Search Results

Search found 4759 results on 191 pages for 'depth buffer'.

Page 42/191 | < Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >

  • Delphi - Using DeviceIoControl passing IOCTL_DISK_GET_LENGTH_INFO to get flash media physical size (Not Partition)

    - by SuicideClutchX2
    Alright this is the result of a couple of other questions. It appears I was doing something wrong with the suggestions and at this point have come up with an error when using the suggested API to get the media size. Those new to my problem I am working at the physical disk level, not within the confines of a partition or file system. Here is the pastebin code for the main unit (Delphi 2009) - http://clutchx2.pastebin.com/iMnq8kSx Here is the application source and executable with a form built to output the status of whats going on - http://www.mediafire.com/?js8e6ci8zrjq0de Its probably easier to use the download, unless your just looking for problems within the code. I will also paste the code here. unit Main; interface uses Windows, Messages, SysUtils, Variants, Classes, Graphics, Controls, Forms, Dialogs, StdCtrls; type TfrmMain = class(TForm) edtDrive: TEdit; lblDrive: TLabel; btnMethod1: TButton; btnMethod2: TButton; lblSpace: TLabel; edtSpace: TEdit; lblFail: TLabel; edtFail: TEdit; lblError: TLabel; edtError: TEdit; procedure btnMethod1Click(Sender: TObject); private { Private declarations } public { Public declarations } end; TDiskExtent = record DiskNumber: Cardinal; StartingOffset: Int64; ExtentLength: Int64; end; DISK_EXTENT = TDiskExtent; PDiskExtent = ^TDiskExtent; TVolumeDiskExtents = record NumberOfDiskExtents: Cardinal; Extents: array[0..0] of TDiskExtent; end; VOLUME_DISK_EXTENTS = TVolumeDiskExtents; PVolumeDiskExtents = ^TVolumeDiskExtents; var frmMain: TfrmMain; const FILE_DEVICE_DISK = $00000007; METHOD_BUFFERED = 0; FILE_ANY_ACCESS = 0; IOCTL_DISK_BASE = FILE_DEVICE_DISK; IOCTL_VOLUME_BASE = DWORD('V'); IOCTL_DISK_GET_LENGTH_INFO = $80070017; IOCTL_VOLUME_GET_VOLUME_DISK_EXTENTS = ((IOCTL_VOLUME_BASE shl 16) or (FILE_ANY_ACCESS shl 14) or (0 shl 2) or METHOD_BUFFERED); implementation {$R *.dfm} function GetLD(Drive: Char): Cardinal; var Buffer : String; begin Buffer := Format('\\.\%s:',[Drive]); Result := CreateFile(PChar(Buffer),GENERIC_READ Or GENERIC_WRITE,FILE_SHARE_READ,nil,OPEN_EXISTING,0,0); If Result = INVALID_HANDLE_VALUE Then begin Result := CreateFile(PChar(Buffer),GENERIC_READ,FILE_SHARE_READ,nil,OPEN_EXISTING,0,0); end; end; function GetPD(Drive: Byte): Cardinal; var Buffer : String; begin If Drive = 0 Then begin Result := INVALID_HANDLE_VALUE; Exit; end; Buffer := Format('\\.\PHYSICALDRIVE%d',[Drive]); Result := CreateFile(PChar(Buffer),GENERIC_READ Or GENERIC_WRITE,FILE_SHARE_READ,nil,OPEN_EXISTING,0,0); If Result = INVALID_HANDLE_VALUE Then begin Result := CreateFile(PChar(Buffer),GENERIC_READ,FILE_SHARE_READ,nil,OPEN_EXISTING,0,0); end; end; function GetPhysicalDiskNumber(Drive: Char): Byte; var LD : DWORD; DiskExtents : PVolumeDiskExtents; DiskExtent : TDiskExtent; BytesReturned : Cardinal; begin Result := 0; LD := GetLD(Drive); If LD = INVALID_HANDLE_VALUE Then Exit; Try DiskExtents := AllocMem(Max_Path); DeviceIOControl(LD,IOCTL_VOLUME_GET_VOLUME_DISK_EXTENTS,nil,0,DiskExtents,Max_Path,BytesReturned,nil); If DiskExtents^.NumberOfDiskExtents > 0 Then begin DiskExtent := DiskExtents^.Extents[0]; Result := DiskExtent.DiskNumber; end; Finally CloseHandle(LD); end; end; procedure TfrmMain.btnMethod1Click(Sender: TObject); var PD : DWORD; CardSize: Int64; BytesReturned: DWORD; CallSuccess: Boolean; begin PD := GetPD(GetPhysicalDiskNumber(edtDrive.Text[1])); If PD = INVALID_HANDLE_VALUE Then Begin ShowMessage('Invalid Physical Disk Handle'); Exit; End; CallSuccess := DeviceIoControl(PD, IOCTL_DISK_GET_LENGTH_INFO, nil, 0, @CardSize, SizeOf(CardSize), BytesReturned, nil); if not CallSuccess then begin edtError.Text := IntToStr(GetLastError()); edtFail.Text := 'True'; end else edtFail.Text := 'False'; CloseHandle(PD); end; end. I placed a second method button on the form so I can write a different set of code into the app if I feel like it. Only minimal error handling and safeguards are there is nothing that wasn't necessary for debugging this via source. I tried this on a Sony Memory Stick using a PSP as the reader because I cant find the adapter for using a duo in my machine. The target is an MS and half of my users use a PSP for a reader half dont. However this should work fine on SD cards and that is a secondary target for my work as well. I tried this on a usb memory card reader and several SD cards. Now that I have fixed my attempt I get an error returned. 50 ERROR_NOT_SUPPORTED The request is not supported. I have found an application that uses this API as well as alot of related functions for what I am trying todo. I am getting ready to look into it the application is called DriveImage and its source is here - http://sourceforge.net/projects/diskimage/ The only thing I have really noticed from that application is there use of TFileStream and using that to get a handle on the physical disk.

    Read the article

  • Using libcurl to create a valid POST

    - by Haraldo
    static int get( const char * cURL, const char * cParam ) { CURL *handle; CURLcode result; std::string buffer; char errorBuffer[CURL_ERROR_SIZE]; //struct curl_slist *headers = NULL; //headers = curl_slist_append(headers, "Content-Type: Multipart/Related"); //headers = curl_slist_append(headers, "type: text/xml"); // Create our curl handle handle = curl_easy_init(); if( handle ) { curl_easy_setopt(handle, CURLOPT_ERRORBUFFER, errorBuffer); //curl_easy_setopt(handle, CURLOPT_HEADER, 0); //curl_easy_setopt(handle, CURLOPT_HTTPHEADER, headers); curl_easy_setopt(handle, CURLOPT_POST, 1); curl_easy_setopt(handle, CURLOPT_POSTFIELDS, cParam); curl_easy_setopt(handle, CURLOPT_POSTFIELDSIZE, strlen(cParam)); curl_easy_setopt(handle, CURLOPT_FOLLOWLOCATION, 1); curl_easy_setopt(handle, CURLOPT_WRITEFUNCTION, Request::writer); curl_easy_setopt(handle, CURLOPT_WRITEDATA, &buffer); curl_easy_setopt(handle, CURLOPT_USERAGENT, "libcurl-agent/1.0"); curl_easy_setopt(handle, CURLOPT_URL, cURL); result = curl_easy_perform(handle); curl_easy_cleanup(handle); } if( result == CURLE_OK ) { return atoi( buffer.c_str() ); } return 0; } Hi there, first of all I'm having trouble debugging this in visual studio express 2008 so I'm unsure what buffer.c_str() might actually be returning but I am outputting 1 or 0 to the web page being posted to. Therefore I'm expecting the buffer to be one or the other, however I seem to only be returning 0 or equivalent. Does the code above look like it will return what I expect or should my variable types be different? The conversion using "atoi" may be an issue. Any thought would be much appreciated.

    Read the article

  • Read from file hexadecimal number and change their representation style

    - by user576844
    I want to write a program changing the notation of all hexadecimal numbers found in an assembly source file from traditional (h) to C-style (0x). I have started the coding part but am not sure how can I detect the hexadecimal numbers and eventually change the style and save it back in the file... I have started writing the program.. ## Mips program - .data fin: .ascii "" # filename for input msg0: .asciiz "aaaa" msg1: .asciiz "Please enter the input file name:" buffer: .asciiz "" .text #----------------------- li $v0, 4 la $a0, msg1 syscall li $v0, 8 la $a0, fin li $a1, 21 syscall jal fileRead #read from file move $s1, $v0 #$t0 = total number of bytes li $t0, 0 # Loop counter loop: bge $t0, $s1, end #if end of file reached OR if there is an error in the file lb $t5, buffer($t0) #load next byte from file jal checkhexa #check for hexadecimal numbers addi $t0, $t0, 1 #increment loop counter j loop end: jal output jal fileClose li $v0, 10 syscall fileRead: # Open file for reading li $v0, 13 # system call for open file la $a0, fin # input file name li $a1, 0 # flag for reading li $a2, 0 # mode is ignored syscall # open a file move $s0, $v0 # save the file descriptor # reading from file just opened li $v0, 14 # system call for reading from file move $a0, $s0 # file descriptor la $a1, buffer # address of buffer from which to read li $a2, 100000 # hardcoded buffer length syscall # read from file jr $ra Any help would be appreciated.

    Read the article

  • Strcpy and malloc issues

    - by mrblippy
    Hi, i am having trouble getting a method relating to a linked list working, i get the errors: assignment makes pointer from integer without a cast and passing argument 1 of âstrcpyâ makes pointer from integer without a cast. i have tried to include all the relevant code, but let me know if you need more info. thanks. struct unit { char code[5]; char *name; node_ptr students; }; typedef struct node *node_ptr; struct node { int student_id; char *studentname; node_ptr next; }; void enrol_student(struct unit u[], int n) { int i, p; int student_id = 0; char code_to_enrol[7]; char buffer[100]; node_ptr studentslist; scanf("%s\n", code_to_enrol); for(i=0; i <= n; i++) { studentslist = u[i].students; if(strcmp(u[i].code ,code_to_enrol)<=0) { scanf("enter student details %d %s\n", &studentID, buffer); p = (char *) malloc (strlen(buffer)+1); strcpy(p, buffer); insert_in_order(student_id, buffer, studentslist); } } } void insert_in_order(int n, char *i, node_ptr list) { node_ptr before = list; node_ptr students = (node_ptr) malloc(sizeof(struct node)); students->ID = n; students->name = *i; while(before->next && (before->next->ID < n)) { before = before->next; } students->next = before->next; before->next = students; }

    Read the article

  • Writing file from HttpWebRequest periodically vs. after download finishes?

    - by WB3000
    Right now I am using this code to download files (with a Range header). Most of the files are large, and it is running 99% of CPU currently as the file downloads. Is there any way that the file can be written periodically so that it does not remain in RAM constantly? private byte[] GetWebPageContent(string url, long start, long finish) { byte[] result = new byte[finish]; HttpWebRequest request; request = WebRequest.Create(url) as HttpWebRequest; //request.Headers.Add("Range", "bytes=" + start + "-" + finish); request.AddRange((int)start, (int)finish); using (WebResponse response = request.GetResponse()) { return ReadFully(response.GetResponseStream()); } } public static byte[] ReadFully(Stream stream) { byte[] buffer = new byte[32768]; using (MemoryStream ms = new MemoryStream()) { while (true) { int read = stream.Read(buffer, 0, buffer.Length); if (read <= 0) return ms.ToArray(); ms.Write(buffer, 0, read); } } }

    Read the article

  • java.io.FileNotFoundException (Permission denied) When trying to write to the Android sdcard

    - by joefischer1
    I am trying to select an image file from the photo gallery and write to the sdcard. Below is the code that results in an exception. It appears to throw this exception when trying to create the FileOutputStream. I have the following line added to the manifest file nested inside the application element. I can't find a solution to the problem: <uses-permission android:name="android.permission.WRITE_EXTERNAL_STORAGE" /> public boolean saveSelectedImage( Uri selectedImage, int imageGroup, int imageNumber ) { boolean exception = false; InputStream input = null; OutputStream output = null; if( externalStorageIsWritable() ) { try { ContentResolver content = ctx.getContentResolver(); input = content.openInputStream( selectedImage ); if(input != null) Log.v( CLASS_NAME, "Input Stream Opened successfully"); File outFile = null; File root = Environment.getExternalStorageDirectory( ); if(root == null) Log.v(CLASS_NAME, "FAILED TO RETRIEVE DIRECTORY"); else Log.v(CLASS_NAME, "ROOT DIRECTORY is:"+root.toString()); output = new FileOutputStream( root+"/Image"+ imageGroup + "_" + imageNumber + ".png" ); if(output != null) Log.e( CLASS_NAME, "Output Stream Opened successfully"); // output = new FileOutputStream // ("/sdcard/Image"+imageGroup+"_"+imageNumber+".png"); byte[] buffer = new byte[1000]; int bytesRead = 0; while ( ( bytesRead = input.read( buffer, 0, buffer.length ) ) >= 0 ) { output.write( buffer, 0, buffer.length ); } } catch ( Exception e ) { Log.e( CLASS_NAME, "Exception occurred while moving image: "); e.printStackTrace(); exception = true; } finally { // if(input != null)input.close(); // if(output != null)output.close(); // if (exception ) return false; } return true; } else return false; }

    Read the article

  • Confused about definition of a 'median' when constructing a kd-Tree

    - by user352636
    Hi there. Im trying to build a kd-tree for searching through a set of points, but am getting confused about the use of 'median' in the wikipedia article. For ease of use, the wikipedia article states the pseudo-code of kd-tree construction as: function kdtree (list of points pointList, int depth) { if pointList is empty return nil; else { // Select axis based on depth so that axis cycles through all valid values var int axis := depth mod k; // Sort point list and choose median as pivot element select median by axis from pointList; // Create node and construct subtrees var tree_node node; node.location := median; node.leftChild := kdtree(points in pointList before median, depth+1); node.rightChild := kdtree(points in pointList after median, depth+1); return node; } } I'm getting confused about the "select median..." line, simply because I'm not quite sure what is the 'right' way to apply a median here. As far as I know, the median of an odd-sized (sorted) list of numbers is the middle element (aka, for a list of 5 things, element number 3, or index 2 in a standard zero-based array), and the median of an even-sized array is the sum of the two 'middle' elements divided by two (aka, for a list of 6 things, the median is the sum of elements 3 and 4 - or 2 and 3, if zero-indexed - divided by 2.). However, surely that definition does not work here as we are working with a distinct set of points? How then does one choose the correct median for an even-sized list of numbers, especially for a length 2 list? I appreciate any and all help, thanks! -Stephen

    Read the article

  • Python IOError: Not a gzipped file (Gzip and Blowfish Encrypt/Compress)

    - by notbad.jpeg
    I'm having some problems with python's built-in library gzip. Looked through almost every other stack question about it, and none of them seem to work. MY PROBLEM IS THAT WHEN I TRY TO DECOMPRESS I GET THE IOError I'm Getting: Traceback (most recent call last): File "mymodule.py", line 61, in return gz.read() File "/usr/lib/python2.7/gzip.py", line 245, readself._read(readsize) File "/usr/lib/python2.7/gzip.py", line 287, in _readself._read_gzip_header() File "/usr/lib/python2.7/gzip.py", line 181, in _read_gzip_header raise IOError, 'Not a gzipped file'IOError: Not a gzipped file This is my code to send it over SMB, it might not make sense why i do things, but it's normally in a while loop and memory efficient, I just simplified it. buffer = cStringIO.StringIO(output) #output is from a subprocess call small_buffer = cStringIO.StringIO() small_string = buffer.read() #need a string to write to buffer gzip_obj = gzip.GzipFile(fileobj=small_buffer,compresslevel=6, mode='wb') gzip_obj.write(small_string) compressed_str = small_buffer.getvalue() blowfish = Blowfish.new('abcd', Blowfish.MODE_ECB) remainder = '|'*(8 - (len(compressed_str) % 8)) compressed_str += remainder encrypted = blowfish.encrypt(compressed_str) #i send it over smb, then retrieve it later Then this is the code that retrieves it: #buffer is a cStringIO object filled with data from smb retrieval decrypter = Blowfish.new('abcd', Blowfish.MODE_ECB) value = buffer.getvalue() decrypted = decrypter.decrypt(value) buff = cStringIO.StringIO(decrypted) buff.seek(0) gz = gzip.GzipFile(fileobj=buff) return gz.read() Here's the problem return gz.read()

    Read the article

  • Retrieving dll version info via Win32 - VerQueryValue(...) crashes under Win7 x64

    - by user256890
    The respected open source .NET wrapper implementation (SharpBITS) of Windows BITS services fails identifying the underlying BITS version under Win7 x64. Here is the source code that fails. NativeMethods are native Win32 calls wrapped by .NET methods and decorated via DllImport attribute. private static BitsVersion GetBitsVersion() { try { string fileName = Path.Combine( System.Environment.SystemDirectory, "qmgr.dll"); int handle = 0; int size = NativeMethods.GetFileVersionInfoSize(fileName, out handle); if (size == 0) return BitsVersion.Bits0_0; byte[] buffer = new byte[size]; if (!NativeMethods.GetFileVersionInfo(fileName, handle, size, buffer)) { return BitsVersion.Bits0_0; } IntPtr subBlock = IntPtr.Zero; uint len = 0; if (!NativeMethods.VerQueryValue(buffer, @"\VarFileInfo\Translation", out subBlock, out len)) { return BitsVersion.Bits0_0; } int block1 = Marshal.ReadInt16(subBlock); int block2 = Marshal.ReadInt16((IntPtr)((int)subBlock + 2 )); string spv = string.Format( @"\StringFileInfo\{0:X4}{1:X4}\ProductVersion", block1, block2); string versionInfo; if (!NativeMethods.VerQueryValue(buffer, spv, out versionInfo, out len)) { return BitsVersion.Bits0_0; } ... The implementation follows the MSDN instructions by the letter. Still during the second VerQueryValue(...) call, the application crashes and kills the debug session without hesitation. Just a little more debug info right before the crash: spv = "\StringFileInfo\040904B0\ProductVersion" buffer = byte[1900] - full with binary data block1 = 1033 block2 = 1200 I looked at the targeted "C:\Windows\System32\qmgr.dll" file (The implementation of BITS) via Windows. It says that the Product Version is 7.5.7600.16385. Instead of crashing, this value should return in the verionInfo string. Any advice?

    Read the article

  • Reading a child process's /proc/pid/mem file from the parent

    - by Amittai Aviram
    In the program below, I am trying to cause the following to happen: Process A assigns a value to a stack variable a. Process A (parent) creates process B (child) with PID child_pid. Process B calls function func1, passing a pointer to a. Process B changes the value of variable a through the pointer. Process B opens its /proc/self/mem file, seeks to the page containing a, and prints the new value of a. Process A (at the same time) opens /proc/child_pid/mem, seeks to the right page, and prints the new value of a. The problem is that, in step 6, the parent only sees the old value of a in /proc/child_pid/mem, while the child can indeed see the new value in its /proc/self/mem. Why is this the case? Is there any way that I can get the parent to to see the child's changes to its address space through the /proc filesystem? #include <fcntl.h> #include <stdbool.h> #include <stdio.h> #include <stdlib.h> #include <string.h> #include <sys/types.h> #include <sys/stat.h> #include <sys/wait.h> #include <unistd.h> #define PAGE_SIZE 0x1000 #define LOG_PAGE_SIZE 0xc #define PAGE_ROUND_DOWN(v) ((v) & (~(PAGE_SIZE - 1))) #define PAGE_ROUND_UP(v) (((v) + PAGE_SIZE - 1) & (~(PAGE_SIZE - 1))) #define OFFSET_IN_PAGE(v) ((v) & (PAGE_SIZE - 1)) # if defined ARCH && ARCH == 32 #define BP "ebp" #define SP "esp" #else #define BP "rbp" #define SP "rsp" #endif typedef struct arg_t { int a; } arg_t; void func1(void * data) { arg_t * arg_ptr = (arg_t *)data; printf("func1: old value: %d\n", arg_ptr->a); arg_ptr->a = 53; printf("func1: address: %p\n", &arg_ptr->a); printf("func1: new value: %d\n", arg_ptr->a); } void expore_proc_mem(void (*fn)(void *), void * data) { off_t frame_pointer, stack_start; char buffer[PAGE_SIZE]; const char * path = "/proc/self/mem"; int child_pid, status; int parent_to_child[2]; int child_to_parent[2]; arg_t * arg_ptr; off_t child_offset; asm volatile ("mov %%"BP", %0" : "=m" (frame_pointer)); stack_start = PAGE_ROUND_DOWN(frame_pointer); printf("Stack_start: %lx\n", (unsigned long)stack_start); arg_ptr = (arg_t *)data; child_offset = OFFSET_IN_PAGE((off_t)&arg_ptr->a); printf("Address of arg_ptr->a: %p\n", &arg_ptr->a); pipe(parent_to_child); pipe(child_to_parent); bool msg; int child_mem_fd; char child_path[0x20]; child_pid = fork(); if (child_pid == -1) { perror("fork"); exit(EXIT_FAILURE); } if (!child_pid) { close(child_to_parent[0]); close(parent_to_child[1]); printf("CHILD (pid %d, parent pid %d).\n", getpid(), getppid()); fn(data); msg = true; write(child_to_parent[1], &msg, 1); child_mem_fd = open("/proc/self/mem", O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("CHILD: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("CHILD: new value %d\n", *(int *)(buffer + child_offset)); read(parent_to_child[0], &msg, 1); exit(EXIT_SUCCESS); } else { printf("PARENT (pid %d, child pid %d)\n", getpid(), child_pid); printf("PARENT: child_offset: %lx\n", child_offset); read(child_to_parent[0], &msg, 1); printf("PARENT: message from child: %d\n", msg); snprintf(child_path, 0x20, "/proc/%d/mem", child_pid); printf("PARENT: child_path: %s\n", child_path); child_mem_fd = open(path, O_RDONLY); if (child_mem_fd == -1) { perror("open (child)"); exit(EXIT_FAILURE); } printf("PARENT: child_mem_fd: %d\n", child_mem_fd); if (lseek(child_mem_fd, stack_start, SEEK_SET) == (off_t)-1) { perror("lseek"); exit(EXIT_FAILURE); } if (read(child_mem_fd, buffer, sizeof(buffer)) != sizeof(buffer)) { perror("read"); exit(EXIT_FAILURE); } printf("PARENT: new value %d\n", *(int *)(buffer + child_offset)); close(child_mem_fd); printf("ENDING CHILD PROCESS.\n"); write(parent_to_child[1], &msg, 1); if (waitpid(child_pid, &status, 0) == -1) { perror("waitpid"); exit(EXIT_FAILURE); } } } int main(void) { arg_t arg; arg.a = 42; printf("In main: address of arg.a: %p\n", &arg.a); explore_proc_mem(&func1, &arg.a); return EXIT_SUCCESS; } This program produces the output below. Notice that the value of a (boldfaced) differs between parent's and child's reading of the /proc/child_pid/mem file. In main: address of arg.a: 0x7ffffe1964f0 Stack_start: 7ffffe196000 Address of arg_ptr-a: 0x7ffffe1964f0 PARENT (pid 20376, child pid 20377) PARENT: child_offset: 4f0 CHILD (pid 20377, parent pid 20376). func1: old value: 42 func1: address: 0x7ffffe1964f0 func1: new value: 53 PARENT: message from child: 1 CHILD: child_mem_fd: 4 PARENT: child_path: /proc/20377/mem CHILD: new value 53 PARENT: child_mem_fd: 7 PARENT: new value 42 ENDING CHILD PROCESS.

    Read the article

  • How do implement a breadth first traversal?

    - by not looking for answer
    //This is what I have. I thought pre-order was the same and mixed it up with depth first! import java.util.LinkedList; import java.util.Queue; public class Exercise25_1 { public static void main(String[] args) { BinaryTree tree = new BinaryTree(new Integer[] {10, 5, 15, 12, 4, 8 }); System.out.print("\nInorder: "); tree.inorder(); System.out.print("\nPreorder: "); tree.preorder(); System.out.print("\nPostorder: "); tree.postorder(); //call the breadth method to test it System.out.print("\nBreadthFirst:"); tree.breadth(); } } class BinaryTree { private TreeNode root; /** Create a default binary tree */ public BinaryTree() { } /** Create a binary tree from an array of objects */ public BinaryTree(Object[] objects) { for (int i = 0; i < objects.length; i++) { insert(objects[i]); } } /** Search element o in this binary tree */ public boolean search(Object o) { return search(o, root); } public boolean search(Object o, TreeNode root) { if (root == null) { return false; } if (root.element.equals(o)) { return true; } else { return search(o, root.left) || search(o, root.right); } } /** Return the number of nodes in this binary tree */ public int size() { return size(root); } public int size(TreeNode root) { if (root == null) { return 0; } else { return 1 + size(root.left) + size(root.right); } } /** Return the depth of this binary tree. Depth is the * number of the nodes in the longest path of the tree */ public int depth() { return depth(root); } public int depth(TreeNode root) { if (root == null) { return 0; } else { return 1 + Math.max(depth(root.left), depth(root.right)); } } /** Insert element o into the binary tree * Return true if the element is inserted successfully */ public boolean insert(Object o) { if (root == null) { root = new TreeNode(o); // Create a new root } else { // Locate the parent node TreeNode parent = null; TreeNode current = root; while (current != null) { if (((Comparable)o).compareTo(current.element) < 0) { parent = current; current = current.left; } else if (((Comparable)o).compareTo(current.element) > 0) { parent = current; current = current.right; } else { return false; // Duplicate node not inserted } } // Create the new node and attach it to the parent node if (((Comparable)o).compareTo(parent.element) < 0) { parent.left = new TreeNode(o); } else { parent.right = new TreeNode(o); } } return true; // Element inserted } public void breadth() { breadth(root); } // Implement this method to produce a breadth first // search traversal public void breadth(TreeNode root){ if (root == null) return; System.out.print(root.element + " "); breadth(root.left); breadth(root.right); } /** Inorder traversal */ public void inorder() { inorder(root); } /** Inorder traversal from a subtree */ private void inorder(TreeNode root) { if (root == null) { return; } inorder(root.left); System.out.print(root.element + " "); inorder(root.right); } /** Postorder traversal */ public void postorder() { postorder(root); } /** Postorder traversal from a subtree */ private void postorder(TreeNode root) { if (root == null) { return; } postorder(root.left); postorder(root.right); System.out.print(root.element + " "); } /** Preorder traversal */ public void preorder() { preorder(root); } /** Preorder traversal from a subtree */ private void preorder(TreeNode root) { if (root == null) { return; } System.out.print(root.element + " "); preorder(root.left); preorder(root.right); } /** Inner class tree node */ private class TreeNode { Object element; TreeNode left; TreeNode right; public TreeNode(Object o) { element = o; } } }

    Read the article

  • Mixing c++ standard strings and windows API

    - by JB
    Many windows APIs take a pointer to a buffer and a size element but the result needs to go into a c++ string. (I'm using windows unicode here so they are wstrings) Here is an example :- #include <iostream> #include <string> #include <vector> #include <windows.h> using namespace std; // This is the method I'm interested in improving ... wstring getComputerName() { vector<wchar_t> buffer; buffer.resize(MAX_COMPUTERNAME_LENGTH+1); DWORD size = MAX_COMPUTERNAME_LENGTH; GetComputerNameW(&buffer[0], &size); return wstring(&buffer[0], size); } int main() { wcout << getComputerName() << "\n"; } My question really is, is this the best way to write the getComputerName function so that it fits into C++ better, or is there a better way? I don't see any way to use a string directly without going via a vector unless I missed something? It works fine, but somehow seems a little ugly. The question isn't about that particular API, it's just a convenient example.

    Read the article

  • Typed Arrays in Gecko 2: Float32Array concatenation and expansion.

    - by janesconference
    Hi all, I'm a bit confused with Javascript Typed Arrays. What I have several *Float32Array*s, that have no concat method. I'd like to concatenate them all inside another Float32Array, but: as I said before, there is no concatenation method if I try to write past the array length, the array is not expanded (aka this won't work - please note that event.frameBuffer and buffer are both Float32Array and that I don't know what the final length of my buffer will be): var length_now = buffer.length; for (var i = 0; i < event.frameBuffer.length; i += 1) { buffer [length_now + i] = event.frameBuffer[i]; } The only solution I found is to copy the Float32Array in a regular array, that's definitely not what I want. How would you do, stackoverflowers?

    Read the article

  • DotNetNuke + XPath = Custom navigation menu DNNMenu HTML render

    - by Rui Santos
    I'm developing a skin for DotNetNuke 5 using the Component DNN Done Right menu by Mark Alan which uses XSL-T to convert the XML sitemap into an HTML navigation. The XML sitemap outputs the following structure: <Root > <root > <node id="40" text="Home" url="http://localhost/dnn/Home.aspx" enabled="1" selected="0" breadcrumb="0" first="1" last="0" only="0" depth="0" > <node id="58" text="Child1" url="http://localhost/dnn/Home/Child1.aspx" enabled="1" selected="0" breadcrumb="0" first="1" last="0" only="0" depth="1" > <keywords >Child1</keywords> <description >Child1</description> <node id="59" text="Child1 SubItem1" url="http://localhost/dnn/Home/Child1/Child1SubItem1.aspx" enabled="1" selected="0" breadcrumb="0" first="1" last="0" only="0" depth="2" > <keywords >Child1 SubItem1</keywords> <description >Child1 SubItem1</description> </node> <node id="60" text="Child1 SubItem2" url="http://localhost/dnn/Home/Child1/Child1SubItem2.aspx" enabled="1" selected="0" breadcrumb="0" first="0" last="0" only="0" depth="2" > <keywords >Child1 SubItem2</keywords> <description >Child1 SubItem2</description> </node> <node id="61" text="Child1 SubItem3" url="http://localhost/dnn/Home/Child1/Child1SubItem3.aspx" enabled="1" selected="0" breadcrumb="0" first="0" last="1" only="0" depth="2" > <keywords >Child1 SubItem3</keywords> <description >Child1 SubItem3</description> </node> </node> <node id="65" text="Child2" url="http://localhost/dnn/Home/Child2.aspx" enabled="1" selected="0" breadcrumb="0" first="0" last="1" only="0" depth="1" > <keywords >Child2</keywords> <description >Child2</description> <node id="66" text="Child2 SubItem1" url="http://localhost/dnn/Home/Child2/Child2SubItem1.aspx" enabled="1" selected="0" breadcrumb="0" first="1" last="0" only="0" depth="2" > <keywords >Child2 SubItem1</keywords> <description >Child2 SubItem1</description> </node> <node id="67" text="Child2 SubItem2" url="http://localhost/dnn/Home/Child2/Child2SubItem2.aspx" enabled="1" selected="0" breadcrumb="0" first="0" last="1" only="0" depth="2" > <keywords >Child2 SubItem2</keywords> <description >Child2 SubItem2</description> </node> </node> </node> </root> </Root> My Goal is to render this XML block into this HTML Navigation structure only using UL's LI's, etc.. <ul id="topnav"> <li> <a href="#" class="home">Home</a> <!-- Parent Node - Depth0 --> <div class="sub"> <ul> <li><h2><a href="#">Child1</a></h2></li> <!-- Parent Node 1 - Depth1 --> <li><a href="#">Child1 SubItem1</a></li> <!-- ChildNode - Depth2 --> <li><a href="#">Child1 SubItem2</a></li> <!-- ChildNode - Depth2 --> <li><a href="#">Child1 SubItem3</a></li ><!-- ChildNode - Depth2 --> </ul> <ul> <li><h2><a href="#">Child2</a></h2></li> <!-- Parent Node 2 - Depth1 --> <li><a href="#">Child2 SubItem1</a></li> <!-- ChildNode - Depth2 --> <li><a href="#">Child2 SubItem2</a></li> <!-- ChildNode - Depth2 --> </ul> </div> </li> </ul> Can anyone help with the XSL coding? I'm just starting now with XSL..

    Read the article

  • Interoperability between two AES algorithms

    - by lpfavreau
    Hello, I'm new to cryptography and I'm building some test applications to try and understand the basics of it. I'm not trying to build the algorithms from scratch but I'm trying to make two different AES-256 implementation talk to each other. I've got a database that was populated with this Javascript implementation stored in Base64. Now, I'm trying to get an Objective-C method to decrypt its content but I'm a little lost as to where the differences in the implementations are. I'm able to encrypt/decrypt in Javascript and I'm able to encrypt/decrypt in Cocoa but cannot make a string encrypted in Javascript decrypted in Cocoa or vice-versa. I'm guessing it's related to the initialization vector, nonce, counter mode of operation or all of these, which quite frankly, doesn't speak to me at the moment. Here's what I'm using in Objective-C, adapted mainly from this and this: @implementation NSString (Crypto) - (NSString *)encryptAES256:(NSString *)key { NSData *input = [self dataUsingEncoding: NSUTF8StringEncoding]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:TRUE]; return [Base64 encode:output]; } - (NSString *)decryptAES256:(NSString *)key { NSData *input = [Base64 decode:self]; NSData *output = [NSString cryptoAES256:input key:key doEncrypt:FALSE]; return [[[NSString alloc] initWithData:output encoding:NSUTF8StringEncoding] autorelease]; } + (NSData *)cryptoAES256:(NSData *)input key:(NSString *)key doEncrypt:(BOOL)doEncrypt { // 'key' should be 32 bytes for AES256, will be null-padded otherwise char keyPtr[kCCKeySizeAES256 + 1]; // room for terminator (unused) bzero(keyPtr, sizeof(keyPtr)); // fill with zeroes (for padding) // fetch key data [key getCString:keyPtr maxLength:sizeof(keyPtr) encoding:NSUTF8StringEncoding]; NSUInteger dataLength = [input length]; // See the doc: For block ciphers, the output size will always be less than or // equal to the input size plus the size of one block. // That's why we need to add the size of one block here size_t bufferSize = dataLength + kCCBlockSizeAES128; void* buffer = malloc(bufferSize); size_t numBytesCrypted = 0; CCCryptorStatus cryptStatus = CCCrypt(doEncrypt ? kCCEncrypt : kCCDecrypt, kCCAlgorithmAES128, kCCOptionECBMode | kCCOptionPKCS7Padding, keyPtr, kCCKeySizeAES256, nil, // initialization vector (optional) [input bytes], dataLength, // input buffer, bufferSize, // output &numBytesCrypted ); if (cryptStatus == kCCSuccess) { // the returned NSData takes ownership of the buffer and will free it on deallocation return [NSData dataWithBytesNoCopy:buffer length:numBytesCrypted]; } free(buffer); // free the buffer; return nil; } @end Of course, the input is Base64 decoded beforehand. I see that each encryption with the same key and same content in Javascript gives a different encrypted string, which is not the case with the Objective-C implementation that always give the same encrypted string. I've read the answers of this post and it makes me believe I'm right about something along the lines of vector initialization but I'd need your help to pinpoint what's going on exactly. Thank you!

    Read the article

  • Android - Read PNG image without alpha and decode as ARGB_8888

    - by loki666
    I try to read an image from sdcard (in emulator) and then create a Bitmap image with the BitmapFactory.decodeByteArray method. I set the options: options.inPrefferedConfig = Bitmap.Config.ARGB_8888 options.inDither = false Then I extract the pixels into a ByteBuffer. ByteBuffer buffer = ByteBuffer.allocateDirect(width*height*4) bitmap.copyPixelsToBuffer(buffer) I use this ByteBuffer then in the JNI to convert it into RGB format and want to calculate on it. But always I get false data - I test without modifying the ByteBuffer. Only thing I do is to put it into the native method into JNI. Then cast it into a unsigned char* and convert it back into a ByteBuffer before returning it back to Java. unsigned char* buffer = (unsinged char*)(env->GetDirectBufferAddress(byteBuffer)) jobject returnByteBuffer = env->NewDirectByteBuffer(buffer, length) Before displaying the image I get data back with bitmap.copyPixelsFromBuffer( buffer ) But then it has wrong data in it. My Question is if this is because the image is internally converted into RGB 565 or what is wrong here? ..... Have an answer for it: - yes, it is converted internally to RGB565. Does anybody know how to create such an bitmap image from PNG with ARGB8888 pixel format? If anybody has an idea, it would be great!

    Read the article

  • Something like System.Diagnostics.Process.Start to run a stream

    - by phenevo
    Hi, I get from server images and videos by stream. Now I'm saving it: Stream str = client.GetFile(path); using (var outStream = new FileStream(@"c:\myFile.jpg", FileMode.Create)) { var buffer = new byte[4096]; int count; while ((count = str.Read(buffer, 0, buffer.Length)) > 0) { outStream.Write(buffer, 0, count); } } I can be jpg, mpg, flv and a lot of other multimedia types (Before I get stream I know what is a extension of this file). Now I want to not save it , bu run direct from stream. Is it possible ??

    Read the article

  • Large File Download - Connection With Server Reset

    - by daveywc
    I have an asp.net website that allows the user to download largish files - 30mb to about 60mb. Sometimes the download works fine but often it fails at some varying point before the download finishes with the message saying that the connection with the server was reset. Originally I was simply using Server.TransmitFile but after reading up a bit I am now using the code posted below. I am also setting the Server.ScriptTimeout value to 3600 in the Page_Init event. private void DownloadFile(string fname, bool forceDownload) { string path = MapPath(fname); string name = Path.GetFileName(path); string ext = Path.GetExtension(path); string type = ""; // set known types based on file extension if (ext != null) { switch (ext.ToLower()) { case ".mp3": type = "audio/mpeg"; break; case ".htm": case ".html": type = "text/HTML"; break; case ".txt": type = "text/plain"; break; case ".doc": case ".rtf": type = "Application/msword"; break; } } if (forceDownload) { Response.AppendHeader("content-disposition", "attachment; filename=" + name.Replace(" ", "_")); } if (type != "") { Response.ContentType = type; } else { Response.ContentType = "application/x-msdownload"; } System.IO.Stream iStream = null; // Buffer to read 10K bytes in chunk: byte[] buffer = new Byte[10000]; // Length of the file: int length; // Total bytes to read: long dataToRead; try { // Open the file. iStream = new System.IO.FileStream(path, System.IO.FileMode.Open, System.IO.FileAccess.Read, System.IO.FileShare.Read); // Total bytes to read: dataToRead = iStream.Length; //Response.ContentType = "application/octet-stream"; //Response.AddHeader("Content-Disposition", "attachment; filename=" + filename); // Read the bytes. while (dataToRead > 0) { // Verify that the client is connected. if (Response.IsClientConnected) { // Read the data in buffer. length = iStream.Read(buffer, 0, 10000); // Write the data to the current output stream. Response.OutputStream.Write(buffer, 0, length); // Flush the data to the HTML output. Response.Flush(); buffer = new Byte[10000]; dataToRead = dataToRead - length; } else { //prevent infinite loop if user disconnects dataToRead = -1; } } } catch (Exception ex) { // Trap the error, if any. Response.Write("Error : " + ex.Message); } finally { if (iStream != null) { //Close the file. iStream.Close(); } Response.Close(); } }

    Read the article

  • ignore certain buffers using iswitchb

    - by robUK
    Hello, GNU Emacs 23.1 I am using iswitchb. However, when I press c-x b I get a list of buffers. However, I don't want to display one like scratch, Messages, GNU Emacs, etc. Just the buffers I have opened myself. So I am looking for a way to ignore these buffers. This is what I have in my configuration. However, it doesn't ignore the buffers I don't want. Have I done anything wrong? ;; Setup iswitchb to select different buffers, ignore buffers to reduce list (iswitchb-mode 1) (setq iswitchb-buffer-ignore '("*scratch*")) (setq iswitchb-buffer-ignore '("*Messages*")) (setq iswitchb-buffer-ignore '("*GNU Emacs*")) (setq iswitchb-buffer-ignore '("*compilation*")) Many thanks for any suggestions,

    Read the article

  • copying a short int to a char array

    - by cateof
    I have a short integer variable called s_int that holds value = 2 unsighed short s_int = 2; I want to copy this number to a char array to the first and second position of a char array. Let's say we have char buffer[10];. We want the two bytes of s_int to be copied at buffer[0] and buffer[1]. How can I do it?

    Read the article

  • Is it possible to BitBlt directly on to a GDI+ bitmap?

    - by jnm2
    I am trying to BitBlt from an HBITMAP to a GDI+ bitmap. I tried this, but nothing happens: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); IntPtr hBufferDC = BufferGraphics.GetHdc(); ... BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); EDIT: Apparently the hDC doesn't work if I acquire it and then much later use it with BitBlt. I needed to make sure the hDC was still valid. This is the solution: Bitmap Buffer = New Bitmap(608, 392) Graphics BufferGraphics = Graphics.FromImage(Buffer); ... IntPtr hBufferDC = BufferGraphics.GetHdc(); BitBlt(hBufferDC, x, y, width, height, hInputDC, 0, 0, SRCCOPY); BufferGraphics.ReleaseHdc(hBufferDC); Does anyone know why this change is necessary? Why might it not work to use an hDC that was gotten earlier as in the first example?

    Read the article

  • Faster way to clone.

    - by AngryHacker
    I am trying to optimize a piece of code that clones an object: #region ICloneable public object Clone() { MemoryStream buffer = new MemoryStream(); BinaryFormatter formatter = new BinaryFormatter(); formatter.Serialize(buffer, this); // takes 3.2 seconds buffer.Position = 0; return formatter.Deserialize(buffer); // takes 2.1 seconds } #endregion Pretty standard stuff. The problem is that the object is pretty beefy and it takes 5.4 seconds (according ANTS Profiler - I am sure there is the profiler overhead, but still). Is there a better and faster way to clone?

    Read the article

  • PIX_FMT_YUYV422 8 bits conversion ffmpeg

    - by Sridhar
    Hi, I have a raw YUYV422 buffer with 8-bit 4:2:2 Component Y’CbCr format (Y0, Cb, Y1, Cr order). I know that ffmpeg's PIX_FMT_YUYV422 only handle 16-bit buffers.So I am getting Bad memory error when scaling that buffer into YUV420P. Can any one give me a clue, how can I use this buffer with ffmpeg to covert into YUV420. Thanks, Raghu

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

< Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >