Search Results

Search found 44902 results on 1797 pages for 'call naive true'.

Page 433/1797 | < Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >

• Newbie question on MvcContrib TestHelpers

  - by Simon Lomax

  Hi, I'm just starting to use the TestHelpers in MvcContrib. I want to try and test an action method on my controller that itself tests if IsAjaxRequest() is true. I've used the same code that is shown in the TestHelper samples to set up the TestControllerBuilder _controller = new StarsController(); _builder = new TestControllerBuilder(); _builder.InitializeController(_controller); So that _controller has all the faked/mocked HttpContext inside it, which is really great. But what do I do now to force IsAjaxRequest() on the internally faked Request object to return true?

  Read the article

• [PHP] Sending Email Notification in Facebook JavaScript API

  - by Veera

  I'm trying to send a email notification to the user from my Facebook application. I'm trying to use the FaceBook JavaScript API function notifications_sendEmail(Array recipients, String subject, String text, String fbml, Object onRequestCompleted) I can understand the first four parameters. But what's the usage of the last parameter 'onRequestCompleted'. The Doc says it's the call back function. But, what if I do not want to execute a call back function? In this case, what will be a valid values to the parameter onRequestCompleted?

  Read the article

• Filter across three tables using Django

  - by Vanessa MacDougal

  I have 3 django models, where the first has a foreign key to the second, and the second has a foreign key to the third. Like this: class Book(models.Model): year_published = models.IntField() author = models.ForeignKey(Author) class Author(models.Model): author_id = models.AutoField(primary_key=True) name = models.CharField(max_length=50) agent = models.ForeignKey(LitAgent) class LitAgent(models.Model): agent_id = models.AutoField(primary_key=True) name = models.CharField(max_length=50) I want to ask for all the literary agents whose authors had books published in 2006, for example. How can I do this in Django? I have looked at the documentation about filters and QuerySets, and don't see an obvious way. Thanks.

  Read the article

• RadioGroup getValue does not return correct slected value

  - by vagabond

  I'm running into a small issue with RadioGroup. My RadioGroup has possible values, true and false. The Radio types I have in my radiogroup use a Model that stores true or false. On an ajax onchange event I want to do some handling, and to do so I need to know the selected radio in my radiogroup and another identical radiogroup. The problem is getValue() only returns the initial value from my Pojo. Whenver I click on a radio button to change the selected Radio getValue() still returns the initial value. When I save my changes, my Pojo gets the correct value. I am finding this bizarre and have spent hours trying to figure our what I'm missing.

  Read the article

• why i am getting popup message when I am tryiing to update user.

  - by kumar

  I am getting Popup mesage something like You have chosen to open Update which is a:application/json From : http://localhost:1234 which ok cancel buttons.. I am using this code to run.. [HttpPost] public JsonResult MEdit(ExpenseBE e) { var cache = CacheFactory.GetCacheManager(); string F_ACTION = "U"; string F_DEBUG = "Y"; var excUpdateStatus = false; for (int i = 0; i <= cache.Count; i++) { var x = (ExpenseBE)cache.GetData("a" + i); if (x != null) { string Resolutioncode = e.Exception.ResolutionCode; string reasoncode = e.Exception.ReasonCode; string actioncode = e.Exception.ActionCode; e.Exception.ExceptionID = x.Exception.ExceptionID; e.Exception.ReasonCode = reasoncode; e.Exception.ReasonCode = Resolutioncode; e.Exception.ActionCode = actioncode; e.Exception.Sequence = x.Exception.Sequence; e.Exception.FollowupDate = x.Exception.FollowupDate; e.Exception.IOL = x.Exception.IOL; e.Exception.LastUpdateUser = User.Identity.Name.ToUpper().Remove(0, 4); excUpdateStatus = common.UpdateException(e.Exception, F_ACTION, F_DEBUG); } } return Json(excUpdateStatus.ToString()); } and my view is <%@ Control Language="C#" Inherits="System.Web.Mvc.ViewUserControl<NorthernTrust.ATP.iTool.Core.Business.Entities.Specialist.ExpenseBE>" %> <% using (Html.BeginForm("MEdit", "expense", FormMethod.Post)) { %> <%= Html.ValidationSummary(true)%> <fieldset class="clearfix" id="fieldset-exception"> <legend>Mass Edit Exception Information</legend> <div class="fiveper"> <label for="ExceptionStatus"> Status: <span> </span> </label> <label for="ResolutionCode"> Resolution: <span> <%=Html.DropDownListFor(model=>model.Exception.ResolutionCode,new SelectList(Model.LookupCodes["C_EXCPT_RESL"], "Key", "Value"))%> </span> </label> <label for="ReasonCode"> Reason: <span><%=Html.DropDownListFor(model => model.Exception.ReasonCode, new SelectList(Model.LookupCodes["C_EXCPT_RSN"], "Key", "Value"))%></span> </label> <label for="ExceptionStatus"> Action Taken: <span><%=Html.DropDownListFor(model => model.Exception.ActionCode, new SelectList(Model.LookupCodes["C_EXCPT_ACT"], "Key", "Value"))%></span> </label> </div> <div class="fiveper"> <label for="FollowupDate"> Follow-up: <span><input type="text" id="exc-flwup-" /></span> <%--<%=Html.EditorFor(model=>model.Exception.FollowupDate) %>--%> </label> <label for="IOL"> Inquiry #: <%=Html.TextBox("Inquiery", ViewData["inq"] ?? "")%> </label> <label>Comment</label> <span> <%=Html.TextArea("value") %> <%=Html.ValidationMessage("value")%> </span> </div> <br /> <br /> <div> <button id="btnSelect" class="button">Select All</button> <button id="btnCancel" class="button">Cancel</button> <input type="submit" class="button" value="Save" /> </div> </fieldset> <% } %> <script type="text/javascript"> $(document).ready(function() { $('#btnSelectAll').click(function() { function validate_excpt(formData, jqForm, options) { var form = jqForm[0]; } $('#btnSelect').click(function() { $('#input [type=checkbox]').attr('checked', 'checked'); }); // post-submit callback function showResponse(responseText, statusText, xhr, $form) { if ('success' == statusText) { $('#error-msg span:last').html('<strong>Update successful.</strong>'); } else { $('#error-msg span:last').html('<strong>Update failed.</strong> ' + responseText); } $('#error-msg').removeClass('hide'); } $('#exc').ajaxForm({ target: '#error-msg', beforeSubmit: validate_excpt, success: showResponse, dataType: 'json' }); $('.button').button(); }); $('.button').button(); $("input[id^='exc-flwup-']").datepicker({ duration: '', showTime: true, constrainInput: true, stepMinutes: 30, stepHours: 1, altTimeField: '', time24h: true, minDate: 0 }); $('#ui-timepicker-div').bgiframe(); }); </script> please correct me if i am doing somwhere wrong? thanks

  Read the article

• C# - Silverlight - Dynamically calling a method

  - by cmaduro

  Is there anyway in C# to call a method based on a Enum and/or class? Say if I were to call Controller<Actions.OnEdit, Customer>(customer); Could I do something like this then? public void Controller<TAction, TParam>(TParam object) { Action<TParam> action = FindLocalMethodName(TAction); action(object); } private Action<T> FindLocalMethodName(Enum method) { //Use reflection to find a metode with //the name corresponding to method.ToString() //which accepts a parameters type T. }

  Read the article

• Python json memory bloat

  - by Anoop

  import json import time from itertools import count def keygen(size): for i in count(1): s = str(i) yield '0' * (size - len(s)) + str(s) def jsontest(num): keys = keygen(20) kvjson = json.dumps(dict((keys.next(), '0' * 200) for i in range(num))) kvpairs = json.loads(kvjson) del kvpairs # Not required. Just to check if it makes any difference print 'load completed' jsontest(500000) while 1: time.sleep(1) Linux top indicates that the python process holds ~450Mb of RAM after completion of 'jsontest' function. If the call to 'json.loads' is omitted then this issue is not observed. A gc.collect after this function execution does releases the memory. Looks like the memory is not held in any caches or python's internal memory allocator as explicit call to gc.collect is releasing memory. Is this happening because the threshold for garbage collection (700, 10, 10) was never reached ? I did put some code after jsontest to simulate threshold. But it didn't help.

  Read the article

• How can I receive messages over http without MSMQ

  - by pduncan

  I need a reliable messaging framework that runs over http/https (due to client security requirements) and that doesn't use MSMQ (because some clients will use Windows XP Home). The clients only need to be able to receive messages, not send them. We already have a message queue on the server for each user, and the receivers have been getting messages by connecting to an HttpHandler on the server and getting a Stream from WebResponse.GetResponseStream() We keep this stream open, and pull messages off of it using Stream.Read(). This MOSTLY works, but Stream.Read() is a blocking call, and we can't reliably interrupt it. We need to be able to stop and start the receiver without losing messages, but the old stream often hangs around, even after we call Thread.Abort on its thread. Any suggestions?

  Read the article

• Problem with notification bar in fullscreen app

  - by Mathias Lin

  I run an app in fullscreen mode where fullscreen is defined as a theme in xml for the entire app. <style name="AskTingTingTheme" parent="android:Theme"> <item name="android:windowNoTitle">true</item> <item name="android:windowFullscreen">true</item> <item name="android:windowBackground">@null</item> </style> Generally it works ok, but there are some issues in some cases: 1) when I open the search dialog via search button - Screenshot: http://tinyurl.com/3xzadft 2) when I open spinner widgets that are very long and fill the screen (so that the list is usually scrollable) - Screenshot: http://tinyurl.com/39q5ya2 The problem is that when I open the search dialog or spinner widget, the system notification bar occurs for a few millisecs and then scrolls off the screen again. Please see the screenshots linked above. I'm currently on 2.2 with NexusOne, but same thing happened on 2.1update1 (esp. case 2) as well before.

  Read the article

• How bad is opening and closing a SQL connection for several times? What is the exact effect?

  - by Eren

  For example, I need to fill lots of DataTables with SQLDataAdapter's Fill() method: DataAdapter1.Fill(DataTable1); DataAdapter2.Fill(DataTable2); DataAdapter3.Fill(DataTable3); DataAdapter4.Fill(DataTable4); DataAdapter5.Fill(DataTable5); .... .... Even all the dataadapter objects use the same SQLConnection, each Fill method will open and close the connection unless the connection state is already open before the method call. What I want to know is how does unnecessarily opening and closing SQLConnections affect the performance of the application. How much does it need to scale to see the bad effects of this problem (100,000s of concurrent users?). In a mid-size website (daily 50000 users) does it worth bothering and searching for all the Fill() calls, keeping them together in the code and opening the connection before any Fill() call and closing afterwards?

  Read the article

• Starting new transaction in Spring bean

  - by Marcus

  We have: @Transactional(propagation = Propagation.REQUIRED) public class MyClass implementes MyInterface { ... MyInterface has a single method: go(). When go() executes we start a new transaction which commits/rollbacks when the method is complete - this is fine. Now let's say in go() we call a private method in MyClass that has @Transactional(propagation = Propagation.REQUIRES_NEW. It seems that Spring "ignores" the REQUIRES_NEW annotation and does not start a new transaction. I believe this is because Spring AOP operates on the interface level (MyInterface) and does not intercept any calls to MyClass methods. Is this correct? Is there any way to start a new transaction within the go() transaction? Is the only way to call another Spring managed bean that has transactions configured as REQUIRES_NEW? Update: Adding that when clients execute go() they do so via a reference to the interface, not the class: @Autowired MyInterface impl; impl.go();

  Read the article

• creating an options menu with quit application function

  - by Domen Tomažin

  Hello, I'm writing an application for android and I would like to insert an options menu, that would have only one function and that is to quit an application. My options_menu.xml looks like this (I created a new folder under res called menu - just like the instructions said): Than I added the following code to my java class file: @Override public boolean onCreateOptionsMenu(Menu menu) { MenuInflater inflater = getMenuInflater(); inflater.inflate(R.menu.options_menu, menu); return true; } @Override public boolean onOptionsItemSelected(MenuItem item) { // Handle item selection switch (item.getItemId()) { case R.id.quit: finish(); return true; default: return super.onOptionsItemSelected(item); } I also defined the @string/quit in values - strings.xml file, but it still says that there is an error: C:\Users\Domen\workspace\Lovne Dobe1.1\res\menu\options_menu.xml:3: error: Error: No resource found that matches the given name (at 'title' with value '@string/quit') So if anybody can help I would be very grateful.

  Read the article

• spidermonkey using JS_CallFunction for static function

  - by supersuraccoon

  JS_CallFunctionName can call a method of an object by name: JSObject* obj; JS_CallFunctionName(cx, obj, "doSomething", argc, vp, retVal); The code above works fine if the "doSomething" is a function declared in the prototype of the "obj". What I want to know is if there is a way to call a function that is a "class function". I tried: if(JS_HasProperty(getGlobalContext(), getGlobalObject(), "ClassToGet", &b)) { print("OK"); } and the output is "OK". But when tried: JS_GetProperty(getGlobalContext(), getGlobalObject(), "ClassToGet", &jsOwner); if (jsOwner != JSVAL_VOID) { } the jsOwner is a JSVAL_VOID. Maybe there is a function in SpiderMonkey can execute function in a JSClass ? Any suggestion will be appreciated, thanks :)

  Read the article

• Unicode data from NSData to NSString

  - by Jeff

  So if I have NSData from an HTTP request, then I do something like this: NSString *test = [[NSString alloc] initWithData:data encoding:NSUTF8StringEncoding]; This will result in null if the data contains weird unicode data (title is from reddit): {"title":"click..¦¦me..and..then¦¦________ ¦¦check¦¦_.your...¦¦.__...¦¦____ ¦¦....¦¦¦¦¦¦¦¦¦¦¦¦¦¦....¦¦____ ¦¦¦¦¦¦....¦¦¦¦¦¦....¦¦¦¦¦¦____ ¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦____ ....¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦¦______ ........¦¦..._recently....¦¦________ ....¦¦....viewed....links....¦¦_____"}, How would I convert the data to a string? Ideally, it would best if the string wasn't null so I could parse it as JSON, but even a lossy conversion is fine with me in these cases. I'm not familiar with unicode (naive American I am), so any enlightenment about that would be a nice bonus :)

  Read the article

• WCF REST Does Not Contain All of the Relative File Path

  - by Brandon

  I have a RESTful WCF 3.5 endpoint as such: System.Security.User.svc This is supposed to represent the namespace of the User class and is desired behavior by our client. I have another endpoint I created for testing called: Echo.svc I am writing an overridden IHttpModule and in my module, I follow what almost everyone does by doing: string path = HttpContext.Current.Request.AppRelativeCurrentExecutionFilePath; If I make a call to: http://localhost/services/Echo/test My path variable has a value of '~/echo/test' However, when I make a call to: http://localhost/services/System.Security.User/test My path variable has a value of '~/system.security.user' In my 2nd situation, it is stripping off the '/test' on the end of any endpoint that contains multiple periods. This is undesired behavior and the only solution I have found to fixing this is some ugly string manipulation using the property which does contain the complete URL path: string rawPath = HttpContext.Current.Request.RawUrl; This returns '/services/system.security.user/test'. Does anyone know why my first situation does not return the rest of the URL path for endpoints that contain multiple periods in the name?

  Read the article

• Killing Mysql processes staying in sleep command.

  - by Shino88

  Hey I am connecting a MYSQL database through hibernate and i seem to have processes that are not being killed after they are finished in the session. I have called flush and close on each session but when i check the server the last processes are still there with a sleep command. This is a new problem which i am having and was not the case yesterday. Is there any way i can ensure the killng of theses processes when i am done with a session. Below is an example of one of my classes. public JSONObject check() { //creates a new session needed to add elements to a database Session session = null; //holds the result of the check in the database JSONObject check = new JSONObject(); try{ //creates a new session needed to add elements to a database SessionFactory sessionFactory = new Configuration().configure().buildSessionFactory(); session = sessionFactory.openSession(); if (justusername){ //query created to select a username from user table String hquery = "Select username from User user Where username = ? "; //query created Query query = session.createQuery(hquery); //sets the username of the query the values JSONObject contents query.setString(0, username); // executes query and adds username string variable String user = (String) query.uniqueResult(); //checks to see if result is found (null if not found) if (user == null) { //adds false to Jobject if not found check.put("indatabase", "false"); } else { check.put("indatabase", "true"); } //adds check to Jobject to say just to check username check.put("justusername", true); } else { //query created to select a username and password from user table String hquery = "Select username from User user Where username = :user and password = :pass "; Query query = session.createQuery(hquery); query.setString("user", username); query.setString("pass", password); String user = (String) query.uniqueResult(); if(user ==null) { check.put("indatabase", false); } else { check.put("indatabase", true); } check.put("justusername", false); } }catch(Exception e){ System.out.println(e.getMessage()); //logg.log(Level.WARNING, " Exception", e.getMessage()); }finally{ // Actual contact insertion will happen at this step session.flush(); session.close(); } //returns Jobject return check; }

  Read the article

• How to check if an SQL query executed without error in ASP?

  - by Sam

  Here's my code: if Request.Form("authorize") <> "" and request.form("delete") <> "true" then post_ids = Request.form("authorize") ids = split(post_ids, ",") For i = LBound(ids) to UBound(ids) sql = "update tbl_comments set authorized = 'true' where comment_id = " & ids(i) pageDB.execute(sql) Next message = "<div id=""succeed""><strong>Updated</strong>: Your comments have been approved.</div>" end if Instead of just setting "message" to the success message i'd like to do something along the lines of... if(pageDB.execute(sql) was succesful) then message = "<div id=""succeed""><strong>Updated</strong>: Your comments have been approved.</div>" else message = "<div id=""error""><strong>Error</strong>: Your comments have not been approved.</div>" end if

  Read the article

• Perform Push Segue From a Tab View Controller

  - by user1416492

  I have a Tab Bar Controller App, the tab bar controller is forked into several "tab" view controller, in one of the view controller I want to redirect the user to an other view controller. I create a segue from that tab view controller to the destination view controller and given it an Identifer. And I call "performSegueWithIdentifier" in "viewDidAppear" to redirect the user. It works fine when the segue is "Modal", however since I want to retain the tabs, I want to call the segue through "Push". However, once I change the segue to "Push", it is not working anymore (it does not try to go to the destination view controller). The app did not crash on the simulator but just staying on the origin tab view controller.

  Read the article

• Windows/C++: Is it possible to find the line of code where exception was thrown having "Exception Of

  - by Pavel

  One of our users having an Exception on our product startup. She has sent us the following error message from Windows: Problem Event Name: APPCRASH Application Name: program.exe Application Version: 1.0.0.1 Application Timestamp: 4ba62004 Fault Module Name: agcutils.dll Fault Module Version: 1.0.0.1 Fault Module Timestamp: 48dbd973 Exception Code: c0000005 Exception Offset: 000038d7 OS Version: 6.0.6002.2.2.0.768.2 Locale ID: 1033 Additional Information 1: 381d Additional Information 2: fdf78cd6110fd6ff90e9fff3d6ab377d Additional Information 3: b2df Additional Information 4: a3da65b92a4f9b2faa205d199b0aa9ef Is it possible to locate the exact place in the source code where the exception has occured having this information? What is the common technique for C++ programmers on Windows to locate the place of an error that has occured on user computer? Our project is compiled with Release configuration, PDB file is generated. I hope my question is not too naive.

  Read the article

• def constrainedMatchPair(firstMatch,secondMatch,length):

  - by smart

  matches of a key string in a target string, where one of the elements of the key string is replaced by a different element. For example, if we want to match ATGC against ATGACATGCACAAGTATGCAT, we know there is an exact match starting at 5 and a second one starting at 15. However, there is another match starting at 0, in which the element A is substituted for C in the key, that is we match ATGC against the target. Similarly, the key ATTA matches this target starting at 0, if we allow a substitution of G for the second T in the key string. consider the following steps. First, break the key string into two parts (where one of the parts could be an empty string). Let's call them key1 and key2. For each part, use your function from Problem 2 to find the starting points of possible matches, that is, invoke starts1 = subStringMatchExact(target,key1) and starts2 = subStringMatchExact(target,key2) The result of these two invocations should be two tuples, each indicating the starting points of matches of the two parts (key1 and key2) of the key string in the target. For example, if we consider the key ATGC, we could consider matching A and GC against a target, like ATGACATGCA (in which case we would get as locations of matches for A the tuple (0, 3, 5, 9) and as locations of matches for GC the tuple (7,). Of course, we would want to search over all possible choices of substrings with a missing element: the empty string and TGC; A and GC; AT and C; and ATG and the empty string. Note that we can use your solution for Problem 2 to find these values. Once we have the locations of starting points for matches of the two substrings, we need to decide which combinations of a match from the first substring and a match of the second substring are correct. There is an easy test for this. Suppose that the index for the starting point of the match of the first substring is n (which would be an element of starts1), and that the length of the first substring is m. Then if k is an element of starts2, denoting the index of the starting point of a match of the second substring, there is a valid match with one substitution starting at n, if n+m+1 = k, since this means that the second substring match starts one element beyond the end of the first substring. finally the question is Write a function, called constrainedMatchPair which takes three arguments: a tuple representing starting points for the first substring, a tuple representing starting points for the second substring, and the length of the first substring. The function should return a tuple of all members (call it n) of the first tuple for which there is an element in the second tuple (call it k) such that n+m+1 = k, where m is the length of the first substring.

  Read the article

• DllImport Based on OS Platform

  - by Ngu Soon Hui

  I have a mixture of unmanaged code ( backend) and managed code ( front end), as such, I would need to call the unmanaged code from my managed code, using interop techniques and DllImport attribute. Now, I've compiled two versions of unmanaged code, for both 32 and 64 bit OS; they are named service32.dll and service64.dll respectively. So, in my .Net code, I would have to do a DllImport for both dlls: [DllImport(@"service32.dll")] //for 32 bit OS invocation public static void SimpleFunction(); [DllImport(@"service64.dll")] //for 64 bit OS invocation public static void SimpleFunction(); And call them depending on which platform my application is running on. The issue now is that for every unmanaged function, I have to declared it twice, one for 32 bit OS and one for 64 bit OS. This is a duplication of work, and everytime I change the signature of an unmanaged function, I have to modified it in two places. Is there anyway that I can change the argument in DllImport so that the correct dll will be invoked automagically, depending on the platform?

  Read the article

• Python metaprogramming help

  - by Timmy

  im looking into mongoengine, and i wanted to make a class an "EmbeddedDocument" dynamically, so i do this def custom(cls): cls = type( cls.__name__, (EmbeddedDocument,), cls.__dict__.copy() ) cls.a = FloatField(required=True) cls.b = FloatField(required=True) return cls A = custom( A ) and tried it on some classes, but its not doing some of the base class's init or sumthing in BaseDocument def __init__(self, **values): self._data = {} # Assign initial values to instance for attr_name, attr_value in self._fields.items(): if attr_name in values: setattr(self, attr_name, values.pop(attr_name)) else: # Use default value if present value = getattr(self, attr_name, None) setattr(self, attr_name, value) but this never gets used, thus never setting ._data, and giving me errors. how do i do this?

  Read the article

• GTKMM/C++ Window Event on loosing/regaining focus?

  - by ace

  How can i call a function whenever my gtkmm app looses or regains focus? Thanks.

  Read the article

• How to read log4j output to a web page?

  - by Ran

  I have a web page, used for admin purposes, which runs a task (image fetching from a remote site). In order to be able to debug the task using the browser only, no ssh etc, I'd like to be able to read all log output from the executing thread and spit it out to the web page. The task boils down to: Changing log level for current thread at the beginning of the call and restore when the call is done. Reading all log output by current thread and storing it in a string. So in pseudocode my execute() method would look like this: (I'm using struts2) public String execute() throws Exception { turnLoggingLevelToDebugOnlyForThisThread() ... do stuff... restoreLoggingLevelForThisThread() String logs = readAllLogsByThisThread(); } Can this be done with log4j? I'm using tomcat, struts2, log4j and slf4j.

  Read the article

• uitextfield delegate must be file's owner?

  - by deafgreatdane

  I've seen a few references (eg here) in response to folks having trouble getting the keyboard to dismiss in iPhone that say "double check that the delegate is attached to file's owner. Is this necessarily true? Or just standard practice? Can't I have other objects in my nib, such as a subclass of UIViewController, and make connections to those as I like? I'd hate to have to route everything into the object that happens to be file owner. That said, I'm having a difficult time getting the keyboard to disappear. I know it's connected to the delegate, because I can set break points and step through the code. I can see the [theTextField resignFirstResponder] get called (and return true), but the keyboard still won't go away. Any other suggestions?

  Read the article

< Previous Page | 429 430 431 432 433 434 435 436 437 438 439 440  | Next Page >