Search Results

Search found 9273 results on 371 pages for 'complex strings'.

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

Page 43/371 | < Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >

  • Help with SQL query (list strings and count in same query)

    - by Mestika
    Hi everybody, I’m working on a small kind of log system to a webpage, and I’m having some difficulties with a query I want to do multiple things. I have tried to do some nested / subqueries but can’t seem to get it right. I’ve two tables: User = {userid: int, username} Registered = {userid: int, favoriteid: int} What I need is a query to list all the userid’s and the usernames of each user. In addition, I also need to count the total number of favoriteid’s the user is registered with. A user who is not registered for any favorite must also be listed, but with the favorite count shown as zero. I hope that I have explained my request probably but otherwise please write back so I can elaborate. By the way, the query I’ve tried with look like this: SELECT user.userid, user.username FROM user,registered WHERE user.userid = registered.userid(SELECT COUNT(favoriteid) FROM registered) However, it doesn’t do the trick, unfortunately Kind regards Mestika

    Read the article

  • Java String.indexOf and empty Strings

    - by tmeisenh
    I'm curious why the String.indexOf is returning a 0 (instead of -1) when asking for the index of an empty string within a string. The Javadocs only say this method returns the index in this String of the specified string, -1 if the string isn't found. System.out.println("FOO".indexOf("")); // outputs 0 wtf!!! System.out.println("FOO".indexOf("bar")); // outputs -1 as expected System.out.println("FOO".indexOf("F")); // outputs 0 as expected System.out.println("".indexOf("")); // outputs 0 as expected, I think

    Read the article

  • PHP Initialising strings as boolean first

    - by Anriëtte Myburgh
    I'm in the habit of initialising variables in PHP to false and then applying whatever (string, boolean, float) value to it later. Which would you reckon is better? $name = false; if (condition == true) { $name = $something_else; } if ($name) { …do something… } vs. $name =''; if (condition == true) { $name = $something_else; } if (!empty($name)) { …do something… } Which would you reckon can possibly give better performance? Which method would you use?

    Read the article

  • inserting std::strings in to a std::map

    - by PaulH
    I have a program that reads data from a file line-by-line. I would like to copy some substring of that line in to a map as below: std::map< DWORD, std::string > my_map; DWORD index; // populated with some data char buffer[ 1024 ]; // populated with some data char* element_begin; // points to some location in buffer char* element_end; // points to some location in buffer > element_begin my_map.insert( std::make_pair( index, std::string( element_begin, element_end ) ) ); This std::map<>::insert() operation takes a long time (It doubles the file parsing time). Is there a way to make this a less expensive operation? Thanks, PaulH

    Read the article

  • XML strings in JAXB

    - by OOO
    I have a JPA entity class mimicking a table. Something like this: @XmlType(name="MyClassElementType") public class MyClass { String name; String xmlDesc; public MyClass() {} @XmlElement String getName() { return name; } void setName(String name) { this.name = name; } @XmlElement String getXmlDesc() { return xmlDesc; } void setXmlDesc(String xmlDesc) { this.xmlDesc = xmlDesc; } } In a Jersey REST get call I'm trying to return this class: @Get @Produces("application/xml") public MyClass get() { return myClass; } Now I'm expecting the already xml string(xmlStr) to be returned as is, but Jersey/JAXB escapes it... So anyway around this?

    Read the article

  • comparing strings from two different sources in javascript

    - by andy-score
    This is a bit of a specific request unfortunately. I have a CMS that allows a user to input text into a tinymce editor for various posts they have made. The editor is loaded via ajax to allow multiple posts to be edited from one page. I want to be able to check if there were edits made to the main text if cancel is clicked. Currently I get the value of the text from the database during the ajax call, json_encode it, then store it in a javascript variable during the callback, to be checked against later. When cancel is clicked the current value of the hidden textarea (used by tinymce to store the data for submission) is grabbed using jquery.val() and checked against the stored value from the previous ajax call like this: if(stored_value!=textarea.val()) { return true } It currently always returns true, even if no changes have been made. The issue seems to be that the textarea.val() uses html entities, whereas the ajax jsoned version doesn't. the response from ajax in firebug looks like this: <p>some text<\/p>\r\n<p>some more text<\/p> the textarea source code looks like this: &lt;p&gt;some text&lt;/p&gt; &lt;p&gt;some more text&lt;/p&gt; these are obviously different, but how can I get them to be treated as the same when evaluated? Is there a function that compares the final output of a string or a way to convert one string to the other using javascript? I tried using html entities in the ajax page, but this returned the string with html entities intact when alerted, I assume because json_encoding it turned them into characters. Any help would be greatly appreciated.

    Read the article

  • How do i compare 2 strings in shell?

    - by Thomas
    I want the user to input something at the command line either -l or -e. so e.g. $./report.sh -e I want an if statement to split up whatever decision they make so i have tried... if [$1=="-e"]; echo "-e"; else; echo "-l"; fi obviously doesn't work though Thanks

    Read the article

  • Accessing different connection strings at runtime in ASP.NET MVC 1

    - by Neil T.
    I'm trying to implement integration testing in my ASP.NET MVC 1.0 solution. The technologies in use are LINQ-to-SQL, NUnit and WatiN. I recently discovered a pattern that will allow me to create a testing version of the database on the fly without modifying the development version of the database. I needed this behavior in order to run my user interface tests in WatiN that may modify the database. The plan is to modify the connection string in the Web.config file, and pass that new connection string to the DataContext constructor. This way, I don't have to add routes or modify my URLs in order to perform the integration testing. I've set up the project so that the test setup can modify the connection string to point to the test database when the tests are running. The connection string is stored in web.config. The problem I'm having is that when I try to run the tests, I get a NullReferenceException when trying to access the HTTPContext. From everything that I have read so far, the HTTPContext is only available within the context of a controller. Here is the code for the property that is supposed to give me the reference to the Web.config file: private System.Configuration.Configuration WebConfig { get { ExeConfigurationFileMap fileMap = new ExeConfigurationFileMap(); // NullReferenceException occurs on this line. fileMap.ExeConfigFilename = HttpContext.Current.Server.MapPath("~\\web.config"); System.Configuration.Configuration config = ConfigurationManager.OpenMappedExeConfiguration(fileMap, ConfigurationUserLevel.None); return config; } } Is there something that I am missing in order to make this work? Is there a better way to accomplish what I'm trying to achieve? UPDATE: I decided to abandon the modification of Web.config in lieu of a "request-scoped DataContext" pattern that I found here. From the looks of it, I believe it should give me the results I'm looking for. However, during the TextFixtureSetUp, I try to create a new copy of the database for testing purposes, and it fails silently. When I get to the tests, the repository still uses the production database connection string to load data.

    Read the article

  • Truncating long strings with CSS: feasible yet?

    - by Sam Stokes
    Is there any good way of truncating text with plain HTML and CSS, so that dynamic content can fit in a fixed-width-and-height layout? I've been truncating server-side by logical width (i.e. a blindly-guessed number of characters), but since a 'w' is wider than an 'i' this tends to be suboptimal, and also requires me to re-guess (and keep tweaking) the number of characters for every fixed width. Ideally the truncation would happen in the browser, which knows the physical width of the rendered text. I've found that IE has a text-overflow: ellipsis property that does exactly what I want, but I need this to be cross-browser. This property seems to be (somewhat?) standard but isn't supported by Firefox. I've found various workarounds based on overflow: hidden, but they either don't display an ellipsis (I want the user to know the content was truncated), or display it all the time (even if the content wasn't truncated). Does anyone have a good way of fitting dynamic text in a fixed layout, or is server-side truncation by logical width as good as I'm going to get for now?

    Read the article

  • Using Visual Studio Intellisense for building jQuery selector strings

    - by jslatts
    This is a minor issue, but one I find myself running into: When I am using jQuery in Visual Studio 2010, I find myself frequently typing: $(#S using Intellisense to find the SomeID object ID: $(#SomeID).click( function() { etc.. }) then going back and adding quotes: $('#SomeID').click( function() { etc.. }) I find it annoying that if I add the quote first, Visual Studio goes into string mode and I lose Intellisense for finding the object's ID or class. Am I doing it wrong?

    Read the article

  • Using a function with variable argument strings

    - by wrongusername
    I was playing around a bit with functions with variable arguments, and decided to make a function to create vectors with the arguments. My function for creating an int vector worked... vector<int> makeIntVector(int numArgs, ...) { va_list listPointer; va_start(listPointer, numArgs); vector<int> made; for(int a = 0; a < numArgs; a++) made.push_back(va_arg(listPointer, int)); va_end(listPointer); return made; } but not my function for creating a string vector: vector<string> makeStringVector(int numArgs, string something, ...) { va_list listPointer; va_start(listPointer, something); vector<string> made; for(int a = 0; a < numArgs; a++) made.push_back(va_arg(listPointer, string)); va_end(listPointer); return made; } which crashes the program. What am I doing wrong?

    Read the article

  • Regex matching wrong strings

    - by Joe Smalley
    I have this PHP/SQL query: $sql = sprintf("SELECT * FROM %sCubeCart_filemanager WHERE filepath REGEXP '%s[\\/\\\\][^\\/\\\\]+$' AND type = '%d' AND disabled = '0' ORDER BY filepath ASC %s", $this->_config['dbprefix'], str_replace(array('\\','/'),'.',$folder), $type, $limit); if '$folder' == 'iha9' it is finding results like 'iha91' and 'iha99' too. Something is wrong with the regular expression, but I don't know how they work, can anyone help?!

    Read the article

  • Obfuscate strings in Python

    - by Caedis
    I have a password string that must be passed to a method. Everything works fine but I don't feel comfortable storing the password in clear text. Is there a way to obfuscate the string or to truly encrypt it? I'm aware that obfuscation can be reverse engineered, but I think I should at least try to cover up the password a bit. At the very least it wont be visible to a indexing program, or a stray eye giving a quick look at my code. I am aware of pyobfuscate but I don't want the whole program obfuscated, just one string and possibly the whole line itself where the variable is defined. Target platform is GNU Linux Generic (If that makes a difference)

    Read the article

  • Parsing Strings ( .crt files )

    - by user1661521
    Base Knowledge : I have a .crt file ( certification authoritie file ) and he is composed of many fields but in one line that resumes this question i have this : Certificate: ...(alot of stuff before)... Subject: C=US, ST=Maryland, L=Pasadena, O=Brent Baccala, OU=FreeSoft, CN=www.freesoft.org/[email protected] Subject Public Key Info: ...(alot of stuff after) and i need to parse the file to populate a .csv file and i have that done the problem that i need help is, i need to get the field: CN=www.fresoft.org but when i get this kind of CN=...(Value instead of the ...) with alot of slashes i get a error in the parsing like the raw string is: CN=foo/bar/the/hell/emailAddress=blablabla and i need only: foo/bar/the/hell and for a moment i got that in the correct column but when i dont have the emailAddress something just fail in my parsing and i then get in my CN .csv column the information wrong instead of |CN| foo/bar/the/hell i get: |CN| OU=FreeSoft, foo/bar/the/hell. I have this code doing the CN parsing: #!/bin/bash subject_line=$(echo $cert | grep -o "Subject:.*Subject Public Key Info") cn=$(echo $subject_line | grep -o "CN=.*" ) if [ $(echo $cn | grep -c ".*email.*") -gt 0 ]; then end_cn=$(echo $cn | grep -b -o emailAddress) end_cn_idx=$(echo $end_cn | grep -o .*:) final_end_cn=${end_cn_idx:0:-1} common_name=${cn:3:$final_end_cn-4} echo $common_name else end_cn=$(echo $cn | grep -b -o "Subject Public Key Info") end_cn_idx=$(echo $end_cn | grep -o .*:) final_end_cn=${end_cn_idx:0:-1} common_name=${cn:3:$final_end_cn-5} echo $common_name fi

    Read the article

  • Connection Strings between Web Application and SQL Server

    - by Raven Dreamer
    Greetings. I'm writing a web application that is supposed to connect to a SQL Server database; the connection is formed from the following database string: <add key="DatabaseConnectionString" value="server=DEVPC1\SQLEXPRESS;uid=USERID;pwd=PASSWORD;database=DATABASE"/> However, whenever I try and run the web application, I get a connection error, specifically: An error occurred attempting this login: Login failed for user 'USERID'. Any suggestions on how to go about debugging this? I'm not really familiar with SQL, so any suggestions would be greatly appreciated.

    Read the article

  • Escape apostrophes inside double quoted strings (Javascript)

    - by George Sheppard
    Say i have a string that i need to evaluate in javascript such as : window.some_class.update( 'Runner', 'update_runner', '{"runner":{"id":"1","name":"Nin's Lad" } }'); In order for eval() to evaluate it, i need to escape the apostrophe in runner_name (Nin's Lad). Is this possable with regex? I dont want to escape the single quotes around Runner and update_runner. I'd just like to escape any single quotes inside double quotes. Thanks,

    Read the article

  • SQL Server 2005 Fail: Return Dates As Strings

    - by Abs
    Hello all, I am using the SQL Server PHP Driver, I think this question can be answered without knowing what this is. I have come across this many times, what does it mean by NAMES? Column names?: SET NAMES utf8 Is there a query similar to the above that will get my dates to be returned as a string? For some reason on my SQL Sever 2008 on Vista, this works: $connectionInfo = array('Database' => $dbname, 'ReturnDatesAsStrings' => true) But the above 'ReturnDatesAsStrings' does not work on my SQL Server 2005 on a windows server machine? I can't execute any queries after setting the above! Does SQL Server 2005 support ReturnDatesAsStrings? Is there some other parameter I can pass to do the same? Thanks all for any help EDIT I should of mentioned this but if there is a solution I am hoping for one that is in the form of a setting that can be set before any queries can be executed as I do not have control on what queries will be executed.

    Read the article

  • Matching strings

    - by Joy
    Write the function subStringMatchExact. This function takes two arguments: a target string, and a key string. It should return a tuple of the starting points of matches of the key string in the target string, when indexing starts at 0. Complete the definition for def subStringMatchExact(target,key): For example, subStringMatchExact("atgacatgcacaagtatgcat","atgc") would return the tuple (5, 15).

    Read the article

  • Match HTML tags in two strings using regex in Python

    - by jack
    I want to verify that the HTML tags present in a source string are also present in a target string. For example: >> source = '<em>Hello</em><label>What's your name</label>' >> verify_target(’<em>Hi</em><label>My name is Jim</label>') True >> verify_target('<label>My name is Jim</label><em>Hi</em>') True >> verify_target('<em>Hi<label>My name is Jim</label></em>') False

    Read the article

facebook twitter digg google delicious technorati stumbleupon myspace wordpress linkedin gmail igoogle windows live tumblr viadeo yahoo buzz yahoo mail yahoo bookmarks favorites email print

< Previous Page | 39 40 41 42 43 44 45 46 47 48 49 50  | Next Page >