Search Results

Search found 93838 results on 3754 pages for 'aspire one'.

Page 422/3754 | < Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >

  • Windows freezes when watching videos

    - by cornerback84
    I have Acer laptop Aspire 5740 - 5780 with windows 7 Ultimate 32 bit. I am using Chrome. Windows is 1 year old, but it's not the first time this has happened. Windows freezes whenever I am watching videos on facebook/youtube or when using SopCast. I thought there was some faulty plugin, so I recently re-installed chrome but it happened again. No keys work, and the sound of whatever I am listening starts repeating like grrrr..drrrr. Its seems like the sound in very slow motion. One time I left it in this freeze state for 5 min and it recovered automatically. It usually does not happen when I am using windows media player. I had some codecs installed but I removed them to see if that fixes. So far, I have narrowed it down to youtube/footytube videos and sopcast. I have checked event logs but nothing special. Is there any way I can narrow down the problem or any suggestions on how to fix it. I'd like to add that it does not always happen. Sometimes windows goes days/weeks without freezing, and sometimes it take a min into video to freeze.

    Read the article

  • Best way to mask 2D sprites in XNA?

    - by electroflame
    I currently am trying to mask some sprites. Rather than explaining it in words, I've made up some example pictures: The area to mask (in white) Now, the red sprite that needs to be cropped. The final result. Now, I'm aware that in XNA you can do two things to accomplish this: Use the Stencil Buffer. Use a Pixel Shader. I have tried to do a pixel shader, which essentially did this: float4 main(float2 texCoord : TEXCOORD0) : COLOR0 { float4 tex = tex2D(BaseTexture, texCoord); float4 bitMask = tex2D(MaskTexture, texCoord); if (bitMask.a > 0) { return float4(tex.r, tex.g, tex.b, tex.a); } else { return float4(0, 0, 0, 0); } } This seems to crop the images (albeit, not correct once the image starts to move), but my problem is that the images are constantly moving (they aren't static), so this cropping needs to be dynamic. Is there a way I could alter the shader code to take into account it's position? Alternatively, I've read about using the Stencil Buffer, but most of the samples seem to hinge on using a rendertarget, which I really don't want to do. (I'm already using 3 or 4 for the rest of the game, and adding another one on top of it seems overkill) The only tutorial I've found that doesn't use Rendertargets is one from Shawn Hargreaves' blog over here. The issue with that one, though is that it's for XNA 3.1, and doesn't seem to translate well to XNA 4.0. It seems to me that the pixel shader is the way to go, but I'm unsure of how to get the positioning correct. I believe I would have to change my onscreen coordinates (something like 500, 500) to be between 0 and 1 for the shader coordinates. My only problem is trying to work out how to correctly use the transformed coordinates. Thanks in advance for any help!

    Read the article

  • Sharing password-protected videos on social media

    - by PaulJ
    We are developing a site where users will be able to watch and download videos that they've recorded of themselves in a public event. The videos will be password protected, and will be available only to users who have paid for them at the event... ...But on the other hand, we also want users to share those videos on social media, since they will be an attractive publicity for our events. Having people log into our site with their password, download the video and then re-upload it to Youtube/Facebook will be too cumbersome, and I suspect that few users will be willing to do that. So the obvious alternative is to have one of those convenient "share" buttons, but the problem with that approach will be that: The video will be physically hosted (and linked to) in our site. What happens if those videos go viral and our bandwidth cost explodes? The video is password protected. The solution I've thought of for this is: Upload the user's video to our (password-protected site) and to Youtube at the same time, as an unlisted video. The user can access our site with his password and download his video (to watch on his TV or whatever). If the users hits the "share" button, we show him the Youtube link... and we turn the video into a listed one. This seems in line with the ideas in Using YouTube as a CDN, and there didn't seem to be any objections in that question. I'm posting this just to confirm that my idea doesn't violate any Youtube TOS, and also to see if it is a good one or there might be better alternatives.

    Read the article

  • Implementing coroutines in Java

    - by JUST MY correct OPINION
    This question is related to my question on existing coroutine implementations in Java. If, as I suspect, it turns out that there is no full implementation of coroutines currently available in Java, what would be required to implement them? As I said in that question, I know about the following: You can implement "coroutines" as threads/thread pools behind the scenes. You can do tricksy things with JVM bytecode behind the scenes to make coroutines possible. The so-called "Da Vinci Machine" JVM implementation has primitives that make coroutines doable without bytecode manipulation. There are various JNI-based approaches to coroutines also possible. I'll address each one's deficiencies in turn. Thread-based coroutines This "solution" is pathological. The whole point of coroutines is to avoid the overhead of threading, locking, kernel scheduling, etc. Coroutines are supposed to be light and fast and to execute only in user space. Implementing them in terms of full-tilt threads with tight restrictions gets rid of all the advantages. JVM bytecode manipulation This solution is more practical, albeit a bit difficult to pull off. This is roughly the same as jumping down into assembly language for coroutine libraries in C (which is how many of them work) with the advantage that you have only one architecture to worry about and get right. It also ties you down to only running your code on fully-compliant JVM stacks (which means, for example, no Android) unless you can find a way to do the same thing on the non-compliant stack. If you do find a way to do this, however, you have now doubled your system complexity and testing needs. The Da Vinci Machine The Da Vinci Machine is cool for experimentation, but since it is not a standard JVM its features aren't going to be available everywhere. Indeed I suspect most production environments would specifically forbid the use of the Da Vinci Machine. Thus I could use this to make cool experiments but not for any code I expect to release to the real world. This also has the added problem similar to the JVM bytecode manipulation solution above: won't work on alternative stacks (like Android's). JNI implementation This solution renders the point of doing this in Java at all moot. Each combination of CPU and operating system requires independent testing and each is a point of potentially frustrating subtle failure. Alternatively, of course, I could tie myself down to one platform entirely but this, too, makes the point of doing things in Java entirely moot. So... Is there any way to implement coroutines in Java without using one of these four techniques? Or will I be forced to use the one of those four that smells the least (JVM manipulation) instead?

    Read the article

  • StyleCop Custom Rules

    - by Aligned
    There are several blogs on how to do this (http://scottwhite.blogspot.com/2008/11/creating-custom-stylecop-rules-in-c.html, etc). I’ve found a few useful things to point out: Debugging is difficult, but here are the steps (thanks to Tintin’s answer). “One way: 1) Delete your custom rules 2) Open Visual Studio (for dev), open your custom rule solution 3) Build & Deploy custom rules (a PostBuild action to copy the rules into the StyleCop folder is handy) 4) Open Visual Studio (for test) 5) Use VS (dev) and Attach to process devenv.exe (the test VS instance), set breakpoints in the rules you want to debug 6) Use VS’ (test) and right-click on project, Run StyleCop 7) Debug” ~ it worked once, now I’m having problems getting it to work again ~ I also get the message “Cannot evaluate expression because the code of the current method is optimized.” when I try to look at properties. Looking at the source code of the StyleCop.CSharp.Rules.dll that comes with the install. I used JustDecompile from Telerik. Create one xml file and name it the same as the one cs file (CodingGuildelineRules.cs and CodingGuidelinRules.xml) Deploy: 1. Build in Visual Studio 2. Close Visual Studio (Style cop is running so you can’t override your dll without closing) 3. Copy the dll from the bin to the C: \Program Files (x86)\StyleCop 4.7\ 4. Open the settings file or re-open Visual Studio

    Read the article

  • Precise: Evolution laggy due to IMAP -profile or due to some odd Sync -issue?

    - by Izzy
    I'm fighting with Evolution. Basically it's working fine -- but it is very slow to react in certain situations. There is apparently some problem with syncing and IMAP. Helper questios Could be that changing away from Bonobo has to do with slowing-down? There might be some trouble with the new engine and "asynchronous actions". What to do about it? I want to get the previous "working mood" back. How can I speed this thing up? Different scenarios when sending a mail, the composer window hangs there inactive for a couple of seconds, everything grayed out. Though there is a green check mark saying it's sent, I'm not sure a) why it's still blocking everything and b) whether I could simply close it without "breaking"/"losing" anything. In earlier versions, the composer window was closing pretty fast, and one could see the message being stored into the local "outbox" until it was sent, and one could immediately continue with the next task. I prefer that behaviour over the current. switching between modules. Coming from mail and switching to the address book takes a couple of seconds. Same for switching to the calendar. I read about different "possible causes" and tried a few things: I only have 3 local address books, so no networking should be involved here. To make sure, I switched to offline mode and then tried to access the address book. No noticeable difference. I use 3 Google Calendars. Switching to offline mode made a minor difference, but so minor that it also could be "imagination" since one might have expected this in this case according to some reports, disabling the tasks should help. Well, it didn't in my case, as I don't use them regularly (just two local items stored here)

    Read the article

  • Static DataTable or DataSet in a class - bad idea?

    - by Superbest
    I have several instances of a class. Each instance stores data in a common database. So, I thought "I'll make the DataTable table field static, that way every instance can just add/modify rows to its own table field, but all the data will actually be in one place!" However, apparently it's a bad idea to do use static fields, especially if it's databases: Don't Use "Static" in C#? Is this a bad idea? Will I run into problems later on if I use it? This is a small project so I can accept no testing as a compromise if that is the only drawback. The benefit of using a static database is that there can be many objects of type MyClass, but only one table they all talk to, so a static field seems to be an implementation of exactly this, while keeping syntax concise. I don't see why I shouldn't use a static field (although I wouldn't really know) but if I had to, the best alternative I can think of is creating one DataTable, and passing a reference to it when creating each instance of MyClass, perhaps as a constructor parameter. But is this really an improvement? It seems less intuitive than a static field.

    Read the article

  • Rails: The Law of Demeter [duplicate]

    - by user2158382
    This question already has an answer here: Rails: Law of Demeter Confusion 4 answers I am reading a book called Rails AntiPatterns and they talk about using delegation to to avoid breaking the Law of Demeter. Here is their prime example: They believe that calling something like this in the controller is bad (and I agree) @street = @invoice.customer.address.street Their proposed solution is to do the following: class Customer has_one :address belongs_to :invoice def street address.street end end class Invoice has_one :customer def customer_street customer.street end end @street = @invoice.customer_street They are stating that since you only use one dot, you are not breaking the Law of Demeter here. I think this is incorrect, because you are still going through customer to go through address to get the invoice's street. I primarily got this idea from a blog post I read: http://www.dan-manges.com/blog/37 In the blog post the prime example is class Wallet attr_accessor :cash end class Customer has_one :wallet # attribute delegation def cash @wallet.cash end end class Paperboy def collect_money(customer, due_amount) if customer.cash < due_ammount raise InsufficientFundsError else customer.cash -= due_amount @collected_amount += due_amount end end end The blog post states that although there is only one dot customer.cash instead of customer.wallet.cash, this code still violates the Law of Demeter. Now in the Paperboy collect_money method, we don't have two dots, we just have one in "customer.cash". Has this delegation solved our problem? Not at all. If we look at the behavior, a paperboy is still reaching directly into a customer's wallet to get cash out. EDIT I completely understand and agree that this is still a violation and I need to create a method in Wallet called withdraw that handles the payment for me and that I should call that method inside the Customer class. What I don't get is that according to this process, my first example still violates the Law of Demeter because Invoice is still reaching directly into Customer to get the street. Can somebody help me clear the confusion. I have been searching for the past 2 days trying to let this topic sink in, but it is still confusing.

    Read the article

  • How to plan/manage multi-platform (mobile) products?

    - by PhD
    Say I've to develop an app that runs on iOS, Android and Windows 8 Mobile. Now all three platforms are technically in different program languages. The only 'reuse' that I can see is that of the boxes-and-lines drawings (UML :) charts and nothing else. So how do companies/programmers manage the variation of the same product across different platforms especially since the implementation languages differ? It's 'easier' in the desktop world IMO given the plethora of languages and cross-platform libraries to make your life easier. Not so in the mobile world. More so, product line management principles don't seem to be all that applicable - what is same and variant doesn't really matter - the application is the same (conceptually) and the implementation is variant. Some difficulties that come to mind: Bug Fixing: Applications maybe designed in a similar manner but the bug identification and fixing would be radically different. A bug on iOS may/may-not be existent for that on Android. Or a bug fix approach on one platform may not be the same on another (unless it's a semantic bug like a!=b instead of a==b which would require the same 'approach' to fixing in essence Enhancements: Making a change on one platform would be radically different than on another Code-Design Divergence: They way the code is written/organized, the class structures etc., could be very different given the different implementation environments - leading to further reuse of the (above) UML models. There are of course many others - just keeping the development in sync and making sure all applications are up to the same version with the same set of features etc. Seems the effort is 3x that of a single application. So how exactly does one manage this nightmarish situation? Some thoughts: Split application to client/server to minimize the effect to client side only (not always doable) Use frameworks like Unity-3D that could take care of the cross-platform problem (mostly applicable to games and probably not to other applications etc.) Any other ways of managing a platform line? What are some proven approaches to managing/taming the effects?

    Read the article

  • Which things instantly ring alarm bells when looking at code? [closed]

    - by FinnNk
    I attended a software craftsmanship event a couple of weeks ago and one of the comments made was "I'm sure we all recognize bad code when we see it" and everyone nodded sagely without further discussion. This sort of thing always worries me as there's that truism that everyone thinks they're an above average driver. Although I think I can recognize bad code I'd love to learn more about what other people consider to be code smells as it's rarely discussed in detail on people's blogs and only in a handful of books. In particular I think it'd be interesting to hear about anything that's a code smell in one language but not another. I'll start off with an easy one: Code in source control that has a high proportion of commented out code - why is it there? was it meant to be deleted? is it a half finished piece of work? maybe it shouldn't have been commented out and was only done when someone was testing something out? Personally I find this sort of thing really annoying even if it's just the odd line here and there, but when you see large blocks interspersed with the rest of the code it's totally unacceptable. It's also usually an indication that the rest of the code is likely to be of dubious quality as well.

    Read the article

  • Task scheduled to wake laptop - only works when lid is open

    - by JD Pack
    I am running Windows 7 Starter on an Acer Aspire One laptop. I want my laptop to automatically run a task (backup the HDD to a network drive) once a week in the middle of the night. I scheduled the task in "Task Scheduler" and checked the box to wake the computer to run the task. I also changed the advanced power settings to allow wake timers. This was half of the solution. It now works flawlessly when the lid is open... the computer can wake itself up from either sleep or hibernate mode to perform the backup. When the lid is closed however, its sleeping beauty. Any ideas? I don't want to have to remember to open the lid once a week. It sort of defeats the purpose of an "automatic" backup. Update: I discovered that it can wake from sleep (or hybrid sleep), but not from hibernate when the lid is closed. This is good news. I'd still be curious about how to get it to work from hibernate, but I'm pretty happy about waking from sleep at least.

    Read the article

  • Assigning a script to a keystroke to toggle touchpad

    - by sodiumnitrate
    Since my default sony vaio shortcuts don't completely work in Ubuntu 12.04, I'd like to assign a script to Fn + F1, which toggles the touchpad on and off, so that the cursor would stop moving while I'm typing. Since I use a mouse and rarely need to use the touchpad, I don't want to use "disable touchpad while writing", which doesn't really seem to work anyway. I figured that using a script with the following command (this works, but I have to open up a terminal each time): xinput set-prop 12 "Device Enabled" 0 I have two problems at this point. One is that I don't know how to write this script so that it will toggle it off if it is on, and on if it is off. I know I should use an if statement but I don't know what value I should be checking to see if it is on or off. The second one is that I am having problems creating a new shortcut. I use System Settings - Keyboard - Shortcuts. I tried to add, to custom shortcuts, a new one by clicking the '+' sign. I named it Toggle Touchpad, and added the path to the executable script with the line above, by typing /home/irem/.toggletouchpad I have made it an executable with chmod. The problem is that when I click apply, and then click back on it to define the keystroke, it re-opens the dialogue. I cannot define new keys. (It says disabled on the right column of the entry). I have also tried xbindkeys, which almost constantly crashes. I'd prefer the system settings, if I can set the shortcut. I'd appreciate if anyone can help. Thanks.

    Read the article

  • Adding files and folders to a Root Folder (inode/directory)

    - by xBaldwin
    Ok so I'm fairly new to Ubuntu and wasn't even the one who put it one this computer(my friend did while I was storing it at his house because I was in the middle of transitioning between houses), but It's on here so I need to learn what I can so I can use it more effectively. My question at the moment is "Would it be safe to add files/folders to a folder (inode/directory) that requires Root access?" I continue to be informed by the system that the directory I am using is running low on space which I found odd seeing how I should have a lot more room on this computer. That's when I started looking at the directories and found that there are two with a bunch of un-used space on them. One says it has 46.9 GB of free space and the other has 24.9 GB of free space. Seems like a complete waste to not use that space and yet they both say they require Root access to add to them. I know that Root folders and files are normally all system folders and files. I also know that changing or deleting them can mess up the computer which right now I cant afford to do. I just don't know if it would mess anything up to add something to those folders. Thank you in advance to anyone who takes the time to reply and try to teach me about how all that works. I really do appreciate it and will do the same if by some crazy (completely unlikely) reason I have an answer to your question. :-)`

    Read the article

  • The most efficent ways for drawing lines all day long with OpenGL

    - by nkint
    I'd like to put a computer screen that is running an OpenGL programs in a room. It has to run all day long (not in the night). I'd like to draw lines that are slowly fading in the background. The setting is simple: a uniform color background (say, black) and colored lines (say, white) that are slowly fading out. With slowly I mean.. hours. Say that the first line I draw is with alpha 255 (fully visible), after one hours is 240. After 10 hours is 105. One line could have 250 points and there will be like 300 line in one day. For now I have done a prototype with very rudimentary method like: glBegin( GL_LINE_STRIP ); iterator = point_list.begin(); for (++iterator, end = point_list.end(); iterator != end; ++iterator) { const Vec3D &v = *iterator; glVertex2f(v.x(), v.y()); } glEnd(); More efficient method?

    Read the article

  • Homepage not showing on Google

    - by MIke Mayberry
    About six weeks ago my homepage (mayberrykayakingdotcodotuk) disappeared from the google organic search for "kayaking pembrokeshire" despite it having been number 2 within a few weeks of it's launch last summer. My previous site (www.mikemayberrykayakingdotcodotuk) had been 2nd for about six years and has 301 redirects for all pages to the new site. Google toolbar still rates the homepage as 3/10 and the domain is still showing in search results, just not the homepage. A little research suggests that this is most likely to be due to an issue with google treating two pages as identical content (one with www. and one with not) since the changes in their algorithms around that time and that the way to fix this is to add some code somewhere. This makes sense to me as my print advertising doesn't have the www part of the address. I have cpanel access but a limited knowledge on web coding, having picked things up as I've gone along and paid for designers etc., when needed. Would someone be able to let me know where I have to go to add the code and what code I need to add to redirect the crawlers to one page? Or is there another issue that is causing this? Thanks in advance.

    Read the article

  • def constrainedMatchPair(firstMatch,secondMatch,length):

    - by smart
    matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

    Read the article

  • emacs keybindings

    - by Max
    I read a lot about vim and emacs and how they make you much more productive, but I didn't know which one to pick. Finally when I decided to teach myself common lisp, the decision was straight forward: everybody says that there's no better editor for common lisp, than emacs + slime. So I started with emacs tutorial and immediately I ran into something that seems very unproductive to me. I'm talking about key bindings for cursor keys: forward/backward: Ctrl+f, Ctrl+b up/down: Ctrl+p, Ctrl+n I find these bindings very strange. I assume that fingers should be on their home rows (am I wrong here?), so to move cursor forward or backward I should use my left index finger and for up and down right pinky and right index fingers. When working with any of Windows IDEs and text editors to navigate text I usually place my right hand in a position so that my thumb is on the right ctrl and my index, ring and middle fingers are on the cursor keys. From this position it is very easy and comfortable to move cursor: I can do one-character moves with my 3 right fingers, or I can press ctrl with my right thumb and do word-moves instead. Also I can press shift with my left pinky and do single-character or word selections. Also it is a very comfortable position to reach PgUp, PgDn, Home, End, Delete and Backspace keys with my right hand. So I have even more navigation and selection possibilities. I understand that the decision not to use cursor keys is to allow one to use emacs to connect to remote terminal sessions, where these keys are not supported, but I still find the choice of cursor keys very unfortunate. Why not to use j, k, i, l instead? This way I could use my right hand without much finger stretching. So how is emacs more productive? What am I doing wrong?

    Read the article

  • Is it a good programming practice to have a class with several .h files?

    - by Jim Thio
    I suppose the class have several different interfaces. Some it shows to some class, some it shows to other classes. Are there any good reason for that? One thing I can think of is with one .h per class, interface would either be public or private. What about if I want some interface to be available to some friends' class and some interface to be truly public? Sample: @interface listNewController:BadgerStandardViewViewController <UITableViewDelegate,UITableViewDataSource,UITextFieldDelegate,NSFetchedResultsControllerDelegate,UIScrollViewDelegate,UIGestureRecognizerDelegate> { } @property (nonatomic) IBOutlet NSFetchedResultsController *FetchController; @property (nonatomic) IBOutlet UITextField *searchBar1; @property (nonatomic) IBOutlet UITableView *tableViewA; + (listNewController *) singleton; //For Easier Access -(void)collapseAll; -(void)TitleViewClicked:(TitleView *) theTitleView; -(NSUInteger) countOfEachSection:(NSInteger)section; @end Many of those public properties and function are only ever called by just one other classes. I wonder why I need to make them available to many classes. It's in Objective-c by the way

    Read the article

  • How to move ubuntu 12.04 on another drive

    - by Maksim
    How I can move my ubuntu on another drive? I know about clonezilla but problem is that destination drive is smaller the source one. Gparted can't copy-paste partition if destination not the end last partition. I tried dpkg --selected-packages and apt-clone. First one just not install all my packages and removed existed that now I have no full unity and not my all packages. Second one just fail on configuration package. But before I did that way I copy-paste my /etc to new system. My partition table destination : gpt 1 1049kB 106MB 105MB fat32 EFI System ??????????? 2 106MB 12,1GB 12,0GB ext4 3 12,1GB 66,3GB 54,2GB ext4 source: msdos 1 1049kB 12,0GB 12,0GB primary ext4 ??????????? 2 12,0GB 492GB 480GB primary ext4 3 492GB 500GB 8107MB primary linux-swap(v1) Gpt not working with ubuntu that use grub 1.99. I don't know why but my laptop can't boot any device with uefi just black screen and ubuntu detect it on fresh install.

    Read the article

  • Windows 7: Wi-Fi connection drops intermittently - only returns after "Troubleshoot connection" resets the adapter

    - by sleske
    On our laptop (running Windows 7) the Wi-Fi connection drops intermittently. Symptoms: Connectivity is suddenly lost, and the "signal strenght" indicator in the tray shows zero strength and a yellow "star" symbol. What happens then: The problem does not resolve itself by just waiting. If I click on the tray icon, the "Windows network diagnostics" wizard pops up and tells me that there is a networking problem (duh). If I click on the "repair" button (not sure about the wording), the wizard works for a while, then reports that it has reset the network adapter. Then Wi-Fi works again. While the above procedure has worked every time so far, it is very annoying. It takes 10-20s to repair the connection, and in the meantime downloads, video streams etc. may have been aborted. Some more details: The problem occurs without any apparent regularity, but usually a few minutes after powerup (though not every time). It happens frequently enough to be annoying. It is unlikely to be a router problem - another laptop running at the same time usually has no Wi-Fi problems. I am at a loss about what to try to troubleshoot this. Any ideas? Computer: Acer Aspire 7739Z. Wi-Fi card: Atheros AR5B125

    Read the article

  • Coordinate spaces and transformation matrices

    - by Belgin
    I'm trying to get an object from object space, into projected space using these intermediate matrices: The first matrix (I) is the one that transforms from object space into inertial space, but since my object is not rotated or translated in any way inside the object space, this matrix is the 4x4 identity matrix. The second matrix (W) is the one that transforms from inertial space into world space, which is just a scale transform matrix of factor a = 14.1 on all coordinates, since the inertial space origin coincides with the world space origin. /a 0 0 0\ W = |0 a 0 0| |0 0 a 0| \0 0 0 1/ The third matrix (C) is the one that transforms from world space, into camera space. This matrix is a translation matrix with a translation of (0, 0, 10), because I want the camera to be located behind the object, so the object must be positioned 10 units into the z axis. /1 0 0 0\ C = |0 1 0 0| |0 0 1 10| \0 0 0 1/ And finally, the fourth matrix is the projection matrix (P). Bearing in mind that the eye is at the origin of the world space and the projection plane is defined by z = 1, the projection matrix is: /1 0 0 0\ P = |0 1 0 0| |0 0 1 0| \0 0 1/d 0/ where d is the distance from the eye to the projection plane, so d = 1. I'm multiplying them like this: (((P x C) x W) x I) x V, where V is the vertex' coordinates in column vector form: /x\ V = |y| |z| \1/ After I get the result, I divide x and y coordinates by w to get the actual screen coordinates. Apparenly, I'm doing something wrong or missing something completely here, because it's not rendering properly. Here's a picture of what is supposed to be the bottom side of the Stanford Dragon: Also, I should add that this is a software renderer so no DirectX or OpenGL stuff here.

    Read the article

  • why doesn't my computer resume after sleeping overnight?

    - by bamdad
    i'm having a weird, weird bug that's been haunting me since 11.10. if i listen to music or watch a video and my computer automatically goes to sleep at night, it won't properly resume in the morning. otherwise, suspend and resume works just fine. what happens is that the wi-fi and bluetooth indicator (that turns from white to orange when suspending) stays orange, the display doesn't turn on, and the only option i have is to hard reset the machine. here's what i've tried so far: installing (and uninstalling and reinstalling) laptop-mode-tools switching the proprietary wireless driver (broadcom-wl) to the open source one (brcmsmac & bcma) and back unloading (and blacklisting) all bluetooth modules (rfcomm, btusb, bnep, bluetooth) and stopping (# stop bluetooth) and disabling (# echo 'manual' /etc/init/bluetooth.override) the bluetooth service creating a custom pm sleep action as suggested here: http://ubuntuforums.org/showthread.php?p=11926504 not watching youtube / any stuff that uses flash before going to sleep (i have flashblock, and i checked $ ps aux | grep flash) because i suspected flash to be the culprit trying out different versions of fglrx (the one from the repos, then installing the latest one from amd's site via generated .deb files, then back to the official ones) none of these worked. i remember back in the days of 10.04, there was a gconf key called network sleep: i thought about disabling that, since re-enabling the wireless card seems to be the problem (according to the indicator led), but the option appears to be missing from gnome 3 (unity-2d, whatever). does anyone have any ideas? thanks, bamdad

    Read the article

  • Creating Ubuntu Browser App Frames

    - by user73006
    After watching the video i am inspired to create one browser but stuck at one place, could you please help me with this. Requirement = - Like you displayed in your Video i wan create Multiple Buttons in my Toolbar which will open Second ToolBar or Popup Window. - From that Pop Window i wanted to Select Specific Button Which will open My Required Browser. Question - - As displayed in your Video i create new BUtton and If i try to open new link using that it works but now i want to display tool bar or Popup window once any one click on that button, how can i do that.The Second Tool Bar Need to be Activated only after clicking on that button. Things i Tried - - As per my understanding i create Second Toolbar and on that tool bar i have created Button, now i wan know how do i link that tool bar with my Browser Toolbar button. - I tried that by passing Signal Property in Second Toolbar in Quickly but something is missing. MY Code class TvbrowserWindow(Window): gtype_name = "TvbrowserWindow" def finish_initializing(self, builder): # pylint: disable=E1002 """Set up the main window""" super(TvbrowserWindow, self).finish_initializing(builder) self.AboutDialog = AboutTvbrowserDialog self.PreferencesDialog = PreferencesTvbrowserDialog # Code for other initialization actions should be added here. self.refreshbutton=self.builder.get_object("refreshbutton") self.SONY=self.builder.get_object("SONY") self.urlentry=self.builder.get_object("urlentry") self.scrolledwindow1=self.builder.get_object("scrolledwindow1") self.webview = WebKit.WebView() self.scrolledwindow1.add(self.webview) self.webview.show() def on_refreshbutton_clicked(self, widget): print "refresh" def on_urlentry_activate(self, widget): url = widget.get_text() print url self.webview.open(url)

    Read the article

  • Setting up a Google Analytics Campaign

    - by Ashfame
    I will be doing a bunch of things to give one of my projects (main app) a big initial push for which I will be building a few small Facebook apps which will help in promoting the main apps. Traffic from these apps need to be tracked individually. My main app will be posting on the walls when the user needs to be notified. Traffic from these posts need to be tracked. Traffic from emails sent by the main app need to be tracked, like different types of email. I need to track all of these & possibly a couple of more but I need to be sure that I build my campaign URLs correctly as I won't get another chance to fix it. Correct me where I am wrong: Campaign Name: Launch Campaign Medium: Email Campaign Source: Type1 or Type2 (I can break it down for different types of email, right?) For apps: Campaign Name: Launch Campaign Medium: Apps Campaign Source: App1 or App2 (I can break it down here for different apps, right?) What if I want to track two different links within a single email or a single app? Any way of tracking them individually too but still keeping to track them as one because tracking them as one makes more sense for me. Campaign Term & Campaign content is irrelevant in my case, or I can/should use them for something? And I will also be tracking traffic of different apps. Should I do more? Let me know if my scenario wasn't clear enough & I need to explain more.

    Read the article

  • What is the program "Additional Drivers" (jockey-gtk) talking me about?

    - by Robert Vila
    The program says: "No proprietary drivers are in use on this system" But it doesn't say if it is talking about graphical drivers only or what. Then, it lists two drivers: NVIDIA accelerated graphics driver (version 173). NVIDIA accelerated graphics driver (version current) [recomended] Both have exactly the same description. What is the difference then? When I select the 1st one, it says: "This river is not activated",and there's a button to "activate" it. When I select the 2nd one, it says: "This river is activated but it is not currently in use", and the button is to "remove". So which one is in use? Why or what for should I have activated (enabled) and not in use? If it is in use it is activated? What is the difference between activate and remove? and what is the relationship between installed, activated, in use, enabled and removed, disabled, inactive and not-installed? Why can I activate the inactivated and remove (but not deactivate) the activated that is not in use? All this is very puzzling... What other drivers can I use for an Apple MacBook pro 3,1 and how? I see that there's a nouveau and I heard that there was going to be a new open source even better. > -display > description: VGA compatible controller > product: G84 [GeForce 8600M GT] > vendor: nVidia Corporation

    Read the article

< Previous Page | 418 419 420 421 422 423 424 425 426 427 428 429  | Next Page >