for some framework or utility in order to deal with them. Finally, if there is no framework available, what features must it have. Here are the issues I thought: 1 - JavaScript must be enabled. Security paranoia isn't the only problem: a lot of mobile devices couldn't use the application, too. 2 - Sometimes you need to update more than one DIV (e.g. main content, menu and breadcrumbs). 3 - Unknown response type: when you make an Ajax call, you set the callback function too, usually specifying if expected response is a javascript object or in which DIV put the result. But this fails when you get another type of response: for example when the session has expired and the user must log in again. 4 - Browser's refresh, back and forward buttons can be a real pain. User will expect different behaviors depending on the situation. 5 - When search engines indexes a site, only follow links. Thus, content load by Ajax won't "exist" for who doesn't know about it yet. 6 - Users can ask for open a link in a different window/tab. 7 - Address bar doesn't show the "real" page you are in. So, you can't copy the location and send it to a friend or bookmark the page. 8 - If you want to monetize the site, you can put some advertisings. As you don't refresh entire page and you want to change the ad after some time, you have to refresh only the DIV where the ad is. But this can violate the Terms and Conditions of your ad service. In fact, it can go against AdSense TOS. 9 - When you refresh an entire page, all JavaScript gets "cleaned". But in Ajax calls, all JavaScript objects will remain. 10 - You can't easily change your CSS properties.

    Read the article

  • how to fix protocol violation in c#

    - by Jeremy Styers
    I have a c# "client" and a Java "server". The java server has a wsdl it serves to the client. So far it works for c# to make a request for the server to perform a soap action. My server gets the soap request executes the method and tries to return the result back to the client. When I send the response to c# however, I get "The server committed a protocol violation. Section=ResponseStatusLine". I have spent all day trying to fix this and have come up with nothing that works. If I explain what i did, this post would be very long, so I'll keep it brief. i Googled for hours and everything tells me my "response line" is correct. I tried shutting down Skype, rearranging the response line, adding things, taking things away, etc, etc. All to no avail. This is for a class assignment so no, I can not use apis to help. I must do everything manually on the server side. That means parsing by hand, creating the soap response and the http response by hand. Just thought you'd like to know that before you say to use something that does it for me. I even tried making sure my server was sending the correct header by creating a java client that "mimicked" the c# one so I could see what the server returned. However, it's returning exactly what i told it to send. I tried telling my java client to do the same thing but to an actuall running c# service, to see what a real service returns, and it returned basically the same thing. To be safe, I copied it's response and tried sending it to the c# client and it still threw the error. Can anyone help? I've tried all i can think of, including adding the useUnsafeHeaderParsing to my app config. Nothing is working though. I send it exactly what a real service sends it and it yells at me. I send it what i want and it yells. I'm sending this: "200 OK HTTP/1.0\r\n" + "Content-Length: 201\r\n" + "Cache-Control: private\r\n" + "Content-Type: text/xml; charset=utf-8\r\n\r\n";

    Read the article

  • C - How to use both aio_read() and aio_write().

    - by Slav
    I implement game server where I need to both read and write. So I accept incoming connection and start reading from it using aio_read() but when I need to send something, I stop reading using aio_cancel() and then use aio_write(). Within write's callback I resume reading. So, I do read all the time but when I need to send something - I pause reading. It works for ~20% of time - in other case call to aio_cancel() fails with "Operation now in progress" - and I cannot cancel it (even within permanent while cycle). So, my added write operation never happens. How to use these functions well? What did I missed? EDIT: Used under Linux 2.6.35. Ubuntu 10 - 32 bit. Example code: void handle_read(union sigval sigev_value) { /* handle data or disconnection */ } void handle_write(union sigval sigev_value) { /* free writing buffer memory */ } void start() { const int acceptorSocket = socket(AF_INET, SOCK_STREAM, 0); struct sockaddr_in addr; memset(&addr, 0, sizeof(struct sockaddr_in)); addr.sin_family = AF_INET; addr.sin_addr.s_addr = INADDR_ANY; addr.sin_port = htons(port); bind(acceptorSocket, (struct sockaddr*)&addr, sizeof(struct sockaddr_in)); listen(acceptorSocket, SOMAXCONN); struct sockaddr_in address; socklen_t addressLen = sizeof(struct sockaddr_in); for(;;) { const int incomingSocket = accept(acceptorSocket, (struct sockaddr*)&address, &addressLen); if(incomingSocket == -1) { /* handle error ... */} else { //say socket to append outcoming messages at writing: const int currentFlags = fcntl(incomingSocket, F_GETFL, 0); if(currentFlags < 0) { /* handle error ... */ } if(fcntl(incomingSocket, F_SETFL, currentFlags | O_APPEND) == -1) { /* handle another error ... */ } //start reading: struct aiocb* readingAiocb = new struct aiocb; memset(readingAiocb, 0, sizeof(struct aiocb)); readingAiocb->aio_nbytes = MY_SOME_BUFFER_SIZE; readingAiocb->aio_fildes = socketDesc; readingAiocb->aio_buf = mySomeReadBuffer; readingAiocb->aio_sigevent.sigev_notify = SIGEV_THREAD; readingAiocb->aio_sigevent.sigev_value.sival_ptr = (void*)mySomeData; readingAiocb->aio_sigevent.sigev_notify_function = handle_read; if(aio_read(readingAiocb) != 0) { /* handle error ... */ } } } } //called at any time from server side: send(void* data, const size_t dataLength) { //... some thread-safety precautions not needed here ... const int cancellingResult = aio_cancel(socketDesc, readingAiocb); if(cancellingResult != AIO_CANCELED) { //this one happens ~80% of the time - embracing previous call to permanent while cycle does not help: if(cancellingResult == AIO_NOTCANCELED) { puts(strerror(aio_return(readingAiocb))); // "Operation now in progress" /* don't know what to do... */ } } //otherwise it's okay to send: else { aio_write(...); } }

    Read the article

  • How do I create/use a Fluent NHibernate convention to automap UInt32 properties to an SQL Server 200

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. I'm trying to have NHibernate generate the schema (via ExposeConfiguration). I'm happy to have NHibernate map it to anything sensible (e.g. bigint). Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. Most of it is based on this post. The error reported is: System.ArgumentException : Dialect does not support DbType.UInt32 I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • .NET Windows Service with timer stops responding

    - by Biri
    I have a windows service written in c#. It has a timer inside, which fires some functions on a regular basis. So the skeleton of my service: public partial class ArchiveService : ServiceBase { Timer tickTack; int interval = 10; ... protected override void OnStart(string[] args) { tickTack = new Timer(1000 * interval); tickTack.Elapsed += new ElapsedEventHandler(tickTack_Elapsed); tickTack.Start(); } protected override void OnStop() { tickTack.Stop(); } private void tickTack_Elapsed(object sender, ElapsedEventArgs e) { ... } } It works for some time (like 10-15 days) then it stops. I mean the service shows as running, but it does not do anything. I make some logging and the problem can be the timer, because after the interval it does not call the tickTack_Elapsed function. I was thinking about rewrite it without a timer, using an endless loop, which stops the processing for the amount of time I set up. This is also not an elegant solution and I think it can have some side effects regarding memory. The Timer is used from the System.Timers namespace, the environment is Windows 2003. I used this approach in two different services on different servers, but both is producing this behavior (this is why I thought that it is somehow connected to my code or the framework itself). Does somebody experienced this behavior? What can be wrong? Edit: I edited both services. One got a nice try-catch everywhere and more logging. The second got a timer-recreation on a regular basis. None of them stopped since them, so if this situation remains for another week, I will close this question. Thank you for everyone so far. Edit: I close this question because nothing happened. I mean I made some changes, but those changes are not really relevant in this matter and both services are running without any problem since then. Please mark it as "Closed for not relevant anymore".

    Read the article

  • C++ DLL creation for C# project - No functions exported

    - by Yeti
    I am working on a project that requires some image processing. The front end of the program is C# (cause the guys thought it is a lot simpler to make the UI in it). However, as the image processing part needs a lot of CPU juice I am making this part in C++. The idea is to link it to the C# project and just call a function from a DLL to make the image processing part and allow to the C# environment to process the data afterwards. Now the only problem is that it seems I am not able to make the DLL. Simply put the compiler refuses to put any function into the DLL that I compile. Because the project requires some development time testing I have created two projects into a C++ solution. One is for the Dll and another console application. The console project holds all the files and I just include the corresponding header into my DLL project file. I thought the compiler should take out the functions that I marked as to be exported and make the DLL from them. Nevertheless this does not happens. Here it is how I defined the function in the header: extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck); extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI, CvScalar &refHSVColorLow, CvScalar &refHSVColorHi ); Followed by the implementation in the cpp file: extern "C" __declspec(dllexport) CvPoint _stdcall RefPointFinder(IplImage* imgInput, CvRect &imgROI,&refHSVColorLow, CvScalar &refHSVColorHi ) { \\... return cvPoint((int)( M10/M00) + imgROI.x, (int)( M01/M00 ) + imgROI.y) ;} extern "C" __declspec(dllexport) void _stdcall RobotData(BYTE* buf, int** pToNewBackgroundImage, int* pToBackgroundImage, bool InitFlag, ObjectInformation* robot1, ObjectInformation* robot2, ObjectInformation* robot3, ObjectInformation* robot4, ObjectInformation* puck) { \\ ...}; And my main file for the DLL project looks like: #ifdef _MANAGED #pragma managed(push, off) #endif /// <summary> Include files. </summary> #include "..\ImageProcessingDebug\ImageProcessingTest.h" #include "..\ImageProcessingDebug\ImageProcessing.h" BOOL APIENTRY DllMain( HMODULE hModule, DWORD ul_reason_for_call, LPVOID lpReserved) { return TRUE; } #ifdef _MANAGED #pragma managed(pop) #endif Needless to say it does not work. A quick look with DLL export viewer 1.36 reveals that no function is inside the library. I don't get it. What I am doing wrong ? As side not I am using the C++ objects (and here it is the C++ DLL part) such as the vector. However, only for internal usage. These will not appear in the headers of either function as you can observe from the previous code snippets. Any ideas? Thx, Bernat

    Read the article

  • Best way to version control a WCF application with Git?

    - by Sam
    Suppose I have the following projects. The format is [ProjectName] : [ProjectDependency1, ProjectDependency2, etc.] // Service CoolLibrary WcfApp.Core WcfApp.Contracts WcfApp.Services : CoolLibrary, WcfApp.Core, WcfApp.Contracts // Clients CustomerX.App : WcfApp.Contracts CustomerY.App : WcfApp.Contracts CustomerZ.App : WcfApp.Contracts (On a side note, WcfApp.Contracts should not depend on WcfApp.Core, right? Else CustomerX.App would also depend on and thus be exposed to the service domain model?) (CoolLibrary is shared with other applications, so I can't just put it inside of WcfApp.Services.) All of this code is in-house. I was thinking of having 6 repositories for this. The format is [repository folder name] : [Projects included in repository.] 1. CoolLibrary.git : CoolLibrary 2. WcfApp.Contracts.git : WcfApp.Contracts 3. WcfApp.git : WcfApp.Core, WcfApp.Services 4. CustomerX.App.git : CustomerX.App 5. CustomerY.App.git : CustomerY.App 6. CustomerZ.App.git : CustomerZ.App How should I manage my project dependencies? I see three options: I could use binaries which I have to manually copy to each dependent repository. This would be easiest at the start, but my repositories would be a little bloated, and it'd become more tedious as I add more client apps for customers. I could import dependent code as submodules. This is what I will probably end up doing, although I keep reading on the web that submodules are a hassle. I also read that I can use something called the subtree merge strategy, but I am not sure how it is different from just cloning the repo into a subdirectory and adding the subdirectory to .gitignore. Is the difference that the subtree is recorded in the master repository, so (for example) cloning it from a different location will also pull the subtree? I know I asked a lot of questions in this post, but the most important two questions I have are: 1. Am I using the right number and layout of repositories? Should I use less or more? 2. Which of the three dependency management strategies would you recommend? Is there another strategy I haven't considered?

    Read the article

  • Marshalling non-Blittable Structs from C# to C++

    - by Greggo
    I'm in the process of rewriting an overengineered and unmaintainable chunk of my company's library code that interfaces between C# and C++. I've started looking into P/Invoke, but it seems like there's not much in the way of accessible help. We're passing a struct that contains various parameters and settings down to unmanaged codes, so we're defining identical structs. We don't need to change any of those parameters on the C++ side, but we do need to access them after the P/Invoked function has returned. My questions are: What is the best way to pass strings? Some are short (device id's which can be set by us), and some are file paths (which may contain Asian characters) Should I pass an IntPtr to the C# struct or should I just let the Marshaller take care of it by putting the struct type in the function signature? Should I be worried about any non-pointer datatypes like bools or enums (in other, related structs)? We have the treat warnings as errors flag set in C++ so we can't use the Microsoft extension for enums to force a datatype. Is P/Invoke actually the way to go? There was some Microsoft documentation about Implicit P/Invoke that said it was more type-safe and performant. For reference, here is one of the pairs of structs I've written so far: C++ /** Struct used for marshalling Scan parameters from managed to unmanaged code. */ struct ScanParameters { LPSTR deviceID; LPSTR spdClock; LPSTR spdStartTrigger; double spinRpm; double startRadius; double endRadius; double trackSpacing; UINT64 numTracks; UINT32 nominalSampleCount; double gainLimit; double sampleRate; double scanHeight; LPWSTR qmoPath; //includes filename LPWSTR qzpPath; //includes filename }; C# /// <summary> /// Struct used for marshalling scan parameters between managed and unmanaged code. /// </summary> [StructLayout(LayoutKind.Sequential)] public struct ScanParameters { [MarshalAs(UnmanagedType.LPStr)] public string deviceID; [MarshalAs(UnmanagedType.LPStr)] public string spdClock; [MarshalAs(UnmanagedType.LPStr)] public string spdStartTrigger; public Double spinRpm; public Double startRadius; public Double endRadius; public Double trackSpacing; public UInt64 numTracks; public UInt32 nominalSampleCount; public Double gainLimit; public Double sampleRate; public Double scanHeight; [MarshalAs(UnmanagedType.LPWStr)] public string qmoPath; [MarshalAs(UnmanagedType.LPWStr)] public string qzpPath; }

    Read the article

  • Daemonize() issues on Debian

    - by djTeller
    Hi, I'm currently writing a multi-process client and a multi-treaded server for some project i have. The server is a Daemon. In order to accomplish that, i'm using the following daemonize() code: static void daemonize(void) { pid_t pid, sid; /* already a daemon */ if ( getppid() == 1 ) return; /* Fork off the parent process */ pid = fork(); if (pid < 0) { exit(EXIT_FAILURE); } /* If we got a good PID, then we can exit the parent process. */ if (pid > 0) { exit(EXIT_SUCCESS); } /* At this point we are executing as the child process */ /* Change the file mode mask */ umask(0); /* Create a new SID for the child process */ sid = setsid(); if (sid < 0) { exit(EXIT_FAILURE); } /* Change the current working directory. This prevents the current directory from being locked; hence not being able to remove it. */ if ((chdir("/")) < 0) { exit(EXIT_FAILURE); } /* Redirect standard files to /dev/null */ freopen( "/dev/null", "r", stdin); freopen( "/dev/null", "w", stdout); freopen( "/dev/null", "w", stderr); } int main( int argc, char *argv[] ) { daemonize(); /* Now we are a daemon -- do the work for which we were paid */ return 0; } I have a strange side effect when testing the server on Debian (Ubuntu). The accept() function always fail to accept connections, the pid returned is -1 I have no idea what causing this, since in RedHat & CentOS it works well. When i remove the call to daemonize(), everything works well on Debian, when i add it back, same accept() error reproduce. I've been monitring the /proc//fd, everything looks good. Something in the daemonize() and the Debian release just doesn't seem to work. (Debian GNU/Linux 5.0, Linux 2.6.26-2-286 #1 SMP) Any idea what causing this? Thank you

    Read the article

  • Counting point size based on chart area during zooming/unzoomin

    - by Gacek
    Hi folks. I heave a quite simple task. I know (I suppose) it should be easy, but from the reasons I cannot understand, I try to solve it since 2 days and I don't know where I'm making the mistake. So, the problem is as follows: - we have a chart with some points - The chart starts with some known area and points have known size - we would like to "emulate" the zooming effect. So when we zoom to some part of the chart, the size of points is getting proportionally bigger. In other words, the smaller part of the chart we select, the bigger the point should get. So, we have something like that. We know this two parameters: initialArea; // Initial area - area of the whole chart, counted as width*height initialSize; // initial size of the points Now lets assume we are handling some kind of OnZoom event. We selected some part of the chart and would like to count the current size of the points float CountSizeOnZoom() { float currentArea = CountArea(...); // the area is counted for us. float currentSize = initialSize * initialArea / currentArea; return currentSize; } And it works. But the rate of change is too fast. In other words, the points are getting really big too soon. So I would like the currentSize to be invertly proportional to currentArea, but with some scaling coefficient. So I created the second function: float CountSizeOnZoom() { float currentArea = CountArea(...); % the area is counted for us. // Lets assume we want the size of points to change ten times slower, than area of the chart changed. float currentSize = initialSize + 0.1f* initialSize * ((initialArea / currentArea) -1); return currentSize; } Lets do some calculations in mind. if currentArea is smaller than initialArea, initialArea/currentArea > 1 and then we add "something" small and postive to initialSize. Checked, it works. Lets check what happens if we would un-zoom. currentArea will be equal to initialArea, so we would have 0 at the right side (1-1), so new size should be equal to initialSize. Right? Yeah. So lets check it... and it doesn't work. My question is: where is the mistake? Or maybe you have any ideas how to count this scaled size depending on current area in some other way?

    Read the article

  • Is there a programming language with be semantics close to English ?

    - by ivo s
    Most languages allow to 'tweek' to certain extend parts of the syntax (C++,C#) and/or semantics that you will be using in your code (Katahdin, lua). But I have not heard of a language that can just completely define how your code will look like. So isn't there some language which already exists that has such capabilities to override all syntax & define semantics ? Example of what I want to do is basically from the C# code below: foreach(Fruit fruit in Fruits) { if(fruit is Apple) { fruit.Price = fruit.Price/2; } } I want do be able to to write the above code in my perfect language like this: Check if any fruits are Macintosh apples and discount the price by 50%. The advantages that come to my mind looking from a coder's perspective in this "imaginary" language are: It's very clear what is going on (self descriptive) - it's plain English after all even kid would understand my program Hides all complexities which I have to write in C#. But why should I care to learn that if statements, arithmetic operators etc since there are already implemented The disadvantages that I see for a coder who will maintain this program are: Maybe you would express this program differently from me so you may not get all the information that I've expressed in my sentence Programs can be quite verbose and hard to debug but if possible to even proximate this type of syntax above maybe more people would start programming right? That would be amazing I think. I can go to work and just write an essay to draw a square on a winform like this: Create a form called MyGreetingForm. Draw a square with in the middle of MyGreetingFormwith a side of 100 points. In the middle of the square write "Hello! Click here to continue" in Arial font. In the above code the parser must basically guess that I want to use the unnamed square from the previous sentence, it'd be hard to write such a smart parser I guess, yet it's so simple what I want to do. If the user clicks on square in the middle of MyGreetingForm show MyMainForm. In the above code 'basically' the compiler must: 1)generate an event handler 2) check if there is any square in the middle of the form and if there is - 3) hide the form and show another form It looks very hard to do but it doesn't look impossible IMO to me at least approximate this (I can personally generate a parser to perform the 3 steps above np & it's basically the same that it has to do any way when you add even in c# a.MyEvent=+handler; so I don't see a problem here) so I'm thinking maybe somebody already did something like this ? Or is there some practical burden of complexity to create such a 'essay style' programming language which I can't see ? I mean what's the worse that can happen if the parser is not that good? - your program will crash so you have to re-word it:)

    Read the article

  • JQuery Datepicker Date highlight Issue

    - by Isola Olufemi
    I have an in-line date picker in which I want to highlight some dates based on array of strings from the server side. I found out the on load of the page with the datepicker, events the matches in the current month will not be highlighted. when I click the next month button the events on the next moth will be highlighted. What I discovered that i the matching only get highlighted when I click to the next month and not when I click back to the previous month. Below is my script: var actionCalDates = new Array(); function getDates(month, year) { $.ajax({ url: "/Index/GetAllAlerts", data: { month: month, year: year }, success: function (result) { var date = new Date(); var i = new Number(date.getMonth()); i += 1; actionCalDates = result.split(","); } }); } function getTitle(ar, d) { var result = ""; for (var i = 0; i < ar.length; i++) { if (ar[i].indexOf(d) != -1) { var e = actionCalDates[i].split(";"); result += e[0] + "\n"; } } return result; } $('#calendar').datepicker({ numberOfMonths: [1, 1], showCurrentAtPos: 0, dateFormat: 'dd/mm/y', beforeShowDay: function (thedate) { var theday = thedate.getDate(); var x = new Number(thedate.getMonth()); x += 1; var date = thedate.getDate() + "/" + x + "/" + thedate.getFullYear(); getDates(x, thedate.getFullYear()); for (var i = 0; i < actionCalDates.length; i++) { var entry = actionCalDates[i].split(";"); if (date == entry[1]) { return [true, "highlight", getTitle(actionCalDates, date)]; } } return [true, "", ""]; }, onChangeMonthYear: function (year, month, inst) { getDates(month, year); }, onSelect: function (d, instance) { $.ajax({ url: '/Index/AlertConvertDate', datatype: 'text', data: { dateString: d }, error: function (xhr, ajaxOptions, thrownError) { alert(xhr.statusText); alert(thrownError); }, success: function (data) { window.SetHomeContent(data); } }); } }); Please can someone point out where I went wrong? Thank you all.

    Read the article

  • How do I create/use a Fluent NHibernate convention to map UInt32 properties to an SQL Server 2008 da

    - by dommer
    I'm trying to use a convention to map UInt32 properties to a SQL Server 2008 database. I don't seem to be able to create a solution based on existing web sources, due to updates in the way Fluent NHibernate works - i.e. examples are out of date. Here's my code as it currently stands (which, when I try to expose the schema, fails due to SQL Server not supporting UInt32). Apologies for the code being a little long, but I'm not 100% sure what is relevant to the problem, so I'm erring on the side of caution. I think I'll need a relatively comprehensive example, as I don't seem to be able to pull the pieces together into a working solution, at present. FluentConfiguration configuration = Fluently.Configure() .Database(MsSqlConfiguration.MsSql2008 .ConnectionString(connectionString)) .Mappings(mapping => mapping.AutoMappings.Add( AutoMap.AssemblyOf<Product>() .Conventions.Add<UInt32UserTypeConvention>())); configuration.ExposeConfiguration(x => new SchemaExport(x).Create(false, true)); namespace NHibernateTest { public class UInt32UserTypeConvention : UserTypeConvention<UInt32UserType> { // Empty. } } namespace NHibernateTest { public class UInt32UserType : IUserType { // Public properties. public bool IsMutable { get { return false; } } public Type ReturnedType { get { return typeof(UInt32); } } public SqlType[] SqlTypes { get { return new SqlType[] { SqlTypeFactory.Int32 }; } } // Public methods. public object Assemble(object cached, object owner) { return cached; } public object DeepCopy(object value) { return value; } public object Disassemble(object value) { return value; } public new bool Equals(object x, object y) { return (x != null && x.Equals(y)); } public int GetHashCode(object x) { return x.GetHashCode(); } public object NullSafeGet(IDataReader rs, string[] names, object owner) { int? i = (int?)NHibernateUtil.Int32.NullSafeGet(rs, names[0]); return (UInt32?)i; } public void NullSafeSet(IDbCommand cmd, object value, int index) { UInt32? u = (UInt32?)value; int? i = (Int32?)u; NHibernateUtil.Int32.NullSafeSet(cmd, i, index); } public object Replace(object original, object target, object owner) { return original; } } }

    Read the article

  • Define Javascript slider hit/rollover area

    - by Rob
    Hey, Im having an issue defining the hit area for a javascript sliding element. See example: http://www.warface.co.uk/clients/warface.co.uk/ Please slide over the grey box on the right side to reveal the button, although this works I would only like for the slider to only be triggered by rolling over the red block. CSS .slidingtwitter { /* -- This is the hit area -- */ background: #ccc; width:255px; height:55px; overflow: hidden; top:50%; right: 0px; /* -- This is the sliding start point -- */ position: fixed; font-family: Gotham, Sans-Serif; z-index: 50; } .slidingtwitter.right { right:0px; } .slidingtwitter .caption { /* -- This is the sliding area -- */ background: #fff; position: absolute; width:260px; height:55px; right: -205px; /* -- This is the sliding start point -- */ } .slidingtwitter a { color: #484848; font-size: 20px; text-transform: uppercase; } .slidingtwitter a:hover { color: black; } .slidingtwitter .smaller { font-size: 12px; font-family: Gotham Medium; } .twitterblock { background: #f35555 url("styles/images/button_twitter.png") no-repeat 14px 15px ; width:35px; height:35px; padding:10px; float:left; display:block; } .slidingtwitter .followme { background: url("styles/images/button_arrowheadthin.jpg")no-repeat right 0; height:35px; display:block; float:left; line-height:14px; width:140px; margin:10px 0px 0px 14px; padding-top:6px; padding-right: 40px; } JS $('.slidingtwitter').hover(function(){ $(".slide", this).stop().animate({right:'0px'},{queue:false,duration:400}); //Position on rollover },function() { $(".slide", this).stop().animate({right:'-205px'},{queue:false,duration:400}); //Position on rollout }); Any suggestions would be much appreciated.

    Read the article

  • How to implement a caching model without violating MVC pattern?

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC 3 (Razor) Web Application, with a particular page which is highly database intensive, and user experience is of the upmost priority. Thus, i am introducing caching on this particular page. I'm trying to figure out a way to implement this caching pattern whilst keeping my controller thin, like it currently is without caching: public PartialViewResult GetLocationStuff(SearchPreferences searchPreferences) { var results = _locationService.FindStuffByCriteria(searchPreferences); return PartialView("SearchResults", results); } As you can see, the controller is very thin, as it should be. It doesn't care about how/where it is getting it's info from - that is the job of the service. A couple of notes on the flow of control: Controllers get DI'ed a particular Service, depending on it's area. In this example, this controller get's a LocationService Services call through to an IQueryable<T> Repository and materialize results into T or ICollection<T>. How i want to implement caching: I can't use Output Caching - for a few reasons. First of all, this action method is invoked from the client-side (jQuery/AJAX), via [HttpPost], which according to HTTP standards should not be cached as a request. Secondly, i don't want to cache purely based on the HTTP request arguments - the cache logic is a lot more complicated than that - there is actually two-level caching going on. As i hint to above, i need to use regular data-caching, e.g Cache["somekey"] = someObj;. I don't want to implement a generic caching mechanism where all calls via the service go through the cache first - i only want caching on this particular action method. First thought's would tell me to create another service (which inherits LocationService), and provide the caching workflow there (check cache first, if not there call db, add to cache, return result). That has two problems: The services are basic Class Libraries - no references to anything extra. I would need to add a reference to System.Web here. I would have to access the HTTP Context outside of the web application, which is considered bad practice, not only for testability, but in general - right? I also thought about using the Models folder in the Web Application (which i currently use only for ViewModels), but having a cache service in a models folder just doesn't sound right. So - any ideas? Is there a MVC-specific thing (like Action Filter's, for example) i can use here? General advice/tips would be greatly appreciated.

    Read the article

  • CGAffineTransformMakeRotation goes the other way after 180 degrees (-3.14)

    - by TheKillerDev
    So, i am trying to do a very simple disc rotation (2d), according to the user touch on it, just like a DJ or something. It is working, but there is a problem, after certain amount of rotation, it starts going backwards, this amount is after 180 degrees or as i saw in while logging the angle, -3.14 (pi). I was wondering, how can i achieve a infinite loop, i mean, the user can keep rotating and rotating to any side, just sliding his finger? Also a second question is, is there any way to speed up the rotation? Here is my code right now: #import <UIKit/UIKit.h> @interface Draggable : UIImageView { CGPoint firstLoc; UILabel * fred; double angle; } @property (assign) CGPoint firstLoc; @property (retain) UILabel * fred; @end @implementation Draggable @synthesize fred, firstLoc; - (id)initWithFrame:(CGRect)frame { self = [super initWithFrame:frame]; angle = 0; if (self) { // Initialization code } return self; } -(void)handleObject:(NSSet *)touches withEvent:(UIEvent *)event isLast:(BOOL)lst { UITouch *touch =[[[event allTouches] allObjects] lastObject]; CGPoint curLoc = [touch locationInView:self]; float fromAngle = atan2( firstLoc.y-self.center.y, firstLoc.x-self.center.x ); float toAngle = atan2( curLoc.y-(self.center.y+10), curLoc.x-(self.center.x+10)); float newAngle = angle + (toAngle - fromAngle); NSLog(@"%f",newAngle); CGAffineTransform cgaRotate = CGAffineTransformMakeRotation(newAngle); self.transform = cgaRotate; if (lst) angle = newAngle; } -(void)touchesBegan:(NSSet *)touches withEvent:(UIEvent *)event { UITouch *touch =[[[event allTouches] allObjects] lastObject]; firstLoc = [touch locationInView:self]; }; -(void) touchesMoved:(NSSet *)touches withEvent:(UIEvent *)event { [self handleObject:touches withEvent:event isLast:NO]; }; -(void) touchesEnded:(NSSet *)touches withEvent:(UIEvent *)event { [self handleObject:touches withEvent:event isLast:YES]; } @end And in the ViewController: UIImage *tmpImage = [UIImage imageNamed:@"theDisc.png"]; CGRect cellRectangle; cellRectangle = CGRectMake(-1,self.view.frame.size.height,tmpImage.size.width ,tmpImage.size.height ); dragger = [[Draggable alloc] initWithFrame:cellRectangle]; [dragger setImage:tmpImage]; [dragger setUserInteractionEnabled:YES]; dragger.layer.anchorPoint = CGPointMake(.5,.5); [self.view addSubview:dragger]; I am open to new/cleaner/more correct ways of doing this too. Thanks in advance.

    Read the article

< Previous Page | 411 412 413 414 415 416 417 418 419 420 421 422  | Next Page >