Search Results

Search found 15535 results on 622 pages for 'mat keep'.

Page 436/622 | < Previous Page | 432 433 434 435 436 437 438 439 440 441 442 443  | Next Page >

• Find Search Replace from landmark to landmark - including everything in between

  - by Erick Tronboll

  Appreciate some Jedi help... I have the following string: gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR repeating sporadically throughout my document and want to remove everything from: gi|37463 to the AAMGR sequence but, I want to keep the blocks where JQ250 appears: gi|374638936|gb|*JQ250*332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC and remove only the lines that have AEZ554 gi|374638939|gb|*AEZ554*52.1| myosin light chain 2, partial [Batrachoseps major] AAMGR ..................................... So, ideally the following block: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638935|gb|AEZ55450.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638937|gb|AEZ55451.1| myosin light chain 2, partial [Batrachoseps major] AAMGR gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638939|gb|AEZ55452.1| myosin light chain 2, partial [Batrachoseps major] AAMGR Would be left as just: gi|374638934|gb|JQ250331.1| Batrachoseps major isolate a voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638936|gb|JQ250332.1| Batrachoseps major isolate b voucher DBW5974 myosin light chain 2 gene, partial cds GCNGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCATGCAATGGGGGCGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACCTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT TCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAGAGACCCCAGTATGACGTCGTCATTGCTCC CAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC gi|374638938|gb|JQ250333.1| Batrachoseps major isolate a voucher MVZ:Herp:249023 myosin light chain 2 gene, partial cds GCCGCCATGGGTAAGTGAACGCGCCGGACCAGACCATTCACTGCCTGCAATGGGGGTGTTTGTGGGTTGG AAGGTGTGCCAAAGATCTAGGGAACCCCAACTCCTCAGGATACGGGTGGGAGCCCTAAAATATGTCCAGC TATAAGGAGATGACCAATGGAAAAGGGGGTATCAGCAGTACTTTACTTGCTACTATAAGAGAATTGCATC CTGGGAATAGCCTCTGAAAGGTCCCATTTTAGCGACACTGGTAGATGGACACTGGCCTTTGGACAGCACC AGTAAGTAGAGCATTGCATCTTGGGATTCCTTTGCTGTTCACATGCCACTGAAAGCTCTCACCATAGCAG ATTCAAAATGCCTACCCGGCAGGTTGCCAGAAAAGCACTGCATCATGGGAGAACCACTTTTAGTGACAAT CCTAAGAGATGGGTGTCTCTCTGCCAGGCGCTATTATCCAAGAGACCCCAGTATGACGTCGTCATTGCTC CCAGGTAACCATGTTCTCACCCCCTCTCCCACAGGCCGC ................................many thanks as I help a struggling Grad Student

  Read the article

• Can I use this power supply + case combination without causing problems?

  - by evan

  I am putting together a computer with a Antec P180 case and a Thermaltake TR2 RX 650 W power supply. The problem is that the Antec P180 case has a separate compartment for the power supply. With an opening for the on/off switch + ac connector to one side, a wall with a small hole for cables to route through on top, a wall on the bottom, and on the other side a fan which pushes air from the hard drive compartment to the power supply compartment. I think the design of the case assumes the power supplies fan is on the side next to the on/off switch, but the fan on the power supply I have is on top, which makes me worry about overheating the power supply. There is about half an inch between the top of the power supply and the wall and the other fan should keep air flowing to push out the air that the power supply pushes upwards. Do you think this setup should work, or should I go get another power supply? Thanks!! PS: This computer will be running an Ubuntu server, so it will always be on, but the rest of the components shouldn't be generating as much heat as they would on say a gaming machine.

  Read the article

• Permission denied when running Rails app in VirtualBox Ubuntu guest with files on Windows host

  - by Ola Tuvesson

  I think I'm close to having my dev environment set up exactly the way I want, but one final snag remains. I'm running VirtualBox on a Windows 7 64bit host, with my dev enviroment inside a Ubuntu 12.04 guest. I want to keep the files for my projects on the host filesystem - partly so I can access them when the Ubuntu guest is not running, but also so I can use Tortoise and other Windows based tools (cough Photoshop), and it also eases my backup scheme somewhat. So I've got a folder "Rails" on my NTFS drive, which I've shared (Samba) from the host with a user specifically created for the Ubuntu guest. The mount point has been set up and an entry added to fstab (cifs), using a credentials file and the options iocharset=utf8,mode=0777,dir_mode=07??77 This mounts fine and my Ubuntu user has both read and write permissions to the contents. But when I try to start my Rails app I get permission errors on any files the app needs to write to (e.g. the log file) - why is that? Are there any major conceptual flaws with this approach? Would I be better off using the VBox "shared folders" function?

  Read the article

• How can I automatically restart Apache and Varnish if can't fetch a file?

  - by Tyler

  I need to restart Apache and Varnish and email some logs when the script can't fetch robots.txt but I am getting an error ./healthcheck: 43 [[: not found My server is Ubuntu 12.04 64-bit #!/bin/sh # Check if can fetch robots.txt if not then restart Apache and Varnish # Send last few lines of logs with date via email PATH=/bin:/usr/bin THEDIR=/tmp/web-server-health [email protected] mkdir -p $THEDIR if ( wget --timeout=30 -q -P $THEDIR http://website.com/robots.txt ) then # we are up touch ~/.apache-was-up else # down! but if it was down already, don't keep spamming if [[ -f ~/.apache-was-up ]] then # write a nice e-mail echo -n "Web server down at " > $THEDIR/mail date >> $THEDIR/mail echo >> $THEDIR/mail echo "Apache Log:" >> $THEDIR/mail tail -n 30 /var/log/apache2/error.log >> $THEDIR/mail echo >> $THEDIR/mail echo "AUTH Log:" >> $THEDIR/mail tail -n 30 /var/log/auth.log >> $THEDIR/mail echo >> $THEDIR/mail # kick apache echo "Now kicking apache..." >> $THEDIR/mail /etc/init.d/varnish stop >> $THEDIR/mail 2>&1 killall -9 varnishd >> $THEDIR/mail 2>&1 /etc/init.d/varnish start >> $THEDIR/mail 2>&1 /etc/init.d/apache2 stop >> $THEDIR/mail 2>&1 killall -9 apache2 >> $THEDIR/mail 2>&1 /etc/init.d/apache2 start >> $THEDIR/mail 2>&1 # prepare the mail echo >> $THEDIR/mail echo "Good luck troubleshooting!" >> $THEDIR/mail # send the mail sendemail -o message-content-type=html -f [email protected] -t $EMAIL -u ALARM -m < $THEDIR/mail rm ~/.apache-was-up fi fi rm -rf $THEDIR

  Read the article

• Cursor lag when mouse cursor changes?

  - by Mathias Lykkegaard Lorenzen

  Cursor lag issue Introduction I'm experiencing a newly arrived problem lately that frustrates me a lot. The computer I bought is a Clevo 150ERM. Two of my friends bought the same machine, and are experiencing the same issue. The computer came with Windows 7. There, I had no issues. Then, when we all switched to Windows 8, they had the mouse problem and I didn't. That is until after 4 or 5 months when I decided to install the RTM driver of my Intel graphics chip, and the latest Nvidia driver. I also installed the latest version of Skype that just released (Skype 6 and Skype for Metro). This basically leads me to conclude that the issue is not hardware-prone, and is not based on the operating system itself, rather the drivers or components that follow with it. Description of the issue The issue itself (lag with the mouse) happens whenever the cursor icon changes. For instance, if I keep hovering from and to a textfield (and the cursor changes into a caret and then back to a mouse), it stops for 200 milliseconds while it changes the icon. An example is if I follow the mouse in the pattern shown by the arrows below. When crossing the window border, the cursor changes into a "resize window" cursor for a short while, making the cursor lag. This doesn't sound like much, but it happens every time the cursor changes (even if it's to just move the mouse somewhere else, and accidentally make it cross a window border from where the resize cursor shows etc). What do you suggest I try?

  Read the article

• Acer Aspire One getting extremely hot

  - by ascom

  I have an Acer Aspire One D250-1197. I really better type fast before it overheats again... For some reason, I'm having a problem with heat on my netbook only when I run Joli OS (Ubuntu 9.10 LTS?). When I leave it idle, with nothing running (other than the regular Joli OS desktop and a couple of doing-nothing terminals), heat slowly builds up to the point where the netbook is burning hot to the touch. I have never had this problem when running Windows 7 Starter (even though it gives me plenty of other headaches). It seems that the fan is spinning, but not fast enough to keep up with the heat buildup. Is there something wrong with the fan drivers? The computer doesn't seem to recognize that it is overheating. What can I do to solve this problem (other than shut it off or use Windows)? I'm currently on the wrong side of Earth (I mean, on vacation), so I just need a temporary fix, such as a driver I can install. Also, I have to use Linux, because I have to share out the wired connection in hotels wirelessly to the iPhones. EDIT: I'm switching from Joli OS to a more "proper" and up to date distribution (Xubuntu 13.04). I'll see if it still has the heat problem and try @nod's cpufreq idea.

  Read the article

• Change DPI setting in Windows 8.1 for the Logon Screen

  - by jmc302005

  How can the DPI setting be changed for the Logon Screen in Windows 8.1? Microsoft has added per-user DPI settings. But this means that there is no adjustable DPI setting for the Lock/Logon screen. You can change the DPI setting to be the same across all displays and this does affect the icons and font on the lock/logon screen. However, it does not affect any app/program that can run on the lock/logon screen. Ex. I use a 44" flat screen TV for my monitor on my desktop. Big enough for me to sit in my recliner and use my computer. I use the on-screen keyboard most of the time. (I don't want to keep a keyboard next to me.) The problem is that with the new DPI setup the on-screen keyboard takes up nearly half the screen, which is too big. I tried looking through the registry to see if I could find a setting for it. In the key HKEY_USERS\.DEFAULT\Control Panel\Desktop there is a string value named LogicalDPIOverride with a value of -1. I have a feeling this is where I can fix the issue. I tried changing the value to 0 and to 1 with no change in the result. Instead I noticed that after logging out and back in the -1 value was back in the registry. How can I change this default DPI? Can I use the LogPixels string that worked for DPI in Windows 7? Here are two Screen shots, one of the Lock Screen and one of the Logon Screen:

  Read the article

• how to split a very large database on sql server

  - by ken jackson

  I have a 90 GB SQL Server database that I want to make more manageable. It stores stock data from 50+ different stocks from 2009 and 2010, and each stock is a separate table. Some tables have hundreds of millions of rows, and other have just a few million. What I want to do is somehow split the database, so that I don't have a single database file that is 90 GB. What I want is to be able to somehow magically split all the tables so that I can backup the 2009 data once and not have to keep on including it in the backup every time I backup the entire database, however, I would like the 2009 data to be included whenever I do a query. Is partitioning the database the way to go? Will it do the above for me, or will I need some other solution? I research partitioning, but I wasn't sure if that would solve all my problems. I wasn't able to find anything that would tell me whether or not it would migrate prexisting data, or whether it only worked for newly inserted data. Any help or pointers would be much appreciated. Thanks in advance, Ken

  Read the article

• How to use Windows mini-dump files?

  - by ekaj

  I have a Mini-ITX Intel DH61AG mobo w/ an Intel i3 processor and 8GB of 1600MHz DDR3 RAM. Anyways, this computer has been crashing kind of frequently. It is not an OS problem, as I have used Ubuntu (and had kernel panics), Windows 7, and Windows 8 (BSODs aren't going to keep me from tinkering =p) Anyways, each of these OSes have had problems, so I ran a HDD check, and I know it is not a heat issue because I tested the processor for a few days when I first put the computer together. When I ran memtest86+, however, I got an error - so I did individual testing, and both chips came back good, did a really intense test with both of them again (took half a day), and no errors. So, I still think the problem could be RAM, but I am not sure - I tested it pretty extensively (might let it run all night again tonight)... which brings me to my point. Could someone explain to me (in simple terms if possible) how to READ the minidump files of Windows computers? I've tried before with a guide I found online, but failed miserably (can't remember guide, either =/). I'm fine with installing the software, I will probably need it sometime in the future as well. I have seen a few other posts on SU that just ask people to post minidump logs, but I feel as if that is too localized. Would someone be able to explain this? Note: If someone knows how to do this, but doesn't want to explain and is still willing to help me, this is the link for the minidump file =p Make sure to click

  Read the article

• Exporting Client Data from Groupwise 6.5 to Outlook 2010 without Crashing

  - by Adam Doherty

  My employer has recently moved from Novell GroupWise 6.5 to Exchange 2010. We've imposed mailbox limits on staff but we still need to move their old messages, contacts, calendars, etc. over to Outlook 2010. Our problem however is this, utilizing the Novell MAPI client is slow within Outlook 2010 and upon exporting messages to a PST file (for later re-attachment, and offline backup purposes) crashes the GroupWise server. Connecting to the server in Outlook via IMAP to export messages to PST is faster and apparently more stable but also crashes the server. We'll be keeping our GroupWise server online internally until then end of the year but I have staff with mailboxes approaching 12 gigabytes, which is fine if we're going to move the data to offline storage (DVD set) but if I keep crashing the server every time I try to get the data I'll just be spinning my wheels. In my first attempts, I tried to move mail for a staff member with 3GB of data. The transfer lasted roughly 8 hours before crashing. I'm wondering if there is an open source solution to my problem. Paid solutions exist but we're a not-for-profit organization and have too many staff to justify the costs of per seat licenses just to migrate mail.

  Read the article

• maillog "No route to host" error

  - by Sherwood Hu

  I have a CentOS server. It has sendmail installed but not used for a mail server. I forwarded the root email to another email address. However, I keep getting errors in maillog: Dec 6 08:49:16 server1 sm-msp-queue[16191]: qB6601et005433: to=root, ctladdr=root (0/0), delay=08:49:15, xdelay=00:00:00, mailer=relay, pri=883224, relay=[127.0.0.1], dsn=4.0.0, stat=Deferred: [127.0.0.1]: No route to host Dec 6 08:49:16 server1 sendmail[16190]: qB39nDfQ014062: to=<[email protected]>, delay=3+05:00:02, xdelay=00:00:00, mailer=esmtp, pri=6965048, relay=subdomain.example.com., dsn=4.0.0, stat=Deferred: subdomain.example.com.: No route to host Dec 6 08:49:16 server1 sendmail[16190]: qB39nDfR014062: to=<[email protected]>, delay=3+05:00:02, xdelay=00:00:00, mailer=esmtp, pri=7004959, relay=subdomain.example.com., dsn=4.0.0, stat=Deferred: subdomain.example.com.: No route to host In the forwarded email address, I received notification "it can't deliver email to [email protected]. subdoamin.example.com does have a MX record, and I do not want to add one. Is there any configuration that I can change to prevent this error? I want all emails to the root to be forwarded to the forward address.

  Read the article

• How to count the most recent value based on multiple criteria?

  - by Andrew

  I keep a log of phone calls like the following where the F column is LVM = Left Voice Mail, U = Unsuccessful, S = Successful. A1 1 B1 Smith C1 John D1 11/21/2012 E1 8:00 AM F1 LVM A2 2 B2 Smith C2 John D2 11/22/2012 E1 8:15 AM F2 U A3 3 B3 Harvey C3 Luke D3 11/22/2012 E1 8:30 AM F3 S A4 4 B4 Smith C4 John D4 11/22/2012 E1 9:00 AM F4 S A5 5 B5 Smith C5 John D5 11/23/2012 E5 8:00 AM F5 LVM This is a small sample. I actually have over 700 entries. In my line of work, it is important to know how many unsuccessful (LVM or U) calls I have made since the last Successful one (S). Since values in the F column can repeat, I need to take into consideration both the B and C column. Also, since I can make a successful call with a client and then be trying to contact them again, I need to be able to count from the last successful call. My G column is completely open which is where I would like to put a running total for each client (G5 would = 1 ideally while G4 = 0, G3 = 0, G2 = 2, G1 = 1 but I want these values calculated automatically so that I do not have scroll through 700 names).

  Read the article

• Getting Server 2008 R2 to ignore all traffic from Internet-facing NIC, leaving it to a VM

  - by Wolvenmoon

  I got in to Server 2008 R2 via Dreamspark and would like to start learning on it. I don't have much option but to put it on a system sitting between the Internet and my home LAN due to electricity bills and the fact that 3 computers in an 11x11 space in 102 degree weather is pretty stygian. Currently I use a ClearOS gateway to manage everything, what I'd like to do is take my server 2008 R2 box, which has two NICs, and drop it at the head of my network. I'd want Server 2008 R2 to ignore all traffic on the external facing NIC and pass it to a virtual ClearOS gateway, and to put all its Internet traffic through its other NIC - which will face the rest of my network and be the default gateway for it. The theory is to keep the potentially vulnerable Server 2008 R2 install as tucked behind a Linux box as possible, without sacrificing too much performance. This is a home network that occasionally hosts dedicated game servers and voice chat servers, so most malicious activity is in the form of drive by non-targeted attacks, however, I don't trust Windows Server because I don't know the OS well enough, yet. So, three questions: How do I do this, am I going to be reasonably more secure doing this than if I just let the Server 2008 R2 rig handle all the network traffic and DHCP (not an option), and should I virtualize the Server 2008 R2 rig instead and if so in what? (Core 2 Duo e6600 w/ 5 gigs usable RAM)

  Read the article

• Configuring vsftpd with nginx on Ubuntu 12.04 LTS

  - by arby

  I've attempted to configure a nginx / vsftpd server on Ubuntu 12.04 LTS (via amazon ec2) a couple times now, but I seem to keep making a mistake along the way. Currently, when I try to connect to my ftp server it takes a minute or so before it connects. Then when I issue a command, they all timeout with an operation failed error. Aside from these issues, I'm not completely confident with the file ownership & permissions or the configuration / settings. So, I think it's best if I just re-install and re-configure correctly. I believe the nginx installation comes with a default user of www-data:www-data and web root directory ownership by root:root. Vsftpd, however, needs to have a user created with the same group as the nginx user (www-data), and the same home directory as the nginx server (/usr/share/nginx/www), with g+w chmod permissions granted on that directory. The vsftpd.conf file should disable anonymous logins and enable local logins, file writing, and chroot local users. In my previous config, I had /bin/false set for the ftp user's shell and pam_shells.so disabled. I also had local_umask set to 0027. So, starting with a fresh ec2 instance, I've got: sudo apt-get install vsftpd sudo apt-get install nginx For the firewall I issued the command (not sure if necessary): sudo ufw allow ftp Which commands / config is recommended from here? I only need 1 ftp user that I can use to login with my ftp client to modify the single nginx web domain, which will need php & sql for WordPress.

  Read the article

• Browsing Playstation 3 from Ubuntu Box

  - by zfranciscus

  Hi, My Goal here is to be able to transfer files from my Ubuntu 10.04 box to my PS3 over a wireless network. My PS3 and my Ubuntu Box is on the same home network. These are some stuff that I tried: I can't see my PS 3 from 'Places ? Network' nor other computer that is running on windows. I am still puzzled by this fact. I have not tried ping-ing my PS3. I'll try that later today and post the result in the forum I install PS3MediaServer (http://code.google.com/p/ps3mediaserver/). Someone in the PS3 chat forum (http://www.ps3chat.com/playstation-3...lp-please.html) claims that it will enable your ubuntu box to browse PS3. So I downloaded PS3MediaServer, and ran the software. The status tab keep showing "Waiting ...". It seems that PS3MediaServer can't find my PS3. Some how I feel that 1 and 2 are related somehow.Perhaps that there is something wrong with my Ubuntu network settings that is preventing my ubuntu box from looking up other device on the network. I can go to the Internet fine, but I can't see other device on my network. Does anyone have any experience in this area. I would like to hear your experience and perhaps some solution. Any kind of hints or help will be greatly appreciated. Cheers

  Read the article

• Wireless access point -> Powerline -> Router -> Internet, should this work?

  - by Anthony

  My network at home used to be a laptop and desktop connected wirelessly to a single Wireless ADSL router, a Cisco 877W. Wireless reception around the house with this setup was quite unreliable, so I've gone about looking to improve it. I purchased some Belkin Gigabit powerline adapters and I've got these working fine. I can hook a computer up to one of the powerline adapters, and with the other one plugged into the ADSL router the computer has internet access. Additionally I can hook a Netgear DG834G Wireless ADSL router into it with the adsl not plugged in, and after turning off DHCP can RJ45 a computer up to the network. Everything works fine. However, if I setup a wireless network on the Netgear then any computer that connects wirelessly to it cannot access the internet. It gets an IP address very slowly via DHCP which is a good one, but it cannot access the internet. It can however communicate with the RJ45'd computer also connected to the Netgear. I wondered whether this could be a problem with the Netgear so I've borrowed a Cisco Aironet 1200 and got this working fine when it's attached directly to the primary ADSL router. I can connect to it wireless and get onto the internet. However, if I then plug it into the Netgear I can communicate with other devices attached to the Netgear, but can't get any further than the Netgear. All the while though the other devices RJ45'd to the Netgear are communicating with the internet just fine. I'm starting to suspect it's one of two things causing the problem: 1) For some reason the belkin powerline adapters don't like carrying wireless-originating signals. Could this be possible? 2) The primary Cisco ADSL router doesn't want to communicate with other devices on my network more than one hop away from it. I'm making an assumption here that within the Netgear box the wireless and wired sides are handled differently. Could this be true? Has anyone successfully setup something similar to what I'm trying, with a wireless device on the otherside of a pair of powerline connectors? Update 06/07/2010 - Response to irrational John 28 June Thanks for the answer John - and for clearing up some of my questions. The model number of the belkin powerline adapters are F5D4076. Security was apparently enabled by default on them, and I didn't change them from their default setting. The network diagram in your answer shows exactly what I'm trying to setup: I've followed that guide and I'm still not able to get things working properly. The thing that perplexes me is that wired network traffic works just fine - it's only the wireless traffic that doesn't. This is with the same laptop, and the same DHCP or static IPs. "1. What IP addresses did you assign to each router? What subnet masks are you using?" - subnet is 255.255.255.0, the router connected to the adsl is 192.168.153.1 and that has the DHCP server. The access point on the other side of the powerline adapters I've tried both a static IP of 192.168.153.110, same subnet, and a DHCP-assigned IP. The other devices are DHCP, although I also tried manually entering IP settings. "2. Have you correctly enabled DHCP on only one of the routers and disabled it on all the others?" Yes I have - only the internet-connected router has DHCP enabled. The IP range for the DHCP is from 192.168.153.11 - 192.168.153.200. The strange thing is that wired connections work fine on the LAN, plugged into any router, work fine - it's only the wireless connections that aren't working when they're plugged into the non-primary AP. "Since the routers you are using appear to integrate an ADSL modem I'm assuming there is no WAN port on them." There's no NAT within the LAN, and all wired connections are connected to LAN ports. It's something wrong with the wireless - wired works fine throughout the whole LAN. Update 06/07/2010 - Response to irrational John 29 June The diagram you've drawn in your answer shows pretty much exactly what I'm trying to do. I've spent another evening trying different things and made some progress but I'm still scratching my head. I've borrowed a Netgear access point and been trying with this, and the strange thing is that my PC is working now - this is a Windows 7 PC connected to the access point in the position of where the DG834G is in the diagram. Meanwhile, however, I have an old Powerbook G4 12" I use for music, and while that has a DHCP-assigned IP address, it's not getting any network throughput to either LAN or internet addresses. To make matters more strange, my phone appears to be intermittently working when it's on the wifi. The access point is a Netgear WPN802v1, DHCP, NAT both switched off, running firmware 2.0.9.0. Last night I set it up with exactly the same settings, and similar to tonight I could get a couple of devices to work, and a couple not to. By the morning, however, everything had stopped working - nothing could get a DHCP IP address. I rebooted the 877W earlier this evening and I'm wondering whether this is why a few things are working now. "Could it be possible that the issue could be with the 877W?" I didn't configure this - is it possible that the DHCP server only likes assigning devices that are immediately attached to it? Or similar, could a firewall be stopping too many addresses that are coming through one device? (ie. the Access Point) This could explain why devices are working at the start but then not by the end. In reply to your questions, "1. I looked at the Netgear DG834G support page. There are five versions of this router. Which version do you have? Netgear usually lists this on the label on the bottom of the router. What version of the firmware does it have?" It's a DG834Gv3, and the firmware is the last on the netgear site version 4.01.40. "3. Not knowing which version you have, I glanced at the reference manual for the DG834G v3. In the section for Wireless Settings under the subsection Wireless Access Point there is a check box for a Wireless Isolation setting. If you have this setting it should be off/unchecked. If it is checked then any device connected via wireless would not be able to talk to any other device on the LAN. This sounds like your problem so maybe this is the cause?" I've checked this and it's switched off. I've made a change to the IP of the access point to something outside the DHCP range - it's now 192.158.153.5, with DHCP starting at 11 and going up to 254. Thanks for the tip about this - I only have a few devices so wouldn't anticipate the DHCP server assigning up to 110, but better safe than sorry. Finally one more thing I thought I should add, is with the Powerbook G4 that's not working - it's getting a DHCP IP address and it can communicate with the WPN802 as I can visit the administration page. Anything further than this, however, it can't reach; I can't administrate the 192.168.153.1 (877W router). Strangely, however, when I open Finder on the same powerbook it's detecting my NAS which is attached directly via wire to the 877W. If I try to browse it, it says connection failed. RE: "Perhaps the problem with your Powerbook is with DNS?.." The IP settings on the powerbook are identical to that of the PC with the exception of the IP address; the PC is 192.168.153.17 and the powerbook is 192.168.153.12. Subnets are the same, 255.255.255.0 and default gateway is the same, .1, and the DNS servers are the same. I administrate the 877W by going to 192.168.153.1 in the browser. This is what isn't working from the Powerbook, despite the PC working fine when I do the same. Meanwhile, however, I can administrate the AP on 192.168.153.5 from both PC and Powerbook Update 06/07/2010 - FINAL RESOLUTION of sorts: First off, sorry for the length of this question. I need start to practice a more concise writing style, so I'm going to try to keep this bit brief. After much fiddling, and with the hugely-appreciated help of irrational John, I have come to the conclusion that it's something wrong with the powerbook. I believe that this was perhaps the reason I doubted things worked at the very beginning. I now have the original DG834Gv3 running both wirelessly and wired, and both wired devices and wireless devices get internet connectivity. The only anomaly is the powerbook which I've had to keep wired, as no matter what I do it refuses to work wirelessly. I still have suspicions that the 877W isn't quite right; I'm fairly sure that if I RJ45 the powerline adapter into a different LAN port on it then everything will break. I've just about run out of patience to test this further, and I think I need to go into the 877W's config to match the 877w's lan port's settings. I'm accepting irrational John's answer as he's been enormously helpful, way above the call of duty, and for this line he wrote: Beats the heck out of me. which in the midst of great frustration made me chuckle, and for a sentence in one of his comments to the same answer: If it is specific to the Powerbook I would put that issue aside until after you feel you have the rest of your LAN and the additional WAP all working together correctlyt It was this second sentence that made me put the powerbook aside and concentrate on the other devices that ultimately led me to getting things working.

  Read the article

• How can I erase the traces of Folder Redirection from the Default Domain Policy

  - by bruor

  I've taken over from an IT outsourcer and have found a struggle now that we're starting a migration to windows 7. Someone decided that they would setup Folder redirection in the Default Domain Policy. I've since configured redirection in another policy at an OU level. No matter what I do, the windows 7 systems pick up the Default Domain Policy folder redirection settings only. I keep getting entries in the event log showing that the previously redirected folders "need to be redirected" with a status of 0x80000004. From what I can tell this just means that it's redirecting them locally. Is there a way I can wipe that section of the GPO clean so it's no longer there? I'm hesitant to try to reset the default domain policy to complete defaults. ***UPDATE 6-26 I found that the following condition occurred and was causing the grief here. I've already implemented the new policies for clients, and for some reason, XP was working great, 7 was refusing to process. The DDP was enforced. Because of this, and the fact that the folder redirection policies were set to redirect back to the local profile upon removal, it was forcing clients to pick up it's "redirect to local" settings. Requirements for to recreate the issue. -Create a new test OU and policy. -Create some folder redirection settings, set them to redirect to local upon removal -Remove settings on that GPO -Refresh your view of the GPO and check the settings. -You'll notice that the settings show "not configured" entries for folder redirection. -Enforce this GPO -Create another sub-OU -Create a GPO linked to this sub-ou and configure some folder redirection settings. -Watch as the enforced GPOs "not configured" setting overrides the policy you just defined. I've had to relink the DDP to all OU's that have "block inheritance" enabled, and disable the "enforced" option on the DDP as a workaround. I'd love to re-enable enforcement of the DDP, but until I can erase the traces of folder redirection settings from the DDP, I think I'm stuck.

  Read the article

• sorry, the maximum allowed clients from your host (10) are already connected" FTP error

  - by Sejanus

  Hello, I keep getting the "sorry, the maximum allowed clients from your host (10) are already connected" error whenever I try to transfer a large number of files. At first I thought it's a filezilla bug, however I get the same error basically with every FTP client I've tried, including Total Commander under Wine. I do not get that error using Windows. I did try to limit maximum allowed connections for Filezilla, both in server settings and in global settings, it didnt change anything. I did try to switch between passive and active modes (not sure if it's related at all, just last desperate attempt), and it didnt change anything either. When I try to use native ftp client (not sure how is it called, the one in Places - Connect to a server) I get abstract "connection refused" error every time I transfer large number of files. Connection is refused for separate particular files, if I click "Ignore" each time the rest of files are transfered perfectly well, so I assume it's the very same error. Anything I could do? This really drives me mad, transfering large numbers of files is a part of my everyday job... P.S. and this happens with many different FTP servers. Also I dont get this error in Windows. So I assume it's not a server problem. P.P.S. I am aware of similar question here, the answer provided just didn't solve it to me.

  Read the article

• How do I host multiple independent, secured SharePoint sites (WSS 3.0) without using Active Directory on the same server?

  - by Kyle Noland

  I have a SharePoint site set up on one of my networks to service Active Directory users. To be clear, this is a Windows SharePoint Services 3.0 installation running on Windows Server 2003 Standard. It is not an option to upgrade the server or SharePoint version. Management would like to create several new sites, one for each of a handful of clients. These sites will be used like "dropboxes" or FTP sites so that my company can make large files available to outside contacts, and vice versa. Here are my requirements: I do not want to have to create Active Directory accounts for each external contact. If possible, I would like to store the external usernames and passwords in a database that I can write a small GUI for so that management can handle adding their own external contacts. Each client site must be sandboxed from each other and from my main company SharePoint site. I would like to keep everything running on port 80 and be able to access the sites as either clientname.mycompany.com or www.mycompany.com/clientname If anybody has ever done this I would really appreciate hearing about any lessons you learned and suggestions for how to set this up. Kyle

  Read the article

• GTX 280 purple snow on bootup, card works without drivers

  - by Brokar

  i have owned a ASUS GTX280 for 3 years now. The card has been great all along but i started having problems 10 days ago. I was playing Diablo 3 for 1 week on max settings no problems, then suddenly my display kept getting some weird purple/colours as soon as i booted and logged into windows. Went into safe mode, updated drivers and it kept crashing. Formatted PC, fresh windows install with new WHQL drivers again same problem. Uninstalled nvidia drivers and pc has been running great for 4 days now, ofcourse i cannot run games but everything works on 1680x1050 resolution and i can browse internet,watch movies and use my PC for everything but gaming. As soon as i install nvidia drivers PC won't boot. I only wanna game a few hours a week (very busy program with school this month so it might be a blessing that i cannot game) and i would love it if i could keep the card. I am looking to upgrde later on when i will have time for gaming but i wonder if i could still use the card somehow with different/new drivers (tried older drivers that came with the card on a CD aswell) tldr: PC works fine with no nvidia drivers (apart from gaming ofc). Once i install WHQL drivers or older ones, cannot even log into windows. Fix?

  Read the article

• Process killing trouble

  - by Aditya Singh

  I am trying to program a server software which involves a lot of testing on java / scala platform. Whenever i compile and execute the code. It starts listening on port 80. Sometimes i need to terminate it by Ctrl+C when it hangs. In that case, ubuntu is not freeing the port. So in order to run the process, i have to restart the machine. I see this at ps aux root 1924 0.0 0.0 5796 1660 pts/0 T 05:44 0:00 sudo scala - root 1925 0.2 1.5 491448 40796 pts/0 Tl 05:44 0:03 java -Xmx256M -Xms16M So process 1924 and 1925. I did sudo kill on both these. But then they keep on persisting even after a long time. sudo nmap -T Aggressive -A -v 127.0.0.1 -p 1-65000 Scanning localhost (127.0.0.1) [65000 ports] Discovered open port 80/tcp on 127.0.0.1 It means its still there ! sudo netstat --tcp --udp --listening --program tcp6 0 0 [::]:www [::]:* LISTEN 1925/java tcp6 0 0 ip6-localhost:ipp [::]:* LISTEN 1185/cupsd This means its 1925 - java How to kill it.

  Read the article

• How to speed up a HP M9517C

  - by Jen

  I bought a system with 8GB RAM, 1TB HD, Quad-Core AMD Phenom 9550, Nvidia Geforce 9300GE, 64-bit Windows Vista Machine. Bought it primarily because it was cheap and came with 25.5 inch screen. Problem: It's slow - if you can believe it. My Dell laptop 1525 is faster and more stable! I tried installing and dual-booting Linux Mint and ran into video and audio troubles. I need fast and stable and I'm going for awesome. Anyone have some suggestions on making this thing smoking hot? Vista is fine, but slows over time - suspect virus/spyware/etc.. But I need to use Photoshop, Fireworks, Dreamweaver, Illustrator. I've tried the alternatives and I just don't like them. When you've got deadlines looming you want to work with what you know. Also use Skype (and I had audio problems with it in Linux), gotomeeting, gotowebinar. Don't need MS Office. Tried VMWare, Virtualbox and again - I keep getting audio/video problems. I'd love someone's input on THEIR setup and how they got there. I'm sure I need to upgrade my video card, but what should I go to?

  Read the article

• Task Scheduler Crashing MMC

  - by Valrok

  I've been getting errors whenever I try to run the task scheduler for Windows 2008 R2. Each time that I've tried running it, the task scheduler will crash and report the following: Problem signature: Problem Event Name: CLR20r3 Problem Signature 01: mmc.exe Problem Signature 02: 6.1.7600.16385 Problem Signature 03: 4a5bc808 Problem Signature 04: System.Windows.Forms Problem Signature 05: 2.0.0.0 Problem Signature 06: 50c29e85 Problem Signature 07: 151f Problem Signature 08: 18 Problem Signature 09: Exception OS Version: 6.1.7601.2.1.0.16.7 Locale ID: 1033 I've been looking online but so far I keep finding mixed results on what could be the fix for this and was wondering if anyone here has ever ran into this issue before. I read that this issue could be because of Security Update for Microsoft Windows (KB2449742) and that by uninstalling it I would be able to fix this issue, however I was not able to locate this anywhere in the server. Here's the link if interested Patch wise, everything is up to date. Also, I tried running hotfix KB2688730 to see if that would work after doing some research online, however the hotfix is not applicable to the computer. If anyone could provide some information on how to fix this and get the task scheduler running again it would be extremely helpful!

  Read the article

• Windows Server 2008R2 Virtual Lab Activation strategies?

  - by William Hilsum

  I have a ESXi server that I use for testing, however, I am often needing to create additional Windows Server virtual machines. Typically, if I do not need a VM for more than 30 days, I simply do not activate. However, I have been doing a lot of HA/DRS testing recently and I have had a few servers up for more than this time. I have a MSDN account with Microsoft and have already received extra keys for Windows Server 2008 R2. I am doing nothing illegal and I am sure if I asked, they would issue more - but, I do not want to tempt fate! I have got 3 different "activated" windows snapshots I can get to at any time. If I try to clone these machines, I get the usual "did you copy or move them VM" message. If I choose copy, as far as I can see, it changes the BIOS ID and NIC MACs which is enough to disable activation. If I choose move, it keeps the activation fine (obviously, I know to change the NIC MAC - I believe I can leave the BIOS ID without problems). However, either of these options keeps the same SID code for the computer and user accounts. After the activation period has expired, as far as I can see, all that happens is optional updates do not work - it seems that the normal updates work fine. Based on this, as you can easily get in to Windows when not activated without any sort of workaround, I was wondering if it is ok just to leave a machine un activated? (However, I obviously would prefer if it was activated!) Alternatively, how dangerous is it run multiple machines on a non domain environment with the same SID? I am just interested to know if anyone can recommend a strategy for me? I have only found one solution that deals with bypassing activation - I am not interested in doing anything remotely dodgy... at a stretch, I am happy to rearm (I have never needed to keep a server past 100 days), but, I would rather have a proper strategy in place.

  Read the article

• SSH over HTTPS with proxytunnel and nginx

  - by Thermionix

  I'm trying to setup an ssh over https connection using nginx. I haven't found any working examples, so any help would be appreciated! ~$ cat .ssh/config Host example.net Hostname example.net ProtocolKeepAlives 30 DynamicForward 8118 ProxyCommand /usr/bin/proxytunnel -p ssh.example.net:443 -d localhost:22 -E -v -H "User-Agent: Mozilla/4.0 (compatible; MSIE 6.0; Win32)" ~$ ssh [email protected] Local proxy ssh.example.net resolves to 115.xxx.xxx.xxx Connected to ssh.example.net:443 (local proxy) Tunneling to localhost:22 (destination) Communication with local proxy: -> CONNECT localhost:22 HTTP/1.0 -> Proxy-Connection: Keep-Alive -> User-Agent: Mozilla/4.0 (compatible; MSIE 6.0; Win32) <- <html> <- <head><title>400 Bad Request</title></head> <- <body bgcolor="white"> <- <center><h1>400 Bad Request</h1></center> <- <hr><center>nginx/1.0.5</center> <- </body> <- </html> analyze_HTTP: readline failed: Connection closed by remote host ssh_exchange_identification: Connection closed by remote host Nginx config on the server; ~$ cat /etc/nginx/sites-enabled/ssh upstream tunnel { server localhost:22; } server { listen 443; server_name ssh.example.net; location / { proxy_pass http://tunnel; proxy_set_header Host $host; proxy_set_header X-Real-IP $remote_addr; proxy_set_header X-Forwarded-For $proxy_add_x_forwarded_for; proxy_redirect off; } ssl on; ssl_certificate /etc/ssl/certs/server.cer; ssl_certificate_key /etc/ssl/private/server.key; } ~$ tail /var/log/nginx/access.log 203.xxx.xxx.xxx - - [08/Feb/2012:15:17:39 +1100] "CONNECT localhost:22 HTTP/1.0" 400 173 "-" "-"

  Read the article

< Previous Page | 432 433 434 435 436 437 438 439 440 441 442 443  | Next Page >