Search Results

Search found 13178 results on 528 pages for 'subsonic active record'.

Page 438/528 | < Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >

  • FancyBox Callback Keydown

    - by headShrinker
    I have been working on this code, and I can't seem to figure it out. Fancybox's callbacks don't seem to work at all. I have the keyboard bound to the pagination for this gallery. But I want to unbind the keyboard from the table when fancybox opens. When fancybox opens nothing changes.... What to do?? $(document).ready(function() { $('a.active').click(function() { var url = $(this).attr('href'); $('#ajaxTable').load(url+'/1'); return false; }); $("a.fancy").fancybox({ callbackOnStart: function() { $('a#gleft a#gright').unbind("keydown"); }, 'frameWidth': 570, 'frameHeight': 470 }) $(document).keydown(function(event) { if(event.keyCode == 37 ) { var url = $('a#gleft').attr('href'); if (url != null) { $('#ajaxTable').load(url+'/1'); $(document).unbind("keydown"); } } else if(event.keyCode == 39 ) { var url = $('a#gright').attr('href'); if (url != null) { $('#ajaxTable').load(url+'/1'); $(document).unbind("keydown"); } } }); });

    Read the article

  • BackgroundWorker From ASP.Net Application

    - by Kevin
    We have an ASP.Net application that provides administrators to work with and perform operations on large sets of records. For example, we have a "Polish Data" task that an administrator can perform to clean up data for a record (e.g. reformat phone numbers, social security numbers, etc.) When performed on a small number of records, the task completes relatively quickly. However, when a user performs the task on a larger set of records, the task may take several minutes or longer to complete. So, we want to implement these kinds of tasks using some kind of asynchronous pattern. For example, we want to be able to launch the task, and then use AJAX polling to provide a progress bar and status information. I have been looking into using the BackgroundWorker class, but I have read some things online that make me pause. I would love to get some additional advice on this. For example, I understand that the BackgroundWorker will actually use the thread pool from the current application. In my case, the application is an ASP.Net web site. I have read that this can be a problem because when the application recycles, the background workers will be terminated. Some of the jobs I mentioned above may take 3 minutes, but others may take a few hours. Also, we may have several hundred administrators all performing similar operations during the day. Will the ASP.Net application thread pool be able to handle all of these background jobs efficiently while still performing it's normal request processing? So, I am trying to determine if using the BackgroundWorker class and approach is right for our needs. Should I be looking at an alternative approach? Thanks and sorry for such a long post! Kevin

    Read the article

  • Anyone got a nifty credit expiry algorithm?

    - by garethkeenan
    Our website uses a credit system to allow users to purchase inexpensive digital goods (eg. photos). We use credits, rather than asking the user to pay for items individually, because the items are cheap and we are trying to keep our credit-card/PayPal overhead low. Because we aren't a bank, we have to expire credits after a certain amount of time. We expire deposit credits after a year, but other types of credits (bonuses, prizes, refunds) may have a different shelf-life. When a buyer buys an item, we spend the credit that is going to expire first. Our current system keeps track of every deposit by storing the original value and the remainder to be spent. We keep a list of all purchases as well, of course. I am currently moving to a system which is much more like a traditional double-entry accounting system. A deposit will create a ledger item, increasing the user's 'spending' account balance. Every purchase will also create a ledger item, decreasing the user's 'spending' account balance. The new system has running balances, while the old system does not, which greatly improves our ability to find problems and do reconciliations. We do not want to use the old system of keeping a 'remainder' value attached to each deposit record because it is inefficient to replay a user's activities to calculate what the remainder of each deposit is over time (for the user's statement). So, after all of this verbose introduction, my question is "Does anyone else out there have a similar system of expiring credits?" If you could describe how you calculate expired credits it would be a great help. If all expired credits had the exact same shelf life, we would be able to calculate the expired amount using: Total Deposits - Total Spending - Deposits Not Due To Expire = Amount to Expire However, because deposits can have different shelf lives, this formula does not work because more than one deposit can be partially spent at any given time.

    Read the article

  • jQuery Autocomplete plugin (Jorn Zaefferer's) - how to dynamically change the list of displayed valu

    - by Max Williams
    I'm using Jorn Zaefferer's Autocomplete query plugin, http://bassistance.de/jquery-plugins/jquery-plugin-autocomplete/ I have options set so it shows all the values when you click in the empty text field, a bit like a select, and the option is also set so that the user can only choose from the list of values used by the autocomplete (so it's kind of like a select but with autocomplete functionality). I have two radio buttons below the text field, which determine whether the user chooses from a long list or a short list of possible values. I want to update the values used in the autocomplete when one of these radio buttons is clicked. Currently i'm doing this in a not very clever way by calling autocomplete again on the same text field, with the different array of values, but this creates a situation where both are active at once, and i can see the long list peeking out from behind the short list. What i need to do is either a) dynamically change the values used in the autocomplete or b) remove (unbind?) the autocomplete from the text field before re-initialising it. Either of these would do tbh though option a) is kind of nicer. Any ideas anyone? Here's my current code: function initSubjectLongShortList(field, short_values, long_values){ $(".subject_short_long_list").change(function(){ updateSubjectAutocomplete(field, short_values, long_values); }); updateSubjectAutocomplete(field, short_values, long_values); } function updateSubjectAutocomplete(field, short_values, long_values){ if($(".subject_short_long_list:checked").attr('id') == "subject_long_list"){ initSubjectAutocomplete(field, long_values); } else { initSubjectAutocomplete(field, short_values); } } function initSubjectAutocomplete(field, values){ jQuery(field).autocomplete(values, { minChars: 0, //make it appear as soon as we click in the field max: 2000, scrollHeight: 400, matchContains: true, selectFirst: false }); } cheers, max

    Read the article

  • php cli script hangs with no messages

    - by julio
    Hi-- I've written a PHP script that runs via SSH and nohup, meant to process records from a database and do stuff with them (eg. process some images, update some rows). It works fine with small loads, up to maybe 10k records. I have some larger datasets that process around 40k records (not a lot, I realize, but it adds up to a lot of work when each record requires the download and processing of up to 50 images). The larger datasets can take days to process. Sometimes I'll see in my debug logs memory errors, which are clear enough-- but sometimes the script just appears to "die" or go zombie on me. My tail of the debug log just stops, with no error messages, the tail of the nohup log ends with no error, and the process is still showing in a ps list, looking like this-- 26075 pts/0 S 745:01 /usr/bin/php ./import.php but no work is getting done. Can anyone give me some ideas on why a process would just quit? The obvious things (like a php script timeout and memory issues) are not a factor, as far as I can tell. Thanks for any tips PS-- this is hosted on a godaddy VDS (not my choice). I am sort of suspecting that godaddy has some kind of limits that might kick in on me despite what overrides I put in the code (such as set_time_limit(0);).

    Read the article

  • sIFR3 and line-height/leading

    - by stephaniesullivan.mp
    I've successfully implemented sIFR3 using the nightlies from the end of Oct. All is well and much easier to work with than sIFR2 except where it comes to line-height. I was able to deal with my headings fine. But I have a pullquote that needs more line-height/leading and though I've read through support and see that it needs to be applied to the .sIFR-root, it's not working. Is there something funky I don't know about? Here's my code: sIFR.replace(fedraBook, { selector: '.callout p', css: '.sIFR-root { background-color: #FFFFFF; color: #968b85; leading: 3.5;}' }); I had the leading at 1.5 but changed to 3.5 just to see if I could get it to vary at all. It does not. I tried also affecting it with this CSS selector with no joy: .sIFR-active .callout p { font-size: 1.6em; padding-top: 7px; line-height: 2.5em; } Does anyone have any ideas here? What am I missing?

    Read the article

  • How do I enumerate all monitors in Windows 7?

    - by Jon Tackabury
    I am trying to enumerate all the monitors in Windows 7, and according to MSDN, using the QueryDisplayConfig method is the correct way to do this. All of this code works fine, and returns a couple of arrays, one with paths and one with modes. However, it doesn't have the same monitor ID's as Windows. I am trying to build an array of all the monitors that appear in the Windows 7 "Screen Resolution" dialog. The paths collection return far too many items, and I'm not sure how to tell if it's a valid non-active monitor. Any help would be much appreciated. UINT32 PathArraySize = 0; UINT32 ModeArraySize = 0; DISPLAYCONFIG_PATH_INFO* PathArray; DISPLAYCONFIG_MODE_INFO* ModeArray; GetDisplayConfigBufferSizes( QDC_ALL_PATHS, &PathArraySize, &ModeArraySize); PathArray = (DISPLAYCONFIG_PATH_INFO*)malloc( PathArraySize * sizeof(DISPLAYCONFIG_PATH_INFO)); memset(PathArray, 0, PathArraySize * sizeof(DISPLAYCONFIG_PATH_INFO)); ModeArray = (DISPLAYCONFIG_MODE_INFO*)malloc( ModeArraySize * sizeof(DISPLAYCONFIG_MODE_INFO)); memset(ModeArray, 0, ModeArraySize * sizeof(DISPLAYCONFIG_MODE_INFO)); LONG rtn = QueryDisplayConfig( QDC_ALL_PATHS, &PathArraySize, PathArray, &ModeArraySize, ModeArray, NULL);

    Read the article

  • Magento started showing PHP language errors since I downloaded the blank theme using Connect

    - by Aayush
    I used the Magento Connect downloader to install the blank theme extension, but I did not switch to it as I was unable to access any-page anymore. Instead, it started showing php errors for front-end and Magento generated security errors for admin. Frontend Error: Fatal error: Call to a member function toHtml() on a non-object in D:\xampp\htdocs\newpinch\app\code\core\Mage\Core\Model\Layout.php on line 529 Admin error on Log-in: There has been an error processing your request Exception printing is disabled by default for security reasons. Error log record number: 1608724822 Link to the theme extension I installed. I didn't even change the theme from the default, can anyone please tell me what am I doing wrong. I just installed the theme and then clicked on "Return to admin" in Magento Connect but it was unable to go instead started refreshed the Magento Connect page, only this time without any CSS styling. The only page that still appears correctly is the admin log-in page. Please help me, I have already tried the forums at magentocommerce.com and their community sucks. 0 views & 0 replies. please help...

    Read the article

  • SQL CE: Limiting rows returned in the query

    - by Diakonia7
    In SQL Compact Edition 3.5 , note that it is the Compact Edition I am talking about- Is there a way to limit the amount of rows to only 2? Something like using LIMIT or TOP. I really don't want to use anything with a SqlCEDataReader, or SqlCEResultSet. I want to do all the limiting in the query. Is this possible now? I have looked around and it doesn't seem so. EDIT- In response to Dave Swersky's request for data and using Min()/Max() on some columns as a means to get the top 2 lines, here is some sample (sterilized) data: Line Site Function Status 1010 Las Vegas new 4 1020 DC send 1 1030 Portland copy 1 1040 SF copy 1 1050 Portland copy 1 1060 DC send 1 *There are more columns than this but these are the significant ones. Sorry for the lack of intuitive data (but the actual data is even less intuitive!), but for security i need to change the data. So- i need to determine: what site the record was at in the preceding line to determine where it needs to be picked up. The site on any given line (except the first line with function = 'new') corresponds to where the item is going next. So simply grabbing that site off the same line wont tell me where it came from. The status will always be 1 or 4. The 4 corresponds to a where it has been delivered already and so i dont want to include those records in the result. But it might be useful in getting the pickup site. For this table of data i want the query to return the site corresponding to the line just above the first line with status 1. So- for this it would be Las Vegas.

    Read the article

  • iPhone: Get indexPath of Predicate Object

    - by Nic Hubbard
    I am using a predicate to find an object in core data. I can successfully find the object that I want, but I need to also get the indexPath of that object, so that I can push a details view in for that object. Currently I have the following code for getting my object: NSFetchRequest *fetchRequest = [[NSFetchRequest alloc] init]; [fetchRequest setEntity:[NSEntityDescription entityForName:@"Ride" inManagedObjectContext:self.managedObjectContext]]; NSPredicate *predicate = [NSPredicate predicateWithFormat:@"title = %@ AND addressFull = %@", view.annotation.title, view.annotation.subtitle]; [fetchRequest setPredicate:predicate]; NSMutableArray *sortDescriptors = [NSMutableArray array]; [sortDescriptors addObject:[[[NSSortDescriptor alloc] initWithKey:@"title" ascending:YES] autorelease]]; [sortDescriptors addObject:[[[NSSortDescriptor alloc] initWithKey:@"addressFull" ascending:YES] autorelease]]; [fetchRequest setSortDescriptors:sortDescriptors]; [fetchRequest setReturnsObjectsAsFaults:NO]; [fetchRequest setPropertiesToFetch:[NSArray arrayWithObjects:@"title", @"addressFull", nil]]; NSError *error = nil; NSArray *fetchedItems = [self.managedObjectContext executeFetchRequest:fetchRequest error:&error]; // Sohow what record we returned NSLog(@"%@",[fetchedItems objectAtIndex:0]); So, I can correctly get my object into an array. But how do I translate that object into an indexPath?

    Read the article

  • managed beans as managed properties

    - by Sean
    I am using JSF 1.1 on WebSphere 6.1. I am building search functionality within an application and am having some issues. I've stripped out the extras, and have left myself with the following: 4 managed beans: SearchController - Controller bean, session scope SearchResults - session scope (store the results) ProductSearch - session scope (store the search conditions) ResultsBacking - Backing bean for DataTable, used to determine which row was clicked, request scope The SearchController bean has, as managed properties, the other 3. All except ResultsBacking are session scoped. If there is only 1 item in the search results, I want to bring up that record directly. I call setFirst(0) for the data table in the ResultsBacking method (I want to use the existing method that handle which item was clicked, so this is called right after the setFirst). When I go to do another search, I get an IllegalArgumentException when calling getRowData in the data table. According to the api, this is thrown 'if now(sic) row data is available at the currently specified row index'. I'm confused as to why this happens. It works the first time but not the second. Do I need to remove the ResultsBacking on a new search to get rid of the old state?

    Read the article

  • Web user expectations

    - by Ash
    When designing a good Web GUI what expectations can we expect from an end user? I've come up with the following, but I wonder if there are any others which can suggest.. If I click on a hyperlink it will take me to another page/part of this page If I tick/untick a checkbox it might alter the page state (enable/disable elements) If I click on a button I expect it to do something to data. If I click on a button I expect something to happen immediately (either to the current page, or for me to be taken to another page) If I have clicked on a hyperlink and it has taken me to another page, I expect to be able to use the Back button to get back to the previous page in a state similar to that which I left it in If I change something in a form, I can change it back to its previous value if necessary Unless I click on the 'Submit' button nothing should happen to my data. If I bookmark/favourite a page then it should show the same related data each time I visit it If text is underlined and looks like a link, it should be a link and act as one The reasoning behind this question is more a 'UI from hell' one. For example I have come across pages which checking a tickbox next to a record will delete it, straight away, via ajax. To me that just seems wrong, a checkbox is a toggle - something which a delete operation definitely isn't!

    Read the article

  • Weblogic 10.3.0 : Loosing a stateless session bean in the bean pool

    - by KlasE
    Hi, We have a strange situation where we loose a Stateless SessionBean in a Bean Pool in Weblogic 10.3.0 Since we only have one bean in the pool, this effectively hangs all incoming calls. We do not want more than one instance in the pool because of application restrictions. In the Weblogic admin console, we can see that there are 1 instance in the bean pool, 0 beans in use and 1 waiting incoming request. The question is, what can have caused the system to not send the request to the one obviously free bean instance? This happens after several hours and over 100000 incoming requests, and the same scenario worked fine in the old weblogic 8 environment. We get the following stacktrace: "[ACTIVE] ExecuteThread: '5' for queue: 'weblogic.kernel.Default (self-tuning)'" waiting for lock java.util.concurrent.locks.AbstractQueuedSynchronizer$ConditionObject@b0d484 TIMED_WAITING sun.misc.Unsafe.park(Native Method) java.util.concurrent.locks.LockSupport.parkNanos(LockSupport.java:198) java.util.concurrent.locks.AbstractQueuedSynchronizer$ConditionObject.await(AbstractQueuedSynchronizer.java:2054) weblogic.ejb.container.pool.StatelessSessionPool.waitForBean(StatelessSessionPool.java:269) weblogic.ejb.container.pool.StatelessSessionPool.getBean(StatelessSessionPool.java:111) weblogic.ejb.container.manager.StatelessManager.preInvoke(StatelessManager.java:148) weblogic.ejb.container.internal.BaseRemoteObject.preInvoke(BaseRemoteObject.java:227) weblogic.ejb.container.internal.StatelessRemoteObject.preInvoke(StatelessRemoteObject.java:52) com.mycompany.beans.MessageLogFacace_n73y0z_EOImpl.isMyStuffValid(MessageLogFacace_n73y0z_EOImpl.java:261) com.mycompany.beans.MessageLogFacace_n73y0z_EOImpl_WLSkel.invoke(Unknown Source) weblogic.rmi.internal.BasicServerRef.invoke(BasicServerRef.java:589) weblogic.rmi.cluster.ClusterableServerRef.invoke(ClusterableServerRef.java:230) weblogic.rmi.internal.BasicServerRef$1.run(BasicServerRef.java:477) weblogic.security.acl.internal.AuthenticatedSubject.doAs(AuthenticatedSubject.java:363) weblogic.security.service.SecurityManager.runAs(Unknown Source) weblogic.rmi.internal.BasicServerRef.handleRequest(BasicServerRef.java:473) weblogic.rmi.internal.wls.WLSExecuteRequest.run(WLSExecuteRequest.java:118) weblogic.work.ExecuteThread.execute(ExecuteThread.java:201) weblogic.work.ExecuteThread.run(ExecuteThread.java:173) Any help would be very welcome. Regards Klas

    Read the article

  • Castle ActiveRecord / NHibernate Linq Querys with ValueTypes

    - by Thomas Schreiner
    Given the following code for our Active Record Entites and ValueTypes Linq is not working for us. [ActiveRecord("Person")] public class PersonEntity : ActiveRecordLinqBase<PersonEntity> { string _name; [Property("Name", Length = 20, ColumnType = "string", Access = PropertyAccess.FieldCamelcaseUnderscore)] public Name Name { get { return NameValue.Create(_name);} set { _name = value.DataBaseValue; } } ... } public abstract class Name : IValueType { string DataBaseValue {get;set;} ... } public class Namevalue : Name { string _name; private NameValue(string name) { _name = name; } public static NameValue Create(string name) { return new NameValue(name); } ... } We tried to use linq in the following way so far with no success: var result = from PersonEntity p in PersonEntity.Queryable where p.Name == "Thomas" select p; return result.First(); // throws exception Cannot convert string into Name We tried and implemented a TypeConverter for Name, but the converter never got called. Is there a way to have linq working with this ValueTypes? Update: Using NHibernate.UserTypes.IUserType it sortof works. I Implemented the Interface as described here: http://stackoverflow.com/questions/1565056/how-to-implement-correctly-iusertype I still had to add a ConversionOperator from string to Name and had to call it Explicitly in the linq Statement, even though it was defined as implicit. var result = from PersonEntity p in PersonEntity.Queryable where p.Name == (Name)"Thomas" select p; return result.First(); //Now works

    Read the article

  • PHP/MySQL Printing Duplicate Labels

    - by Michael
    Using an addon of FPDF, I am printing labels using PHP/MySQL (http://www.fpdf.de/downloads/addons/29/). I'd like to be able to have the user select how many labels to print. For example, if the query puts out 10 records and the user wants to print 3 labels for each record, it prints them all in one set. 1,1,1,2,2,2,3,3,3...etc. Any ideas? <?php require_once('auth.php'); require_once('../config.php'); require_once('../connect.php'); require('pdf/PDF_Label.php'); $sql="SELECT $tbl_members.lastname, $tbl_members.firstname, $tbl_members.username, $tbl_items.username, $tbl_items.itemname FROM $tbl_members, $tbl_items WHERE $tbl_members.username = $tbl_items.username"; $result=mysql_query($sql); if(mysql_num_rows($result) == 0){ echo "Your search criteria does not return any results, please try again."; exit(); } $pdf = new PDF_Label("5160"); $pdf->AddPage(); // Print labels while($rows=mysql_fetch_array($result)){ $name = $rows['lastname'].', '.$rows['firstname'; $item= $rows['itemname']; $text = sprintf(" * %s *\n %s\n", $name, $item); $pdf->Add_Label($text); } $pdf->Output('labels.pdf', 'D'); ?>

    Read the article

  • MS-Access: What could cause one form with a join query to load right and another not?

    - by Daniel Straight
    Form1 Form1 is bound to Table1. Table1 has an ID field. Form2 Form2 is bound to Table2 joined to Table1 on Table2.Table1_ID=Table1.ID Here is the SQL (generated by Access): SELECT Table2.*, Table1.[FirstFieldINeed], Table1.[SecondFieldINeed], Table1.[ThirdFieldINeed] FROM Table1 INNER JOIN Table2 ON Table1.ID = Table2.[Table1_ID]; Form2 is opened with this code in Form1: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form2", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form1", acSaveYes And when loaded runs: Me.[Table1_ID] = Me.OpenArgs When Form2 is loaded, fields bound to columns from Table1 show up correctly. Form3 Form3 is bound to Table3 joined to Table2 on Table3.Table2_ID=Table2.ID Here is the SQL (generated by Access): SELECT Table3.*, Table2.[FirstFieldINeed], Table2.[SecondFieldINeed] FROM Table2 INNER JOIN Table3 ON Table2.ID = Table3.[Table2_ID]; Form3 is opened with this code in Form2: DoCmd.RunCommand acCmdSaveRecord DoCmd.OpenForm "Form3", , , , acFormAdd, , Me.[ID] DoCmd.Close acForm, "Form2", acSaveYes And when loaded runs: Me.[Table2_ID] = Me.OpenArgs When Form3 is loaded, fields bound to columns from Table2 do not show up correctly. WHY? UPDATES I tried making the join query into a separate query and using that as my record source, but it made no difference at all. If I go to the query for Form3 and view it in datasheet view, I can see that the information that should be pulled into the form is there. It just isn't showing up on the form.

    Read the article

  • Search for string allowing for one mismatches in any location of the string, Python

    - by Vincent
    I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

    Read the article

  • How to import data to SAP

    - by Mehmet AVSAR
    Hi, As a complete stranger in town of SAP, I want to transfer my own application's (mobile salesforce automation) data to SAP. My application has records of customers, stocks, inventory, invoices (and waybills), cheques, payments, collections, stock transfer data etc. I have an additional database which holds matchings of records. ie. A customer with ID 345 in my application has key 120-035-0223 in SAP. Every record, for sure, has to know it's counterpart, including parameters. After searching Google and SAP help site for a day, I covered that it's going to be a bit more pain than I expected. Especially SAP site does not give even a clue on it. Say I couldn't find. We transferred our data to some other ERP systems, some of which wanted XML files, some other exposed their APIs. My point is, is Sql Server's SSIS an option for me? I hope it is, so I can fight on my own territory. Since client requests would vary a lot, I count flexibility as most important criteria. Also, I want to transfer as much data as I could. Any help is appreciated. Regards,

    Read the article

  • Passing a LINQ DataRow Reference in a GridView's ItemTemplate

    - by Bob Kaufman
    Given the following GridView: <asp:GridView runat="server" ID="GridView1" AutoGenerateColumns="false" DataKeyNames="UniqueID" OnSelectedIndexChanging="GridView1_SelectedIndexChanging" > <Columns> <asp:BoundField HeaderText="Remarks" DataField="Remarks" /> <asp:TemplateField HeaderText="Listing"> <ItemTemplate> <%# ShowListingTitle( ( ( System.Data.DataRowView ) ( Container.DataItem ) ).Row ) %> </ItemTemplate> </asp:TemplateField> <asp:BoundField HeaderText="Amount" DataField="Amount" DataFormatString="{0:C}" /> </Columns> </asp:GridView> which refers to the following code-behind method: protected String ShowListingTitle( DataRow row ) { Listing listing = ( Listing ) row; return NicelyFormattedString( listing.field1, listing.field2, ... ); } The cast from DataRow to Listing is failing (cannot convert from DataRow to Listing) I'm certain the problem lies in what I'm passing from within the ItemTemplate, which is simply not the right reference to the current record from the LINQ to SQL data set that I've created, which looks like this: private void PopulateGrid() { using ( MyDataContext context = new MyDataContext() ) { IQueryable < Listing > listings = from l in context.Listings where l.AccountID == myAccountID select l; GridView1.DataSource = listings; GridView1.DataBind(); } }

    Read the article

  • Selenium onChange not working

    - by tohop
    Hi, I have tried a number of things to try and get Selenium to pick up an 'onchange' event from a drop down menu, none of which has worked. The offending HTML is: <select onchange="doOpperation(this.options[this.selectedIndex]); this.selectedIndex = 0;" name="opps_ondemand" id="opps_ondemand"> <option value="none" id="ondemand">Mark as...</option> <option cmd="blah1" value="add">Something</option> <option cmd="blah2" value="remove">None</option> </select> I have read that Selenium IDE doesn't record some on* events, and so it would be wise to use fireEvent(): $this->click("opps_ondemand"); $this->select("opps_ondemand", "label=Mark as..."); $this->click("//option[@value='add']"); sleep(3); $this->fireEvent("//select[@id='opps_ondemand']", "change"); However, this does not work (with or without the fireEvent). I have also tried using $this->fireEvent("locator", "click"); instead of $this->click("locator"); but this did nothing. Selenium does not complain about these locators not existing so I am assuming it can see the select/option elements fine. The problem seems to be the onChange event. Does anyone know how to resolve this? Thanks.

    Read the article

  • Add Zend_Navigation to the View with old legacy bootstrap

    - by Grant Collins
    Hi, I've been struggling with Zend_Navigation all weekend, and now I have another problem, which I believe has been the cause of a lot of my issues. I am trying to add Zend_Navigation to a legacy 1.7.6 Zend Framework application, i've updated the Zend Library to 1.9.0 and updated the bootstrap to allow this library update. The problem is that I don't know how, and the examples show the new bootstrap method of how to add the Navigation object to the view, I've tried this: //initialise the application layouts with the MVC helpers $layout = Zend_Layout::startMvc(array('layoutPath' => '../application/layouts')); $view = $layout->getView(); $configNav = new Zend_Config_Xml('../application/config/navigation.xml', 'navigation'); $navigation = new Zend_Navigation($configNav); $view->navigation($navigation); $viewRenderer = new Zend_Controller_Action_Helper_ViewRenderer(); $viewRenderer->setView($view); This seems to run through fine, but when I go to use the breadcrumb view helper in my layout, it errors with: Strict Standards: Creating default object from empty value in C:\www\moobia\development\website\application\modules\employers\controllers\IndexController.php on line 27 This is caused by the following code in the init() function of my controller. $uri = $this->_request->getPathInfo(); $activeNav = $this->view->navigation()->findByUri($uri); <- this is null when called $activeNav->active = true; I believe it's because the Zend_Navigation object is not in the view. I would look at migrating the bootstrap to the current method, but at present I am running out of time for a release. Thanks, Grant

    Read the article

  • When I add a database table to a DBML file via LINQ to SQL, I get a slew of compiler errors.

    - by Zian Choy
    Whenever I add a certain table to a DBML file via LINQ to SQL, I get 102 errors in my VB NET project. Some of the errors: Error 1 Attribute 'TableAttribute' cannot be applied multiple times. C:\Documents and Settings\zchoy\My Documents\Virtual EMS Deployment\Life And Death\Life And Death\ShearwaterEMS.designer.vb 74 2 EMS Reality Check Error 2 'emptyChangingEventArgs' is already declared as 'Private Shared emptyChangingEventArgs As System.ComponentModel.PropertyChangingEventArgs' in this class. C:\Documents and Settings\zchoy\My Documents\Virtual EMS Deployment\Life And Death\Life And Death\ShearwaterEMS.designer.vb 78 17 EMS Reality Check Error 3 '_GroupID' is already declared as 'Private _GroupID As Integer' in this class. C:\Documents and Settings\zchoy\My Documents\Virtual EMS Deployment\Life And Death\Life And Death\ShearwaterEMS.designer.vb 80 10 EMS Reality Check Error 4 '_ID' is already declared as 'Private _ID As Integer' in this class. C:\Documents and Settings\zchoy\My Documents\Virtual EMS Deployment\Life And Death\Life And Death\ShearwaterEMS.designer.vb 82 10 EMS Reality Check Any suggestions for getting the table to work with LINQ to SQL will be welcomed. The table's properties: Group ID ID (Primary Key) Contact Title UseGroupAddress InternationalFormat Address1 Address2 City State ZipCode Country Phone Fax EMailAddress Notes DateAdded AddedBy DateChanged ChangedBy Active ExternalReference ChangeCounter PhoneLabel FaxLabel

    Read the article

  • IIS6 configuration for WCF/Silverlight

    - by Grayson Mitchell
    I am trying the simple senario of running a WCF service to return Active directory information on a user. (http://rouslan.com/2009/03/20-steps-to-get-together-windows-authentication-silverlight-and-wcf-service/) using Silverlight 4 & .net 4 However, I am being driven insane by trying to set this up in IIS. Currently I have my solution working in VS, but when I try to run the service in ISS a debug window tries to open... (and I can't get rid of it, is is complaining about the WCF call). <basicHttpBinding> <binding name="winAuthBasicHttpBinding"> <security mode="TransportCredentialOnly"> <transport clientCredentialType="Ntlm"/> </security> </binding> </basicHttpBinding> The Insanity: I have got the IIS to successfully call a WCF service (but can't reproduce), I have created 5 projects to try and get this working, but in my 5th I can't even browse the site (says it can't download silverlight application, but mime type are setup). My next step is to install Server2008 on a test machine and try IIS7... as all the various walkthrough's I have found just dont seem to work in IIS6.

    Read the article

  • SharePoint 2007 and SiteMinder

    - by pborovik
    Here is a question regarding some details how SiteMinder secures access to the SharePoint 2007. I've read a bunch of materials regarding this and have some picture for SharePoint 2010 FBA claims-based + SiteMinder security (can be wrong here, of course): SiteMinder is registered as a trusted identity provider for the SharePoint; It means (to my mind) that SharePoint has no need to go into all those user directories like AD, RDBMS or whatever to create a record for user being granted access to SharePoint - instead it consumes a claims-based id supplied by SiteMinder SiteMinder checks all requests to SharePoint resources and starts login sequence via SiteMinder if does not find required headers in the request (SMSESSION, etc.) SiteMinder creates a GenericIdentity with the user login name if headers are OK, so SharePoint recognizes the user as authenticated But in the case of SharePoint 2007 with FBA + SiteMinder, I cannot find an answer for questions like: Does SharePoint need to go to all those user directories like AD to know something about users (as SiteMinder is not in charge of providing user info like claims-based ids)? So, SharePoint admin should configure SharePoint FBA to talk to these sources? Let's say I'm talking to a Web Service of SharePoint protected by SiteMinder. Shall I make a Authentication.asmx-Login call to create a authentication ticket or this schema is somehow changed by the SiteMinder? If such call is needed, do I also need a SiteMinder authentication sequence? What prevents me from rewriting request headers (say, manually in Fiddler) before posting request to the SharePoint protected by SiteMinder to override its defence? Pity, but I do not have access to deployed SiteMinder + SharePoint, so need to investigate some question blindly. Thanks.

    Read the article

  • symfony get data from array

    - by iggnition
    Hi, I'm trying to use an SQL query to get data from my database into the template of a symfony project. my query: SQL: SELECT l.loc_id AS l__loc_id, l.naam AS l__naam, l.straat AS l__straat, l.huisnummer AS l__huisnummer, l.plaats AS l__plaats, l.postcode AS l__postcode, l.telefoon AS l__telefoon, l.opmerking AS l__opmerking, o.org_id AS o__org_id, o.naam AS o__naam FROM locatie l LEFT JOIN organisatie o ON l.org_id = o.org_id This is generated by this DQL: DQL: $this->q = Doctrine_Query::create() ->select('l.naam, o.naam, l.straat, l.huisnummer, l.plaats, l.postcode, l.telefoon, l.opmerking') ->from('Locatie l') ->leftJoin('l.Organisatie o') ->execute(); But now when i try to acces this data in the template by either doing: <?php foreach ($q as $locatie): ?> <?php echo $locatie['o.naam'] ?> or <?php foreach ($q as $locatie): ?> <?php echo $locatie['o__naam'] ?> i get the error from symfony: 500 | Internal Server Error | Doctrine_Record_UnknownPropertyException Unknown record property / related component "o__naam" on "Locatie" Does anyone know what is going wrong here? i dont know how to call the value from the array if the names in both query's dont work.

    Read the article

< Previous Page | 434 435 436 437 438 439 440 441 442 443 444 445  | Next Page >