Search Results

Search found 5547 results on 222 pages for 'flyweight pattern'.

Page 42/222 | < Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >

  • Is there a name for the Builder Pattern where the Builder is implemented via interfaces so certain parameters are required?

    - by Zipper
    So we implemented the builder pattern for most of our domain to help in understandability of what actually being passed to a constructor, and for the normal advantages that a builder gives. The one twist was that we exposed the builder through interfaces so we could chain required functions and unrequired functions to make sure that the correct parameters were passed. I was curious if there was an existing pattern like this. Example below: public class Foo { private int someThing; private int someThing2; private DateTime someThing3; private Foo(Builder builder) { this.someThing = builder.someThing; this.someThing2 = builder.someThing2; this.someThing3 = builder.someThing3; } public static RequiredSomething getBuilder() { return new Builder(); } public interface RequiredSomething { public RequiredDateTime withSomething (int value); } public interface RequiredDateTime { public OptionalParamters withDateTime (DateTime value); } public interface OptionalParamters { public OptionalParamters withSeomthing2 (int value); public Foo Build ();} public static class Builder implements RequiredSomething, RequiredDateTime, OptionalParamters { private int someThing; private int someThing2; private DateTime someThing3; public RequiredDateTime withSomething (int value) {someThing = value; return this;} public OptionalParamters withDateTime (int value) {someThing = value; return this;} public OptionalParamters withSeomthing2 (int value) {someThing = value; return this;} public Foo build(){return new Foo(this);} } } Example of how it's called: Foo foo = Foo.getBuilder().withSomething(1).withDateTime(DateTime.now()).build(); Foo foo2 = Foo.getBuilder().withSomething(1).withDateTime(DateTime.now()).withSomething2(3).build();

    Read the article

  • Is event sourcing ready for prime time?

    - by Dakotah North
    Event Sourcing was popularized by LMAX as a means to provide speed, performance scalability, transparent persistence and transparent live mirroring. Before being rebranded as Event Sourcing, this type of architectural pattern was known as System Prevalence but yet I was never familiar with this pattern before the LMAX team went public. Has this pattern proved itself in numerous production systems and therefore even conservative individuals should feel empowered to embrace this pattern or is event sourcing / system prevalence an exotic pattern that is best left for the fearless?

    Read the article

  • GIT repository layout for server with multiple projects

    - by Paul Alexander
    One of the things I like about the way I have Subversion set up is that I can have a single main repository with multiple projects. When I want to work on a project I can check out just that project. Like this \main \ProductA \ProductB \Shared then svn checkout http://.../main/ProductA As a new user to git I want to explore a bit of best practice in the field before committing to a specific workflow. From what I've read so far, git stores everything in a single .git folder at the root of the project tree. So I could do one of two things. Set up a separate project for each Product. Set up a single massive project and store products in sub folders. There are dependencies between the products, so the single massive project seems appropriate. We'll be using a server where all the developers can share their code. I've already got this working over SSH & HTTP and that part I love. However, the repositories in SVN are already many GB in size so dragging around the entire repository on each machine seems like a bad idea - especially since we're billed for excessive network bandwidth. I'd imagine that the Linux kernel project repositories are equally large so there must be a proper way of handling this with Git but I just haven't figured it out yet. Are there any guidelines or best practices for working with very large multi-project repositories?

    Read the article

  • Linq to SQL, Repository, IList and Persist All

    - by Dr. Zim
    This discusses a repository which returns IList that also uses Linq to SQL as a DAL. Once you do a .ToList(), IQueryable object is gone once you exit the Repository. This means that I need to send the objects back in to the Repo methods .Create(Model model), .Update(Model model), and .Delete(int ID). Assuming that is correct, how do you do the PersistAll()? For example, if you did the following, how would you code that in the repository? Changed a single string property in the object Called .Update(object); Changed a different string property in the object Called .Update(object); Called .PersistAll(), which would update the database with both changed strings. How would you associate the objects in the Repository parameters with the objects in the Linq to Sql data context, especially over multiple calls? I am sure this is a standard thing. Links to examples on the web would be great!

    Read the article

  • Replace with wildcard, in SQL

    - by Jay
    I know MS T-SQL does not support regular expression, but I need similar functionality. Here's what I'm trying to do: I have a varchar table field which stores a breadcrumb, like this: /ID1:Category1/ID2:Category2/ID3:Category3/ Each Category name is preceded by its Category ID, separated by a colon. I'd like to select and display these breadcrumbs but I want to remove the Category IDs and colons, like this: /Category1/Category2/Category3/ Everything between the leading slash (/) up to and including the colon (:) should be stripped out. I don't have the option of extracting the data, manipulating it externally, and re-inserting back into the table; so I'm trying to accomplish this in a SELECT statement. I also can't resort to using a cursor to loop through each row and clean each field with a nested loop, due to the number of rows returned in the SELECT. Can this be done? Thanks all - Jay

    Read the article

  • Javascript regex URL matching

    - by Blondie
    I have this so far: chrome.tabs.getSelected(null, function(tab) { var title = tab.title; var btn = '<a href="' + tab.url + '" onclick="save(\'' + title + '\');"> ' + title + '</a>'; if(tab.url.match('/http:\/\/www.mydomain.com\/version.php/i')) { document.getElementById('link').innerHTML = '<p>' + btn + '</p>'; } }); Basically it should match the domain within this: http://www.mydomain.com/version.php?* Anything that matches that even when it includes something like version.php?ver=1, etc When I used the code above of mine, it doesn't display anything, but when I remove the if statement, it's fine but it shows on other pages which it shouldn't only on the matched URL.

    Read the article

  • How can I write a clean Repository without exposing IQueryable to the rest of my application?

    - by Simucal
    So, I've read all the Q&A's here on SO regarding the subject of whether or not to expose IQueryable to the rest of your project or not (see here, and here), and I've ultimately decided that I don't want to expose IQueryable to anything but my Model. Because IQueryable is tied to certain persistence implementations I don't like the idea of locking myself into this. Similarly, I'm not sure how good I feel about classes further down the call chain modifying the actual query that aren't in the repository. So, does anyone have any suggestions for how to write a clean and concise Repository without doing this? One problem I see, is my Repository will blow up from a ton of methods for various things I need to filter my query off of. Having a bunch of: IEnumerable GetProductsSinceDate(DateTime date); IEnumberable GetProductsByName(string name); IEnumberable GetProductsByID(int ID); If I was allowing IQueryable to be passed around I could easily have a generic repository that looked like: public interface IRepository<T> where T : class { T GetById(int id); IQueryable<T> GetAll(); void InsertOnSubmit(T entity); void DeleteOnSubmit(T entity); void SubmitChanges(); } However, if you aren't using IQueryable then methods like GetAll() aren't really practical since lazy evaluation won't be taking place down the line. I don't want to return 10,000 records only to use 10 of them later. What is the answer here? In Conery's MVC Storefront he created another layer called the "Service" layer which received IQueryable results from the respository and was responsible for applying various filters. Is this what I should do, or something similar? Have my repository return IQueryable but restrict access to it by hiding it behind a bunch of filter classes like GetProductByName, which will return a concrete type like IList or IEnumerable?

    Read the article

  • Using C# and Repository Factory and the error: The requested database is not defined in configurati

    - by odiseh
    hi I am using Repository factory for visual studio 2008 for a personal project. It generated a class called ProductRepository which inherits from Repository. The ProductRepository has a constructor which gets a database name as string and passes it to its base (I mean Repository ). So when I try to debug my project step by step, I pass my database name to ProductRepository but it raises the following error: The requested database is not defined in configuration. What's wrong?

    Read the article

  • Very simple regex not working

    - by Thomas Wanner
    I have read that to match a word inside of a string using Regular expressions (in .NET), I can use the word boundary specifier (\b) within the regex. However, none of these calls result in any matches Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\b@p1\b"); Regex.Match("INSERT INTO TEST(Col1,Col2) VALUES(@p1,@p2)", "\bINSERT\b"); Is there anything I am doing wrong ?

    Read the article

  • Custom Django admin URL + changelist view for custom list filter by Tags

    - by Botondus
    In django admin I wanted to set up a custom filter by tags (tags are introduced with django-tagging) I've made the ModelAdmin for this and it used to work fine, by appending custom urlconf and modifying the changelist view. It should work with URLs like: http://127.0.0.1:8000/admin/reviews/review/only-tagged-vista/ But now I get 'invalid literal for int() with base 10: 'only-tagged-vista', error which means it keeps matching the review edit page instead of the custom filter page, and I cannot figure out why since it used to work and I can't find what change might have affected this. Any help appreciated. Relevant code: class ReviewAdmin(VersionAdmin): def changelist_view(self, request, extra_context=None, **kwargs): from django.contrib.admin.views.main import ChangeList cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, self.list_per_page, self.list_editable, self) cl.formset = None if extra_context is None: extra_context = {} if kwargs.get('only_tagged'): tag = kwargs.get('tag') cl.result_list = cl.result_list.filter(tags__icontains=tag) extra_context['extra_filter'] = "Only tagged %s" % tag extra_context['cl'] = cl return super(ReviewAdmin, self).changelist_view(request, extra_context=extra_context) def get_urls(self): from django.conf.urls.defaults import patterns, url urls = super(ReviewAdmin, self).get_urls() def wrap(view): def wrapper(*args, **kwargs): return self.admin_site.admin_view(view)(*args, **kwargs) return update_wrapper(wrapper, view) info = self.model._meta.app_label, self.model._meta.module_name my_urls = patterns('', # make edit work from tagged filter list view # redirect to normal edit view url(r'^only-tagged-\w+/(?P<id>.+)/$', redirect_to, {'url': "/admin/"+self.model._meta.app_label+"/"+self.model._meta.module_name+"/%(id)s"} ), # tagged filter list view url(r'^only-tagged-(P<tag>\w+)/$', self.admin_site.admin_view(self.changelist_view), {'only_tagged':True}, name="changelist_view"), ) return my_urls + urls Edit: Original issue fixed. I now receive 'Cannot filter a query once a slice has been taken.' for line: cl.result_list = cl.result_list.filter(tags__icontains=tag) I'm not sure where this result list is sliced, before tag filter is applied. Edit2: It's because of the self.list_per_page in ChangeList declaration. However didn't find a proper solution yet. Temp fix: if kwargs.get('only_tagged'): list_per_page = 1000000 else: list_per_page = self.list_per_page cl = ChangeList(request, self.model, list(self.list_display), self.list_display_links, self.list_filter, self.date_hierarchy, self.search_fields, self.list_select_related, list_per_page, self.list_editable, self)

    Read the article

  • What is good practice in .NET system architecture design concerning multiple models and aggregates

    - by BuzzBubba
    I'm designing a larger enterprise architecture and I'm in a doubt about how to separate the models and design those. There are several points I'd like suggestions for: - models to define - way to define models Currently my idea is to define: Core (domain) model Repositories to get data to that domain model from a database or other store Business logic model that would contain business logic, validation logic and more specific versions of forms of data retrieval methods View models prepared for specifically formated data output that would be parsed by views of different kind (web, silverlight, etc). For the first model I'm puzzled at what to use and how to define the mode. Should this model entities contain collections and in what form? IList, IEnumerable or IQueryable collections? - I'm thinking of immutable collections which IEnumerable is, but I'd like to avoid huge data collections and to offer my Business logic layer access with LINQ expressions so that query trees get executed at Data level and retrieve only really required data for situations like the one when I'm retrieving a very specific subset of elements amongst thousands or hundreds of thousands. What if I have an item with several thousands of bids? I can't just make an IEnumerable collection of those on the model and then retrieve an item list in some Repository method or even Business model method. Should it be IQueryable so that I actually pass my queries to Repository all the way from the Business logic model layer? Should I just avoid collections in my domain model? Should I void only some collections? Should I separate Domain model and BusinessLogic model or integrate those? Data would be dealt trough repositories which would use Domain model classes. Should repositories be used directly using only classes from domain model like data containers? This is an example of what I had in mind: So, my Domain objects would look like (e.g.) public class Item { public string ItemName { get; set; } public int Price { get; set; } public bool Available { get; set; } private IList<Bid> _bids; public IQueryable<Bid> Bids { get { return _bids.AsQueryable(); } private set { _bids = value; } } public AddNewBid(Bid newBid) { _bids.Add(new Bid {.... } } Where Bid would be defined as a normal class. Repositories would be defined as data retrieval factories and used to get data into another (Business logic) model which would again be used to get data to ViewModels which would then be rendered by different consumers. I would define IQueryable interfaces for all aggregating collections to get flexibility and minimize data retrieved from real data store. Or should I make Domain Model "anemic" with pure data store entities and all collections define for business logic model? One of the most important questions is, where to have IQueryable typed collections? - All the way from Repositories to Business model or not at all and expose only solid IList and IEnumerable from Repositories and deal with more specific queries inside Business model, but have more finer grained methods for data retrieval within Repositories. So, what do you think? Have any suggestions?

    Read the article

  • Any sample C# project that highlights separate data access layer (using EF) to business logic layer

    - by Greg
    Hi, I'm interested in having a look at a small sample project that would highlight a good technique to separate data access layer (using Entity Framework) to business logic layer. In C# would be good. That is, it would highlight how to pass data between the layer without coupling them. That is, the assumption here is not to use the EF classes in the Business Logic layer, and how to achieve this low coupling, but minimizing plumbing code.

    Read the article

  • Perl script matching a certain patern

    - by kivien
    Assuming the file.txt is as follows:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The perl code is as follows:- open ( FILE, "file.txt" ) || die "can't open file!"; @lines = <FILE>; close (FILE); $string = "John Depp"; foreach $line (@lines) { if ($line =~ $string) { print "$line"; } } The output is going to be first and fourth line. I want to make it working for the file having random line breaks rather than one English sentence per line. I mean it should also work for the following:- John Depp is a great guy. He is very inteligent. He can do anything. Come and meet John Depp. The output should be first and fourth sentence. Any ideas please?

    Read the article

  • realloc() & ARC

    - by RynoB
    How would I be able to rewrite the the following utility class to get all the class string values for a specific type - using the objective-c runtime functions as shown below? The ARC documentation specifically states that realloc should be avoided and I also get the following compiler error on this this line: classList = realloc(classList, sizeof(Class) * numClasses); "Implicit conversion of a non-Objective-C pointer type 'void *' to '__unsafe_unretained Class *' is disallowed with ARC" The the below code is a reference to the original article which can be found here. + (NSArray *)classStringsForClassesOfType:(Class)filterType { int numClasses = 0, newNumClasses = objc_getClassList(NULL, 0); Class *classList = NULL; while (numClasses < newNumClasses) { numClasses = newNumClasses; classList = realloc(classList, sizeof(Class) * numClasses); newNumClasses = objc_getClassList(classList, numClasses); } NSMutableArray *classesArray = [NSMutableArray array]; for (int i = 0; i < numClasses; i++) { Class superClass = classList[i]; do { superClass = class_getSuperclass(superClass); if (superClass == filterType) { [classesArray addObject:NSStringFromClass(classList[i])]; break; } } while (superClass); } free(classList); return classesArray; } Your help will be much appreciated. Thanks

    Read the article

  • How can I use jQuery to match a string inside the current URL of the window I am in?

    - by Jannis
    Hi, I have used the excellent gskinner.com/RegExr/ tool to test my string matching regex but I cannot figure out how to implement this into my jQuery file to return true or false. The code I have is as follows: ^(http:)\/\/(.+\.)?(stackoverflow)\. on a url such as http://stackoverflow.com/questions/ask this would match (according to RegExr) http://stackoverflow. So this is great because I want to try matching the current window.location to that string, but the issue I am having is that this jQuery/js script does not work: var url = window.location; if ( url.match( /^(http:)\/\/(.+\.)?(stackoverflow)\./ ) ) { alert('this works'); }; Any ideas on what I am doing wrong here? Thanks for reading. Jannis

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • DDD: Getting aggregate roots for other aggregates

    - by Ed
    I've been studying DDD for the past 2 weeks, and one of the things that really stuck out to me was how aggregate roots can contain other aggregate roots. Aggregate roots are retrieved from the repository, but if a root contains another root, does the repository have a reference to the other repository and asks it to build the subroot?

    Read the article

  • How do you handle EF Data Contexts combined with asp.net custom membership/role providers

    - by KallDrexx
    I can't seem to get my head around how to implement a custom membership provider with Entity Framework data contexts into my asp.net MVC application. I understand how to create a custom membership/role provider by itself (using this as a reference). Here's my current setup: As of now I have a repository factory interface that allows different repository factories to be created (right now I only have a factory for EF repositories and and in memory repositories). The repository factory looks like this: public class EFRepositoryFactory : IRepositoryFactory { private EntitiesContainer _entitiesContext; /// <summary> /// Constructor that generates the necessary object contexts /// </summary> public EFRepositoryFactory() { _entitiesContext = new EntitiesContainer(); } /// <summary> /// Generates a new entity framework repository for the specified entity type /// </summary> /// <typeparam name="T">Type of entity to generate a repository for </typeparam> /// <returns>Returns an EFRepository</returns> public IRepository<T> GenerateRepository<T>() where T : class { return new EFRepository<T>(_entitiesContext); } } Controllers are passed an EF repository factory via castle Windsor. The controller then creates all the service/business layer objects it requires and passes in the repository factory into it. This means that all service objects are using the same EF data contexts and I do not have to worry about objects being used in more than one data context (which of course is not allowed and causes an exception). As of right now I am trying to decide how to generate my user and authorization service layers, and have run against a design roadblock. The User/Authization service will be a central class that handles the logic for logging in, changing user details, managing roles and determining what users have access to what. The problem is, using the current methodology the asp.net mvc controllers will initialize it's own EF repository factory via Windsor and the asp.net membership/role provider will have to initialize it's own EF repository factory. This means that each part of the site will then have it's own data context. This seems to mean that if asp.net authenticates a user, that user's object will be in the membership provider's data context and thus if I try to retrieve that user object in the service layer (say to change the user's name) I will get a duplication exception. I thought of making the repository factory class a singleton, but I don't see a way for that to work with castle Windsor. How do other people handle asp.net custom providers in a MVC (or any n-tier) architecture without having object duplication issues?

    Read the article

  • Regular Expressions: Positive Lookahead and Word Border question

    - by Inf.S
    Hello again Stackoverflow people! Assume I have these words: smartphones, smartphone I want to match the substring "phone" from within them. However, in both case, I want only "phone" to be returned, not "phones" in the first case. In addition to this, I want matches only if the word "phone" is a suffix only, such that: fonephonetics (just an example) is not matched. I assumed that the regex (phone([?=s])?)\b would give me what I need, but it is currently matching "phones" and "phone", but not the "fonephonetics" one. I don't need "phones". I want "phone" for both cases. Any ideas about what is wrong, and what I can do? Thank you in advance!

    Read the article

  • Sorting tree with a materialized path?

    - by Ovid
    I have a tree structure in a table and it uses materialized paths to allow me to find children quickly. However, I also need to sort the results depth-first, as one would expect with threaded forum replies. id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 7 | 1 | 1 | 2010-05-08 18:18:11.849735 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 So the final results should actually be sorted like this: id | parent_id | matpath | created ----+-----------+---------+---------------------------- 2 | 1 | 1 | 2010-05-08 15:18:37.987544 6 | 2 | 1.2 | 2010-05-08 17:50:43.288759 8 | 6 | 1.2.6 | 2010-05-09 14:01:17.632695 3 | 1 | 1 | 2010-05-08 17:38:14.125377 4 | 1 | 1 | 2010-05-08 17:38:57.26743 5 | 1 | 1 | 2010-05-08 17:43:28.211708 9 | 5 | 1.5 | 2010-05-09 14:02:43.818646 7 | 1 | 1 | 2010-05-08 18:18:11.849735 How would I work that out? Can I do that in straight SQL (this is PostgreSQL 8.4) or should additional information be added to this table?

    Read the article

  • Does .NET Regex support global matching?

    - by Dave
    I haven't been able to find anything online regarding this. There's RegexOptions, but it doesn't have Global as one of its options. The inline modifiers list also doesn't mention global matching. In a nutshell, I've got a regex to parse something like --arga= "arg1" --argb ="arg2" into separate argument name/value pairs using this regex: --(\\w+)\\s*=\\s*\"(\\w+)\"\\s* but the .NET Regex class doesn't do it globally (iteratively). So in order for me to get this to work, I'd have to do a match, then remove this from the argument string, and loop over and over again until I've exhausted all of the arguments. It would be nicer to run the regex once, and then loop over the match groups to get the name value pairs. Is this possible? What am I missing?

    Read the article

  • How can I extract the nth occurrence of a match in a Perl regex?

    - by Zaid
    Is it possible to extract the n'th match in a string of single-quoted words? use strict; use warnings; my $string1 = '\'I want to\' \'extract the word\' \'Perl\',\'from this string\''; my $string2 = '\'What about\',\'getting\',\'Perl\',\'from\',\'here\',\'?\''; sub extract_quoted { my ($string, $index) = @_; my ($wanted) = $string =~ /some_regex_using _$index/; return $wanted; } extract_wanted ($string1, 3); # Should return 'Perl', with quotes extract_wanted ($string2, 3); # Should return 'Perl', with quotes

    Read the article

  • How can I substitute the nth occurrence of a match in a Perl regex?

    - by Zaid
    Following up from an earlier question on extracting the n'th regex match, I now need to substitute the match, if found. I thought that I could define the extraction subroutine and call it in the substitution with the /e modifier. I was obviously wrong (admittedly, I had an XY problem). use strict; use warnings; sub extract_quoted { # à la codaddict my ($string, $index) = @_; while($string =~ /'(.*?)'/g) { $index--; return $1 if(! $index); } return; } my $string = "'How can I','use' 'PERL','to process this' 'line'"; extract_quoted ( $string, 3 ); $string =~ s/&extract_quoted($string,2)/'Perl'/e; print $string; # Prints 'How can I','use' 'PERL','to process this' 'line' There are, of course, many other issues with this technique: What if there are identical matches at different positions? What if the match isn't found? In light of this situation, I'm wondering in what ways this could be implemented.

    Read the article

< Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >