Search Results

Search found 6492 results on 260 pages for 'trigger io'.

Page 42/260 | < Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >

  • How to read from database and write into text file with C#?

    - by user147685
    How to read from database and write into text file? I want to write/copy (not sure what to call) the record inside my database into a text file. One row record in database is equal to one line in the text file. I'm having no problem in database. For creating text file, it mentions FileStream and StreamWriter. Which one should I use?

    Read the article

  • fortran error I/O

    - by jpcgandre
    I get this error when compiling: forrtl: severe (256): unformatted I/O to unit open for formatted transfers, unit 27, file C:\Abaqus_JOBS\w.txt The error occurs in the beginning of the analysis. At the start, the file w.txt is created but is empty. The error may be related to the fact that I want to read from an empty file. My code is: OPEN(27, FILE = "C:/Abaqus_JOBS/w.txt", status = "UNKNOWN") READ(27, *, iostat=stat) w IF (stat .NE. 0) CALL del_file(27, stat) SUBROUTINE del_file(uFile, stat) IMPLICIT NONE INTEGER uFile, stat C If the unit is not open, stat will be non-zero CLOSE(unit=uFile, status='delete', iostat=stat) END SUBROUTINE Ref: Close multiple files If you agree with my opion about the cause of the error, is there a way to solve it? Thanks

    Read the article

  • Batch backup a harddrive without modifying access times C#

    - by johnathan-doena
    I'm trying to write a simple program that will backup my flash drive. I want it to work automatically and silently in the background, and I also want it to be as quick as possible. The thing is, resetting all the access times is useless to me, and something I want to avoid. I know I can read the access times and set them back, but I bet it will fail one day in the future. It would be much simpler to read the files without ever changing it. Also, what is the fastest way to do this? What differences would there be between, say, a flash drive and an external hard drive. I am writing this in C#, as it is the simplest way to do it and it will probably last more generations of Windows..

    Read the article

  • Efficient file buffering & scanning methods for large files in python

    - by eblume
    The description of the problem I am having is a bit complicated, and I will err on the side of providing more complete information. For the impatient, here is the briefest way I can summarize it: What is the fastest (least execution time) way to split a text file in to ALL (overlapping) substrings of size N (bound N, eg 36) while throwing out newline characters. I am writing a module which parses files in the FASTA ascii-based genome format. These files comprise what is known as the 'hg18' human reference genome, which you can download from the UCSC genome browser (go slugs!) if you like. As you will notice, the genome files are composed of chr[1..22].fa and chr[XY].fa, as well as a set of other small files which are not used in this module. Several modules already exist for parsing FASTA files, such as BioPython's SeqIO. (Sorry, I'd post a link, but I don't have the points to do so yet.) Unfortunately, every module I've been able to find doesn't do the specific operation I am trying to do. My module needs to split the genome data ('CAGTACGTCAGACTATACGGAGCTA' could be a line, for instance) in to every single overlapping N-length substring. Let me give an example using a very small file (the actual chromosome files are between 355 and 20 million characters long) and N=8 import cStringIO example_file = cStringIO.StringIO("""\ header CAGTcag TFgcACF """) for read in parse(example_file): ... print read ... CAGTCAGTF AGTCAGTFG GTCAGTFGC TCAGTFGCA CAGTFGCAC AGTFGCACF The function that I found had the absolute best performance from the methods I could think of is this: def parse(file): size = 8 # of course in my code this is a function argument file.readline() # skip past the header buffer = '' for line in file: buffer += line.rstrip().upper() while len(buffer) = size: yield buffer[:size] buffer = buffer[1:] This works, but unfortunately it still takes about 1.5 hours (see note below) to parse the human genome this way. Perhaps this is the very best I am going to see with this method (a complete code refactor might be in order, but I'd like to avoid it as this approach has some very specific advantages in other areas of the code), but I thought I would turn this over to the community. Thanks! Note, this time includes a lot of extra calculation, such as computing the opposing strand read and doing hashtable lookups on a hash of approximately 5G in size. Post-answer conclusion: It turns out that using fileobj.read() and then manipulating the resulting string (string.replace(), etc.) took relatively little time and memory compared to the remainder of the program, and so I used that approach. Thanks everyone!

    Read the article

  • VB.NET 2008, Windows 7 and saving files

    - by James Brauman
    Hello, We have to learn VB.NET for the semester, my experience lies mainly with C# - not that this should make a difference to this particular problem. I've used just about the most simple way to save a file using the .NET framework, but Windows 7 won't let me save the file anywhere (or anywhere that I have found yet). Here is the code I am using to save a text file. Dim dialog As FolderBrowserDialog = New FolderBrowserDialog() Dim saveLocation As String = dialog.SelectedPath ... Build up output string ... Try ' Try to write the file. My.Computer.FileSystem.WriteAllText(saveLocation, output, False) Catch PermissionEx As UnauthorizedAccessException ' We do not have permissions to save in this folder. MessageBox.Show("Do not have permissions to save file to the folder specified. Please try saving somewhere different.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) Catch Ex As Exception ' Catch any exceptions that occured when trying to write the file. MessageBox.Show("Writing the file was not successful.", "Error", MessageBoxButtons.OK, MessageBoxIcon.Error) End Try The problem is that this using this code throws an UnauthorizedAccessException no matter where I try to save the file. I've tried running the .exe file as administrator, and the IDE as administrator. Is this just Windows 7 being overprotective? And if so, what can I do to solve this problem? The requirements state that I be able to save a file! Thanks.

    Read the article

  • Add HTML Id's to tags in .aspx file

    - by slandau
    So I'm writing an app that lets the user select a folder, it gets all the .aspx files in that folder, and lets the users check off which ones they want to add HTML ID's to. Then they click start, and this runs private void btnStart_Click(object sender, EventArgs e) { for (int i = 0; i < listFiles.CheckedItems.Count; i++) { } } It loops through all the selected file names. How do I open each of these .aspx files in the background, and go through them and add the id="thisItemId" attribute to each tag that's like a , , , , , etc....

    Read the article

  • MFC: Reading entire file to buffer...

    - by deostroll
    I've meddled with some code but I am unable to read the entire file properly...a lot of junk gets appended to the output. How do I fix this? // wmfParser.cpp : Defines the entry point for the console application. // #include "stdafx.h" #include "wmfParser.h" #include <cstring> #ifdef _DEBUG #define new DEBUG_NEW #endif // The one and only application object CWinApp theApp; using namespace std; int _tmain(int argc, TCHAR* argv[], TCHAR* envp[]) { int nRetCode = 0; // initialize MFC and print and error on failure if (!AfxWinInit(::GetModuleHandle(NULL), NULL, ::GetCommandLine(), 0)) { // TODO: change error code to suit your needs _tprintf(_T("Fatal Error: MFC initialization failed\n")); nRetCode = 1; } else { // TODO: code your application's behavior here. CFile file; CFileException exp; if( !file.Open( _T("c:\\sample.txt"), CFile::modeRead, &exp ) ){ exp.ReportError(); cout<<'\n'; cout<<"Aborting..."; system("pause"); return 0; } ULONGLONG dwLength = file.GetLength(); cout<<"Length of file to read = " << dwLength << '\n'; /* BYTE* buffer; buffer=(BYTE*)calloc(dwLength, sizeof(BYTE)); file.Read(buffer, 25); char* str = (char*)buffer; cout<<"length of string : " << strlen(str) << '\n'; cout<<"string from file: " << str << '\n'; */ char str[100]; file.Read(str, sizeof(str)); cout << "Data : " << str <<'\n'; file.Close(); cout<<"File was closed\n"; //AfxMessageBox(_T("This is a test message box")); system("pause"); } return nRetCode; }

    Read the article

  • How to store a scaleable sized extensible event log?

    - by firoso
    Hello everyone! I've been contemplating writing a simple "event log" that takes a paramater list and stores event messages in a log file, trouble is, I forsee this file growing to be rather large (assume 1M entries or more) the question is, how can I implement this system without pulling teeth, I know that SQL would be a possible way to go. XML would be ideal but not really practical for scaleability if i'm not going nuts. Example Log Entry -----Time Date-------- ---------Sender----------------------- ---------Tags---------- --Message---------- 12/24/2008 24:00:00 $DOMAIN\SYSTEM\Application$ :Trivial: :Notification: It's Christmas in 1s

    Read the article

  • What is the easiest way to loop through a folder of files in C#?

    - by badpanda
    I am new to C# and am trying to write a program that navigates the local file system using a config file containing relevant filepaths. My question is this: What are the best practices to use when performing file I/O (this will be from the desktop app to a server and back) and file system navigation in C#? I know how to google, and I have found several solutions, but I would like to know which of the various functions is most robust and flexible. As well, if anyone has any tips regarding exception handling for C# file I/O that would also be very helpful. Thanks!!! badPanda

    Read the article

  • Improving File Read Performance (single file, C++, Windows)

    - by david
    I have large (hundreds of MB or more) files that I need to read blocks from using C++ on Windows. Currently the relevant functions are: errorType LargeFile::read( void* data_out, __int64 start_position, __int64 size_bytes ) const { if( !m_open ) { // return error } else { seekPosition( start_position ); DWORD bytes_read; BOOL result = ReadFile( m_file, data_out, DWORD( size_bytes ), &bytes_read, NULL ); if( size_bytes != bytes_read || result != TRUE ) { // return error } } // return no error } void LargeFile::seekPosition( __int64 position ) const { LARGE_INTEGER target; target.QuadPart = LONGLONG( position ); SetFilePointerEx( m_file, target, NULL, FILE_BEGIN ); } The performance of the above does not seem to be very good. Reads are on 4K blocks of the file. Some reads are coherent, most are not. A couple questions: Is there a good way to profile the reads? What things might improve the performance? For example, would sector-aligning the data be useful? I'm relatively new to file i/o optimization, so suggestions or pointers to articles/tutorials would be helpful.

    Read the article

  • What is the magic behind perl read() function and buffer which is not a ref ?

    - by alex8657
    I do not get to understand how the Perl read($buf) function is able to modify the content of the $buf variable. $buf is not a reference, so the parameter is given by copy (from my c/c++ knowledge). So how come the $buf variable is modified in the caller ? Is it a tie variable or something ? The C documentation about setbuf is also quite elusive and unclear to me # Example 1 $buf=''; # It is a scalar, not a ref $bytes = $fh->read($buf); print $buf; # $buf was modified, what is the magic ? # Example 2 sub read_it { my $buf = shift; return $fh->read($buf); } my $buf; $bytes = read_it($buf); print $buf; # As expected, this scope $buf was not modified

    Read the article

  • Do we need seperate file path for window and linux in java

    - by Kishor Sharma
    I have a file on linux ubuntu server hosted with path name /home/kishor/project/detail/. When I made a web app in window to upload and download file from specified location i used path "c:\kishor\projects\detail\" for saving in window. For my surprise when i used window file path name in my server i am still able to get files and upload them, i.e, "c:\kishor\projects\detail\". Can anyone explain why it is working (as window and linux both use different file path pattern).

    Read the article

  • Most efficient way to write over file after reading

    - by Ryan McClure
    I'm reading in some data from a file, manipulating it, and then overwriting it to the same file. Until now, I've been doing it like so: open (my $inFile, $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... close ($inFile); open (my $outFile, $file) or die "Could not open $file: $!"; print $outFile, $retString; close ($inFile); However I realized I can just use the truncate function and open the file for read/write: open (my $inFile, '+<', $file) or die "Could not open $file: $!"; $retString .= join ('', <$inFile>); ... truncate $inFile, 0; print $inFile $retString; close ($inFile); I don't see any examples of this anywhere. It seems to work well, but am I doing it correctly? Is there a better way to do this?

    Read the article

  • Read File/Directory properties with java

    - by Pizza
    How can I read the file information (for example size, line count, last modification, etc) from a file in the file-system or the directory content with JAVA? I need it for a linux operating system. Thanks Ps. This is my first question, althought I have user this forum for a while so please be kind :P

    Read the article

  • Java I/O: How to append to an already existing text file.

    - by Joe
    Hi I am having no problem writing to or appending to a file, the only problem is that as soon as I quit the program and then run it again, it creates a new file overwriting my original file. This is a problem, as I am using the text file to keep a running tally. Is there a way to get an already created text file as an object and then append to it? Thanks in advance.

    Read the article

  • fprintf() within a subprogram

    - by sergio
    Im stuck when trying to write to my file within my subprogram. void new_page(float *a, float *b, float *c, int *d){ fprintf(results,"\nPage Totals: %f\t%f\t%f\t%d", *a,*b,*c,*d); } I get a warning saying "Warning: incompatible implicit declaration of built-in function 'fprinf' [enabled by default]" "error: 'results' undeclared (first use in this function)" in main fprintf works fine, its just when it comes to the subprogram/function it wont work. from my understanding it thinks that results is undeclared, so do i have to pass the name or location of the file to make it work?

    Read the article

  • How to open files in Java Swing without JFileChooser

    - by ron
    I'm using Java Swing (GUI) and I want to add a button to my project for opening files . I don't like the JFileChooser since it opens a small window for browsing through the files of the directories . Can I use something else , instead of the JFileChooser under Java Swing ? I've tried to use elements of SWT but it didn't work , meaning is the use of the button object and then use it inside the Jframe , but that failed , so I guess SWT and Swing don't mix together? Here is the example of Java Swing with JFileChooser and I'm looking for something like this to put in my JFrame.

    Read the article

  • Read from file in eclipse

    - by Buzkie
    I'm trying to read from a text file to input data to my java program. However, eclipse continuosly gives me a Source not found error no matter where I put the file. I've made an additional sources folder in the project directory, the file in question is in both it and the bin file for the project and it still can't find it. I even put a copy of it on my desktop and tried pointing eclipse there when it asked me to browse for the source lookup path. No matter what I do it can't find the file. here's my code in case it's pertinent: System.out.println(System.getProperty("user.dir")); File file = new File("file.txt"); Scanner scanner = new Scanner(file); in addition, it says the user directory is the project directory and there is a copy there too. I have no clue what to do. Thanks, Alex after attempting the suggestion below and refreshing again, I was greeted by a host of errors. FileNotFoundException(Throwable).<init>(String) line: 195 FileNotFoundException(Exception).<init>(String) line: not available FileNotFoundException(IOException).<init>(String) line: not available FileNotFoundException.<init>(String) line: not available URLClassPath$JarLoader.getJarFile(URL) line: not available URLClassPath$JarLoader.access$600(URLClassPath$JarLoader, URL) line: not available URLClassPath$JarLoader$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath$JarLoader.ensureOpen() line: not available URLClassPath$JarLoader.<init>(URL, URLStreamHandler, HashMap) line: not available URLClassPath$3.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] URLClassPath.getLoader(URL) line: not available URLClassPath.getLoader(int) line: not available URLClassPath.access$000(URLClassPath, int) line: not available URLClassPath$2.next() line: not available URLClassPath$2.hasMoreElements() line: not available ClassLoader$2.hasMoreElements() line: not available CompoundEnumeration<E>.next() line: not available CompoundEnumeration<E>.hasMoreElements() line: not available ServiceLoader$LazyIterator.hasNext() line: not available ServiceLoader$1.hasNext() line: not available LocaleServiceProviderPool$1.run() line: not available AccessController.doPrivileged(PrivilegedExceptionAction<T>) line: not available [native method] LocaleServiceProviderPool.<init>(Class<LocaleServiceProvider>) line: not available LocaleServiceProviderPool.getPool(Class<LocaleServiceProvider>) line: not available NumberFormat.getInstance(Locale, int) line: not available NumberFormat.getNumberInstance(Locale) line: not available Scanner.useLocale(Locale) line: not available Scanner.<init>(Readable, Pattern) line: not available Scanner.<init>(ReadableByteChannel) line: not available Scanner.<init>(File) line: not available code used: System.out.println(System.getProperty("user.dir")); File file = new File(System.getProperty("user.dir") + "/file.txt"); Scanner scanner = new Scanner(file);

    Read the article

  • Modifying File while in use using Java

    - by Marquinio
    Hi all, I have this recurrent Java JAR program tasks that tries to modify a file every 60seconds. Problem is that if user is viewing the file than Java program will not be able to modify the file. I get the typical IOException. Anyone knows if there is a way in Java to modify a file currently in use? Or anyone knows what would be the best way to solve this problem? I was thinking of using the File canRead(), canWrite() methods to check if file is in use. If file is in use then I'm thinking of making a backup copy of data that could not be written. Then after 60 seconds add some logic to check if backup file is empty or not. If backup file is not empty then add its contents to main file. If empty then just add new data to main file. Of course, the first thing I will always do is check if file is in use. Thanks for all your ideas.

    Read the article

< Previous Page | 38 39 40 41 42 43 44 45 46 47 48 49  | Next Page >