Search Results

Search found 19742 results on 790 pages for 'search tree'.

Page 429/790 | < Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >

  • How can I find the names of AD Group policies that a user/pc is using?

    - by Russ
    I am having trouble locating some settings in group policy so I can make changes due to the convoluted nature of our policies. What I would like to be able to do is go to a specific PC and see what group policies are being applied, so I can focus on those policies. My goal would be to clean up the GP's a bit, while allowing me to "walk the tree" to see what people have implemented and what is worthless. Thanks. EDIT: In this specific case, I am looking to find which GP maped drives are configured in. (User Configuration -- Preferences -- Windows Settings -- Drive Maps)

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

  • How to let Linux Python application handle termination on user logout correctly?

    - by tuxpoldo
    I have written a Linux GUI application in Python that needs to do some cleanup tasks before being terminated when the user logs out. Unfortunately it seems, that on logout, all applications are killed. I tried both to handle POSIX signals and DBUS notifications, but nothing worked. Any idea what I could have made wrong? On application startup I register some termination handlers: # create graceful shutdown mechanisms signal.signal(signal.SIGTERM, self.on_signal_term) self.bus = dbus.SessionBus() self.bus.call_on_disconnection(self.on_session_disconnect) When the user logs out, neither self.on_signal_term nor self.on_session_disconnect are called. The problem occurs in several scenarios: Ubuntu 14.04 with Unity, Debian Wheezy with Gnome. Full code: https://github.com/tuxpoldo/btsync-deb/tree/master/btsync-gui

    Read the article

  • How to install libcrypt-ssleay-perl in Ubuntu?

    - by Deqing
    When I tried to install libcrypt-ssleay-perl, it says: $ sudo apt-get install libcrypt-ssleay-perl Reading package lists... Done Building dependency tree Reading state information... Done Some packages could not be installed. This may mean that you have requested an impossible situation or if you are using the unstable distribution that some required packages have not yet been created or been moved out of Incoming. The following information may help to resolve the situation: The following packages have unmet dependencies: libcrypt-ssleay-perl : Depends: perlapi-5.12.4 but it is not installable E: Unable to correct problems, you have held broken packages. This perlapi-5.12.4 is actually a virtual package provided by perl-base, which I had already installed: $ dpkg -l|grep perl-base ii perl-base 5.14.2-6ubuntu2.1 minimal Perl system So what should I do to install libcrypt-ssleay-perl now?

    Read the article

  • Approach for caching data from data logger

    - by filip-fku
    Greetings, I've been working on a C#.NET app that interacts with a data logger. The user can query and obtain logs for a specified time period, and view plots of the data. Typically a new data log is created every minute and stores a measurement for a few parameters. To get meaningful information out of the logger, a reasonable number of logs need to be acquired - data for at least a few days. The hardware interface is a UART to USB module on the device, which restricts transfers to a maximum of about 30 logs/second. This becomes quite slow when reading in the data acquired over a number of days/weeks. What I would like to do is improve the perceived performance for the user. I realize that with the hardware speed limitation the user will have to wait for the full download cycle at least the first time they acquire a larger set of data. My goal is to cache all data seen by the app, so that it can be obtained faster if ever requested again. The approach I have been considering is to use a light database, like SqlServerCe, that can store the data logs as they are received. I am then hoping to first search the cache prior to querying a device for logs. The cache would be updated with any logs obtained by the request that were not already cached. Finally my question - would you consider this to be a good approach? Are there any better alternatives you can think of? I've tried to search SO and Google for reinforcement of the idea, but I mostly run into discussions of web request/content caching. Thanks for any feedback!

    Read the article

  • How do I install the latest Sun Java JRE on Ubuntu Server 9.10?

    - by blackrobot
    Unfortunately, if I try to install sun-java via apt-get, it's not found in the repositories. # apt-get install sun-java6-jre Reading package lists... Done Building dependency tree Reading state information... Done Package sun-java6-jre is not available, but is referred to by another package. This may mean that the package is missing, has been obsoleted, or is only available from another source E: Package sun-java6-jre has no installation candidate If I try to install it using the bin from Sun's website, here's the issue: # ./jre-6u18-linux-i586.bin (license agreement...) Do you agree to the above license terms? [yes or no] yes Unpacking... Checksumming... Extracting... ./jre-6u18-linux-i586.bin: 366: ./install.sfx.10648: not found Failed to extract the files. Please refer to the Troubleshooting section of the Installation Instructions on the download page for more information. Thanks for the help.

    Read the article

  • Which cms or script for social network wiki?

    - by Jason
    Hi, I am building a social network. I need a cms that will allow users to contribute content. Each content item will need to have a google map, list of features, ratings, comments, etc. And the content must be editable by other users with revision control. Also, each user should have a profile with their bookmarked content items, contributed items, comments, etc. It's very important that I can create a template for the wiki/content entries so that each item looks uniform. (and as a kick in the teeth, I would like to be able to search for wiki items using a radial search or map) Joomla was my first choice, as I've used it for many projects, but the wiki functionality is not there. I was also setting up a grou.ps site, but the wiki is so-so - not feature rich and it really doesn't have the option I need. Additionally, I know someone out there will mention Drupal. I may consider it if I can see it put to use without and overabundance of custom programming (I don't mind initial coding, but drupal requires constant coding & recoding - with this site, I dont' have that time commitment) I thought about using mediawiki with buddypress, but i'm not sure if that's the way to go. Thoughts?

    Read the article

  • MySQL running on an EC2 m1.small instance has high load but low memory usage, possible resolutions?

    - by Tosh
    I have a MySQL server 5.0.75 Ubuntu, on an m1.small instance running on Amazon's EC2 as part of an application. During peak usage the server load will rise very high, while the memory usage stays low and the application server is no longer responsive since it's waiting for query results. The application server has only 5-8 apache processes running (mod_perl processes). The data directory uses only 140MB of data so the MyIsam tables aren't very big. The queries are pretty complicated with some big joins being performed, and the application makes a lot of queries. mysqltuner reports everything OK except "Maximum possible memory usage: 1.7G (99% of installed RAM)" but I'm nowhere close to using that. My question is, where should I be looking to fix this? Is this something that can be tuned away, or do I just need a larger instance/server? Googling indicates either or also upgrading MySQL server. Any pointers in the right direction would be greatly appreciated, thanks! EDIT: I just discovered this in my slow queries log: # Time: 101116 11:17:00 # User@Host: user[pass] @ [host] # Query_time: 4063 Lock_time: 1035 Rows_sent: 0 Rows_examined: 19960174 SELECT * FROM contacts WHERE contacts.contact_id IN (SELECT external_id FROM contact_relations WHERE external_table = 'contacts' AND contact_id IN (SELECT contact_id FROM contacts WHERE (company_name like '%%butan%%%' OR country like '%%butan%%%' OR city like '%%butan%%%' OR email1 like '%%butan%%%') AND (company_name is not null and company_name != ''))); Which actually brings up a different but related question: If I have a contact table containing: John Smith,The Fun Factory,555-1212,[email protected] What's the best way to search for that record using "factory" as a search key? Fulltext rarely seems to find items in the middle of a word, for example "actor" should bring up "Factory"

    Read the article

  • jquery parent/children selector for counting <li>

    - by Kreker
    Hi. I have this piece of HTML <div id="fileTreeInviati"> <ul class="php-file-tree"> <li class="pft-directory"> <a href="#" class="" name="101">A006 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-png"> <a href="javascript:getInfoFile('4');" class="" id="4">cut.png</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('27');" class="new" id="27">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="102">A012 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-jpg"> <a href="javascript:getInfoFile('19');" class="new" id="19">04.jpg</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('24');" class="new" id="24">Safari.dll</a> </li> </ul> </li> <li class="pft-directory"> <a href="#" class="" name="103">A014 - SOMETEXT (<span name="contaNew"></span>)</a> <img src="./moduli/home/images/info.png" title="Informazioni Azienda" class="imgInfo"/> <ul style="display: none;"> <li class="pft-file ext-txt"> <a href="javascript:getInfoFile('17');" class="new" id="17">acu.txt</a> </li> <li class="pft-file ext-dll"> <a href="javascript:getInfoFile('22');" class="new" id="22">Safari.dll</a> </li> </ul> </li> </ul> I'm working on a js snippet that cycle through all "a" of the "li" and checks if it has the class "new" if yes increment a counter by one. This counter now has to be printed on the relative "li" "span" 3 level before. So I have the number of the element with the "new" class. The js snippet is this $("#fileTreeInviati .php-file-tree .pft-directory li").each(function(){ $(this).children("a").each(function(i,e){ if ($(e).hasClass("new")){ cont++; console.log($(e).text()); $(this).parent().parent().parent().children("a").children("span").text(cont); } }) cont = 0; }); I think I'm almost there but the counter is always 1. I think there is something mess with .children, maybe it can handle only the first occurrence? Thanks for help

    Read the article

  • Statistical analysis on large data set to be published on the web

    - by dassouki
    I have a non-computer related data logger, that collects data from the field. This data is stored as text files, and I manually lump the files together and organize them. The current format is through a csv file per year per logger. Each file is around 4,000,000 lines x 7 loggers x 5 years = a lot of data. some of the data is organized as bins item_type, item_class, item_dimension_class, and other data is more unique, such as item_weight, item_color, date_collected, and so on ... Currently, I do statistical analysis on the data using a python/numpy/matplotlib program I wrote. It works fine, but the problem is, I'm the only one who can use it, since it and the data live on my computer. I'd like to publish the data on the web using a postgres db; however, I need to find or implement a statistical tool that'll take a large postgres table, and return statistical results within an adequate time frame. I'm not familiar with python for the web; however, I'm proficient with PHP on the web side, and python on the offline side. users should be allowed to create their own histograms, data analysis. For example, a user can search for all items that are blue shipped between week x and week y, while another user can search for sort the weight distribution of all items by hour for all year long. I was thinking of creating and indexing my own statistical tools, or automate the process somehow to emulate most queries. This seemed inefficient. I'm looking forward to hearing your ideas Thanks

    Read the article

  • Escape characters in MySQL, in Ruby

    - by Swards
    I have a couple escaped characters in user-entered fields that I can't figure out. I know they are the "smart" single and double quotes, but I don't know how to search for them in mysql. The characters in ruby, when output from Ruby look like \222, \223, \224 etc irb> "\222".length => 1 So - do you know how to search for these in mysql? When I look in mysql, they look like '?'. I'd like to find all records that have this character in the text field. I tried mysql> select id from table where field LIKE '%\222%' but that did not work. Some more information - after doing a mysqldump, this is how one of the characters is represented - '\\xE2\\x80\\x99'. It's the smart single quote. Ultimately, I'm building an RTF file and the characters are coming out completely wrong, so I'm trying to replace them with 'dumb' quotes for now. I was able to do a gsub(/\222\, "'"). Thanks.

    Read the article

  • Best way of showing more results with javascript/css

    - by Ricardo Neves
    I'm developing a website and i'm having troubles showing the search results to the user the way I want. Basically, after the user search, the page makes a couple of ajax requests and as soon as a response arrive it appends the info to a specific element on my page. Each results is shown as a line... The problem is that in most case there are going to be more than 1000 results and this would make the page have a large scroll. My idea was to show only the first 15 results and when the user clicks "show more" the element would expand and show the next 15 results and so on... This would be easier to do if the website wasn't responsive, but because it is I can't find the proper way of implementing what I want without lowering the website perfomance. I have "2 ideas": The first is by using something like #element .div:nth-child(-n+15) on my css and figure a way of changing the "15" to how much results I want to show... I don't know if this can be done. Is it possible to call css rules with parameters? Maybe with less css? The second option is probably a bad option if i don't want to lower the website performance. Using javascript I would check if there is a specific css class(like .show-15 .show30 .show45) and add that class to my element and if it don't exist, create it somehow.. Any help would be appreciated.

    Read the article

  • Outlook 2007 inbox message grouping like the Web App

    - by Heki
    The Outlook Web App has this nice, default, conversation grouping. It hides all earlier messages in a conversation from the message list. When I click a mail, it shows the conversation thread in the reading pane. In Outlook 2007 I have tried grouping on received date, but it groups by minutes and not days. I've also tried grouping by conversation, but then I get this ugly tree in the list pane and I loose the "today", "yesterday", and vice versa groups. So how do I make Outlook 2007 look like the Outlook Web App? Illustration

    Read the article

  • How can I filter images and use filesystemview icons in my jtree?

    - by HoLeX
    First of all sorry about my english. So, i have some problems with my JTree because i want to filter specific types of images and also i want to use icons of FileSystemView class. Can you help me? I will appreciate so much. Here is my code: import java.awt.BorderLayout; import java.io.File; import java.util.Iterator; import java.util.Vector; import javax.swing.JPanel; import javax.swing.JTree; import javax.swing.event.TreeModelEvent; import javax.swing.event.TreeModelListener; import javax.swing.event.TreeSelectionEvent; import javax.swing.event.TreeSelectionListener; import javax.swing.tree.TreeModel; import javax.swing.tree.TreePath; public class ArbolDirectorio extends JPanel { private JTree fileTree; private FileSystemModel fileSystemModel; public ArbolDirectorio(String directory) { this.setLayout(new BorderLayout()); this.fileSystemModel = new FileSystemModel(new File(directory)); this.fileTree = new JTree(fileSystemModel); this.fileTree.setEditable(true); this.fileTree.addTreeSelectionListener(new TreeSelectionListener() { @Override public void valueChanged(TreeSelectionEvent event) { File file = (File) fileTree.getLastSelectedPathComponent(); System.out.println(getFileDetails(file)); } }); this.add(fileTree, BorderLayout.CENTER); } private String getFileDetails(File file) { if (file == null) { return ""; } StringBuffer buffer = new StringBuffer(); buffer.append("Name: " + file.getName() + "\n"); buffer.append("Path: " + file.getPath() + "\n"); return buffer.toString(); } } class FileSystemModel implements TreeModel { private File root; private Vector listeners = new Vector(); public FileSystemModel(File rootDirectory) { root = rootDirectory; } @Override public Object getRoot() { return root; } @Override public Object getChild(Object parent, int index) { File directory = (File) parent; String[] children = directory.list(); return new TreeFile(directory, children[index]); } @Override public int getChildCount(Object parent) { File file = (File) parent; if (file.isDirectory()) { String[] fileList = file.list(); if (fileList != null) { return file.list().length; } } return 0; } @Override public boolean isLeaf(Object node) { File file = (File) node; return file.isFile(); } @Override public int getIndexOfChild(Object parent, Object child) { File directory = (File) parent; File file = (File) child; String[] children = directory.list(); for (int i = 0; i < children.length; i++) { if (file.getName().equals(children[i])) { return i; } } return -1; } @Override public void valueForPathChanged(TreePath path, Object value) { File oldFile = (File) path.getLastPathComponent(); String fileParentPath = oldFile.getParent(); String newFileName = (String) value; File targetFile = new File(fileParentPath, newFileName); oldFile.renameTo(targetFile); File parent = new File(fileParentPath); int[] changedChildrenIndices = { getIndexOfChild(parent, targetFile) }; Object[] changedChildren = { targetFile }; fireTreeNodesChanged(path.getParentPath(), changedChildrenIndices, changedChildren); } private void fireTreeNodesChanged(TreePath parentPath, int[] indices, Object[] children) { TreeModelEvent event = new TreeModelEvent(this, parentPath, indices, children); Iterator iterator = listeners.iterator(); TreeModelListener listener = null; while (iterator.hasNext()) { listener = (TreeModelListener) iterator.next(); listener.treeNodesChanged(event); } } @Override public void addTreeModelListener(TreeModelListener listener) { listeners.add(listener); } @Override public void removeTreeModelListener(TreeModelListener listener) { listeners.remove(listener); } private class TreeFile extends File { public TreeFile(File parent, String child) { super(parent, child); } @Override public String toString() { return getName(); } } }

    Read the article

  • IIS FTP server not working after purchase of SSL certificate

    - by Chris
    I've been connecting to my web server with active mode in FileZilla with no problems. Over the weekend, an SSL certificate was dropped into a folder that I access with FTP, and which contains files for the website. Now I am receiving a 425 error in active mode on the FTP root, so I can't really do anything but log in. In passive mode, I can connect and move around in the directory tree, but the connection seems shaky. Occasionally I'll time out, and I can't get access at all to the folder containing the SSL certificate. My question is how does the SSL certificate affect my FTP connection (if at all)? Does its presence demand the use of FTP over SSL? Note: As far as I know, the only change which occurred was the placement of the SSL certificate. Firewall settings, FTP client and server settings should all be the same as before, when everything was working.

    Read the article

  • ftp connects but files aren't visible browsing

    - by YsoL8
    Hello If this should be on that other site, please don't shoot me, as I can't remember the name or the url. I have an ftp account in Dreamweaver that connects to the remote site and appears to be uploading files as normal. But when I browse to the location I can't see any new files or changes to the index page. (I've uploaded index.php and connect.php). I'm getting a 404 page. I suspect the host directory is wrong, but looking at the file tree, I can't see the folder I'm supposed to be using, so I'm uploading to the apparent site root. Any guidance on this?

    Read the article

  • Hosting an Access DB

    - by Mitciv
    Hey, So I'm inexperienced in hosting DB's and I've always had the luxury of someone else getting the db setup. I was going to help a friend out with getting a webpage setup, I've got experience in Asp.Net MVC so I'm going with that. They want to setup a search page to query a db and display the results. My question I have is in getting the DB setup and hosted. They currently just have the Access DB on a local computer. There is basically only one table that would need to be queried for the search. What is the best approach to getting this table/db accessible? They would like to keep the main copy of the db on the local machine, so copying the entire db over to the hosted site would be time consuming, could the lone table needed be solely copied to the host? Should I try to convince them to make changes on the hosted db and just make copies of that for their local machines? Any suggestions are welcome, Again I'm a total noob when it comes to hosting databases. Thanks

    Read the article

  • Advice on Minimizing Stored Procedure Parameters

    - by RPM1984
    Hi Guys, I have an ASP.NET MVC Web Application that interacts with a SQL Server 2008 database via Entity Framework 4.0. On a particular page, i call a stored procedure in order to pull back some results based on selections on the UI. Now, the UI has around 20 different input selections, ranging from a textbox, dropdown list, checkboxes, etc. Each of those inputs are "grouped" into logical sections. Example: Search box : "Foo" Checkbox A1: ticked, Checkbox A2: unticked Dropdown A: option 3 selected Checkbox B1: ticked, Checkbox B2: ticked, Checkbox B3: unticked So i need to call the SPROC like this: exec SearchPage_FindResults @SearchQuery = 'Foo', @IncludeA1 = 1, @IncludeA2 = 0, @DropDownSelection = 3, @IncludeB1 = 1, @IncludeB2 = 1, @IncludeB3 = 0 The UI is not too important to this question - just wanted to give some perspective. Essentially, i'm pulling back results for a search query, filtering these results based on a bunch of (optional) selections a user can filter on. Now, My questions/queries: What's the best way to pass these parameters to the stored procedure? Are there any tricks/new ways (e.g SQL Server 2008) to do this? Special "table" parameters/arrays - can we pass through User-Defined-Types? Keep in mind im using Entity Framework 4.0 - but could always use classic ADO.NET for this if required. What about XML? What are the serialization/de-serialization costs here? Is it worth it? How about a parameter for each logical section? Comma-seperated perhaps? Just thinking out loud. This page is particulary important from a user point of view, and needs to perform really well. The stored procedure is already heavy in logic, so i want to minimize the performance implications - so keep that in mind. With that said - what is the best approach here?

    Read the article

  • Using Linq-To-SQL I'm getting some weird behavior doing text searches with the .Contains method. Loo

    - by Nate Bross
    I have a table, where I need to do a case insensitive search on a text field. If I run this query in LinqPad directly on my database, it works as expected Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase")) // also, adding in the same constraints I'm using in my repository works in LinqPad // Table.Where(tbl => tbl.Title.Contains("StringWithAnyCase") && tbl.IsActive == true) In my application, I've got a repository which exposes IQueryable objects which does some initial filtering and it looks like this var dc = new MyDataContext(); public IQueryable<Table> GetAllTables() { var ret = dc.Tables.Where(t => t.IsActive == true); return ret; } In the controller (its an MVC app) I use code like this in an attempt to mimic the LinqPad query: var rpo = new RepositoryOfTable(); var tables = rpo.GetAllTables(); // for some reason, this does a CASE SENSITIVE search which is NOT what I want. tables = tables.Where(tbl => tbl.Title.Contains("StringWithAnyCase"); return View(tables); The column is defiend as an nvarchar(50) in SQL Server 2008. Any help or guidance is greatly appreciated!

    Read the article

  • getting Thunderbird rescan imap folder

    - by asdmin
    Since I got an external program (imapfilter) modifying my imap folder, thunderbird keeps loosing track of new messages. Messages are moved upon arrival in sub-folders, making Thunderbird unable keep tracking them - therefore I have no clue which folders to look for new messages, and newly created folders (even I subscribe them after creation) does not show up until I restart the mail client. Is there any extension or setting for Thunderbird which I could use to trigger re-scanning my folder tree? Please don't waste time on advices like restarting Thunderbird: takes a great amount of time, or "use Evolution (or any other mail client)", or use internal mail filters: they are not sophisticated enough or procmail/fetchmail: I'm arranging a remote imap server for good EXTENSION 1: even folders can be created in the background, without Thunderbird would know it has been created.

    Read the article

  • Help with a loop to return UIImage from possible matches

    - by Canada Dev
    I am parsing a list of locations and would like to return a UIImage with a flag based on these locations. I have a string with the location. This can be many different locations and I would like to search this string for possible matches in an NSArray, and when there's a match, it should find the appropriate filename in an NSDictionary. Here's an example of the NSDictionary and NSArray: NSDictionary *dict = [NSDictionary dictionaryWithObjectsAndKeys: @"franceFlag", @"france", @"greeceFlag", @"greece", @"spainFlag", @"spain", @"norwayFlag", @"norway", nil]; NSArray *array = [NSArray arrayWithObjects: @"france" @"greece" @"spain" @"portugal" @"ireland" @"norway", nil]; Obviously I'll have a lot more countries and flags in both. Here's what I have got to so far: -(UIImage *)flagFromOrigin:(NSString *)locationString { NSRange range; for (NSString *arrayString in countryArray) { range = [locationString rangeOfString:arrayString]; if (range.location != NSNotFound) { return [UIImage imageWithContentsOfFile:[[NSBundle mainBundle] pathForResource:[dictionary objectForKey: arrayString] ofType:@"png"]]; } } return nil; } Now, the above doesn't actually work. I am missing something (and perhaps not even doing it right in the first place) The issue is, the locationString could have several locations in the same country, described something like this "Barcelona, Spain", "Madrid, Spain", "North Spain", etc., but I just want to retrieve "Spain" in this case. (Also, notice caps for each country). Basically, I want to search the locationString I pass into the method for a possible match with one of the countries listed in the NSArray. If/When one is found, it should continue into the NSDictionary and grab the appropriate flag based on the correct matched string from the array. I believe the best way would then to take the string from the array, as this would be a stripped-out version of the location. Any help to point me in the right direction for the last bit is greatly appreciated.

    Read the article

  • object not getting released in iphone

    - by mohsinpathan
    NSString *strSql = @"select tblrecentsearch_id,xmlrequest,company,postcode,city,kilometer,date from tblrecentsearch"; returnValue = sqlite3_prepare_v2(database, [strSql UTF8String], -1, &selectStatement, NULL); if(returnValue == SQLITE_OK) { arrRecentSearch=[[NSMutableArray alloc] init]; while(sqlite3_step(selectStatement)==SQLITE_ROW) { Search *ObjSearch = [[Search alloc]init]; ObjSearch.intRecentSearchId = sqlite3_column_int(selectStatement, 0); ObjSearch.xmlRequest = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 1) encoding:NSUTF8StringEncoding]; ObjSearch.strCompnay=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 2) encoding:NSUTF8StringEncoding]; ObjSearch.strPostCode=[NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 3) encoding:NSUTF8StringEncoding]; ObjSearch.strPlace = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 4) encoding:NSUTF8StringEncoding]; ObjSearch.strKilometer = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 5) encoding:NSUTF8StringEncoding]; ObjSearch.strDate = [NSString stringWithCString:(char *)sqlite3_column_text_check(selectStatement, 6) encoding:NSUTF8StringEncoding]; [arrRecentSearch addObject:ObjSearch]; [ObjSearch release]; } } sqlite3_finalize(selectStatement); I want release arrRecentSearch but it will return from function . How can i realese this array. Please help me.I am fetching data from databse.

    Read the article

  • object not getting released in iphone

    - by Jaimin
    i m writing this code in my code to store the data in database.. Search *objSearchDetail = [[Search alloc] init]; objSearchDetail = [xmlResponseDetail objectAtIndex:i]; sql = "INSERT INTO tblsearchdetail(tblrecentsearch_id,name,address,email,url,street,postcode,city,telephone,mobile) VALUES(?,?,?,?,?,?,?,?,?,?)"; returnValue = sqlite3_prepare_v2(database, sql, -1, &insertStatement, NULL); if(returnValue == SQLITE_OK){ sqlite3_bind_int(insertStatement, 1, intLastRecentSearchId); sqlite3_bind_text(insertStatement, 2, [objSearchDetail.strName UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 3, [objSearchDetail.strAddress UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 4, [objSearchDetail.strEmail UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 5, [objSearchDetail.strUrl UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 6, [objSearchDetail.strStreet UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 7, [objSearchDetail.strPostCode UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 8, [objSearchDetail.strPlace UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 9, [objSearchDetail.strTelephone UTF8String], -1,SQLITE_TRANSIENT); sqlite3_bind_text(insertStatement, 10, [objSearchDetail.strMobile UTF8String], -1,SQLITE_TRANSIENT); if(sqlite3_step(insertStatement)==SQLITE_DONE) { //Data; } } NSLog(@"count %d",[objSearchDetail retainCount]); [objSearchDetail release]; now the nslog shows refrence count as 2 so even if i release the refrence count will still be one and the object will not be destroyed.. plz help me....

    Read the article

  • rsync invocation to replace symlinks pointing to source?

    - by bdbaddog
    Currently I'm moving a big filesystem to a new server as the original fileserver is no longer able to handle the filesystem writes. To make this quick I made symlinks at the target filesystem pointing to the original filesystem. Initially: /company/release (mountpoint of the original filesystem) After migration: /company/release.old (points to original filesystem after automount map update) /company/release (points to new fileserver/filesystem after automount map update) In /company/release there are symlinks like the following: /company/release/product-1.0.tar.gz - /company/release.old/product-1.0.tar.gz /company/release/product-1.0 - /company/release.old/product-1.0 (this is a tree of files) Using symlinks allowed me to move the writes to the new filesystem quickly. Now I'd like to slowly migrate the existing files and directories to the new filesystem. The problem I'm running into is that since the symlinks point back at the original files rsync doesn't see any difference and so it doesn't actually copy the file(s) or directory(s) and remove/overwrite the symlinks. Is there a set of rsync flags which will do what I want?

    Read the article

  • Indexing table with duplicates MySQL/MSSQL with millions of records

    - by Tesnep
    I need help in indexing in MySQL. I have a table in MySQL with following rows: ID Store_ID Feature_ID Order_ID Viewed_Date Deal_ID IsTrial The ID is auto generated. Store_ID goes from 1 - 8. Feature_ID from 1 - let's say 100. Viewed Date is Date and time on which the data is inserted. IsTrial is either 0 or 1. You can ignore Order_ID and Deal_ID from this discussion. There are millions of data in the table and we have a reporting backend that needs to view the number of views in a certain period or overall where trial is 0 for a particular store id and for a particular feature. The query takes the form of: select count(viewed_date) from theTable where viewed_date between '2009-12-01' and '2010-12-31' and store_id = '2' and feature_id = '12' and Istrial = 0 In MSSQL you can have a filtered index to use for Istrial. Is there anything similar to this in MySQL? Also, Store_ID and Feature_ID have a lot of duplicate data. I created an index using Store_ID and Feature_ID. Although this seems to have decreased the search period, I need better improvement than this. Right now I have more than 4 million rows. To search for a particular query like the one above, it looks at 3.5 million rows in order to give me the count of 500k rows. PS. I forgot to add view_date filter in the query. Now I have done this.

    Read the article

< Previous Page | 425 426 427 428 429 430 431 432 433 434 435 436  | Next Page >