Search Results

Search found 7605 results on 305 pages for 'newbie 25'.

Page 44/305 | < Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >

• Upload Certificate and Key to RUEI in order to decrypt SSL traffic

  - by stefan.thieme(at)oracle.com

  So you want to monitor encrypted traffic with your RUEI collector ?Actually this is an easy thing if you follow the lines below...I will start out with creating a pair of snakeoil (so called self-signed) certificate and key with the make-ssl-cert tool which comes pre-packaged with apache only for the purpose of this example.$ sudo make-ssl-cert generate-default-snakeoil$ sudo ls -l /etc/ssl/certs/ssl-cert-snakeoil.pem /etc/ssl/private/ssl-cert-snakeoil.key-rw-r--r-- 1 root root     615 2010-06-07 10:03 /etc/ssl/certs/ssl-cert-snakeoil.pem-rw-r----- 1 root ssl-cert 891 2010-06-07 10:03 /etc/ssl/private/ssl-cert-snakeoil.keyRUEI Configuration of Security SSL Keys You will most likely get these two files from your Certificate Authority (CA) and/or your system administrators should be able to extract this from your WebServer or LoadBalancer handling SSL encryption for your infrastructure.Now let's look at the content of these two files, the certificate (apache assumes this is in PEM format) is called a public key and the private key is used by the apache server to encrypt traffic for a client using the certificate to initiate the SSL connection with the server.In case you already know that these two match, you simply have to paste them in one text file and upload this text file to your RUEI instance.$ sudo cat /etc/ssl/certs/ssl-cert-snakeoil.pem /etc/ssl/private/ssl-cert-snakeoil.key > /tmp/ruei.cert_and_key$ sudo cat /tmp/ruei.cert_and_key -----BEGIN CERTIFICATE----- MIIBmTCCAQICCQD7O3XXwVilWzANBgkqhkiG9w0BAQUFADARMQ8wDQYDVQQDEwZ1 YnVudHUwHhcNMTAwNjA3MDgwMzUzWhcNMjAwNjA0MDgwMzUzWjARMQ8wDQYDVQQD EwZ1YnVudHUwgZ8wDQYJKoZIhvcNAQEBBQADgY0AMIGJAoGBALbs+JnI+p+K7Iqa SQZdnYBxOpdRH0/9jt1QKvmH68v81h9+f1Z2rVR7Zrd/l+ruE3H9VvuzxMlKuMH7 qBX/gmjDZTlj9WJM+zc0tSk+e2udy9he20lGzTxv0vaykJkuKcvSWNk4WE9NuAdg IHZvjKgoTSVmvM1ApMCg69nyOy97AgMBAAEwDQYJKoZIhvcNAQEFBQADgYEAk2rv VEkxR1qPSpJiudDuGUHtWKBKWiWbmSwI3REZT+0vG+YDG5a55NdxgRk3zhQntqF7 gNYjKxblBByBpY7W0ci00kf7kFgvXWMeU96NSQJdnid/YxzQYn0dGL2rSh1dwdPN NPQlNSfnEQ1yxFevR7aRdCqTbTXU3mxi8YaSscE= -----END CERTIFICATE----- -----BEGIN RSA PRIVATE KEY----- MIICXgIBAAKBgQC27PiZyPqfiuyKmkkGXZ2AcTqXUR9P/Y7dUCr5h+vL/NYffn9W dq1Ue2a3f5fq7hNx/Vb7s8TJSrjB+6gV/4Jow2U5Y/ViTPs3NLUpPntrncvYXttJ Rs08b9L2spCZLinL0ljZOFhPTbgHYCB2b4yoKE0lZrzNQKTAoOvZ8jsvewIDAQAB AoGBAJ7LCWeeUwnKNFqBYmD3RTFpmX4furnal3lBDX0945BZtJr0WZ/6N679zIYA aiVTdGfgjvDC9lHy3n3uctRd0Jqdh2QoSSxNBhq5elIApNIIYzu7w/XI/VhGcDlA b6uadURQEC2q+M8YYjw3mwR2omhCWlHIViOHe/9T8jfP/8pxAkEA7k39WRcQildH DFKcj7gurqlkElHysacMTFWf0ZDTEUS6bdkmNXwK6mH63BlmGLrYAP5AMgKgeDf8 D+WRfv8YKQJBAMSCQ7UGDN3ysyfIIrdc1RBEAk4BOrKHKtD5Ux0z5lcQkaCYrK8J DuSldreN2yOhS99/S4CRWmGkTj04wRSnjwMCQQCaR5mW3QzTU4/m1XEQxsBKSdZE 2hMSmsCmhuSyK13Kl0FPLr/C7qyuc4KSjksABa8kbXaoKfUz/6LLs+ePXZ2JAkAv +mIPk5+WnQgS4XFgdYDrzL8HTpOHPSs+BHG/goltnnT/0ebvgXWqa5+1pyPm6h29 PrYveM2pY1Va6z1xDowDAkEAttfzAwAHz+FUhWQCmOBpvBuW/KhYWKZTMpvxFMSY YD5PH6NNyLfBx0J4nGPN5n/f6il0s9pzt3ko++/eUtWSnQ== -----END RSA PRIVATE KEY----- Simply click on the add new key and browse for the cert_and_key file on your desktop which you concatenated earlier using any text editor. You may need to add a passphrase in order to decrypt the RSA key in some cases (it should tell you BEGIN ENCRYPTED PRIVATE KEY in the header line). I will show you the success screen after uploading the certificate to RUEI. You may want to restart your collector once you have uploaded all the certificate/key pairs you want to use in order to make sure they get picked up asap.You should be able to see the number of SSL Connections rising in the Collector statistics screen below. The figures for decrypt errors should slowly go down and the usage figures for your encryption algortihm on the subsequent SSL Encryption screen should go up. You should be 100% sure everything works fine by now, otherwise see below to distinguish the remaining 1% from your 99% certainty.Verify Certificate and Key are matchingYou can compare the modulus of private key and public certificate and they should match in order for the key to fit the lock. You only want to make sure they both fit each other.We are actually interested only in the following details of the two files, which can be determined by using the -subject, -dates and -modulus command line switches instead of the complete -text output of the x509 certificate/rsa key contents.$ sudo openssl x509 -noout -subject -in /etc/ssl/certs/ssl-cert-snakeoil.pemsubject= /CN=ubuntu$ sudo openssl x509 -noout -dates -in /etc/ssl/certs/ssl-cert-snakeoil.pemnotBefore=Jun  7 08:03:53 2010 GMTnotAfter=Jun  4 08:03:53 2020 GMT$ sudo openssl x509 -noout -modulus -in /etc/ssl/certs/ssl-cert-snakeoil.pem Modulus=B6ECF899C8FA9F8AEC8A9A49065D9D80713A97511F4FFD8EDD502AF987EBCBFCD61F7E7F5676AD547B66B77F97EAEE1371FD56FBB3C4C94AB8C1FBA815FF8268C3653963F5624CFB3734B5293E7B6B9DCBD85EDB4946CD3C6FD2F6B290992E29CBD258D938584F4DB8076020766F8CA8284D2566BCCD40A4C0A0EBD9F23B2F7B $ sudo openssl rsa -noout -modulus -in /etc/ssl/private/ssl-cert-snakeoil.keyModulus=B6ECF899C8FA9F8AEC8A9A49065D9D80713A97511F4FFD8EDD502AF987EBCBFCD61F7E7F5676AD547B66B77F97EAEE1371FD56FBB3C4C94AB8C1FBA815FF8268C3653963F5624CFB3734B5293E7B6B9DCBD85EDB4946CD3C6FD2F6B290992E29CBD258D938584F4DB8076020766F8CA8284D2566BCCD40A4C0A0EBD9F23B2F7BAs you can see the modulus matches exactly and we have the proof that the certificate has been created using the private key. OpenSSL Certificate and Key DetailsAs I already told you, you do not need all the greedy details, but in case you want to know it in depth what is actually in those hex-blocks can be made visible with the following commands which show you the actual content in a human readable format.Note: You may not want to post all the details of your private key =^) I told you I have been using a self-signed certificate only for showing you these details.$ sudo openssl rsa -noout -text -in /etc/ssl/private/ssl-cert-snakeoil.keyPrivate-Key: (1024 bit)modulus:    00:b6:ec:f8:99:c8:fa:9f:8a:ec:8a:9a:49:06:5d:    9d:80:71:3a:97:51:1f:4f:fd:8e:dd:50:2a:f9:87:    eb:cb:fc:d6:1f:7e:7f:56:76:ad:54:7b:66:b7:7f:    97:ea:ee:13:71:fd:56:fb:b3:c4:c9:4a:b8:c1:fb:    a8:15:ff:82:68:c3:65:39:63:f5:62:4c:fb:37:34:    b5:29:3e:7b:6b:9d:cb:d8:5e:db:49:46:cd:3c:6f:    d2:f6:b2:90:99:2e:29:cb:d2:58:d9:38:58:4f:4d:    b8:07:60:20:76:6f:8c:a8:28:4d:25:66:bc:cd:40:    a4:c0:a0:eb:d9:f2:3b:2f:7bpublicExponent: 65537 (0x10001)privateExponent:    00:9e:cb:09:67:9e:53:09:ca:34:5a:81:62:60:f7:    45:31:69:99:7e:1f:ba:b9:da:97:79:41:0d:7d:3d:    e3:90:59:b4:9a:f4:59:9f:fa:37:ae:fd:cc:86:00:    6a:25:53:74:67:e0:8e:f0:c2:f6:51:f2:de:7d:ee:    72:d4:5d:d0:9a:9d:87:64:28:49:2c:4d:06:1a:b9:    7a:52:00:a4:d2:08:63:3b:bb:c3:f5:c8:fd:58:46:    70:39:40:6f:ab:9a:75:44:50:10:2d:aa:f8:cf:18:    62:3c:37:9b:04:76:a2:68:42:5a:51:c8:56:23:87:    7b:ff:53:f2:37:cf:ff:ca:71prime1:    00:ee:4d:fd:59:17:10:8a:57:47:0c:52:9c:8f:b8:    2e:ae:a9:64:12:51:f2:b1:a7:0c:4c:55:9f:d1:90:    d3:11:44:ba:6d:d9:26:35:7c:0a:ea:61:fa:dc:19:    66:18:ba:d8:00:fe:40:32:02:a0:78:37:fc:0f:e5:    91:7e:ff:18:29prime2:    00:c4:82:43:b5:06:0c:dd:f2:b3:27:c8:22:b7:5c:    d5:10:44:02:4e:01:3a:b2:87:2a:d0:f9:53:1d:33:    e6:57:10:91:a0:98:ac:af:09:0e:e4:a5:76:b7:8d:    db:23:a1:4b:df:7f:4b:80:91:5a:61:a4:4e:3d:38:    c1:14:a7:8f:03exponent1:    00:9a:47:99:96:dd:0c:d3:53:8f:e6:d5:71:10:c6:    c0:4a:49:d6:44:da:13:12:9a:c0:a6:86:e4:b2:2b:    5d:ca:97:41:4f:2e:bf:c2:ee:ac:ae:73:82:92:8e:    4b:00:05:af:24:6d:76:a8:29:f5:33:ff:a2:cb:b3:    e7:8f:5d:9d:89exponent2:    2f:fa:62:0f:93:9f:96:9d:08:12:e1:71:60:75:80:    eb:cc:bf:07:4e:93:87:3d:2b:3e:04:71:bf:82:89:    6d:9e:74:ff:d1:e6:ef:81:75:aa:6b:9f:b5:a7:23:    e6:ea:1d:bd:3e:b6:2f:78:cd:a9:63:55:5a:eb:3d:    71:0e:8c:03coefficient:    00:b6:d7:f3:03:00:07:cf:e1:54:85:64:02:98:e0:    69:bc:1b:96:fc:a8:58:58:a6:53:32:9b:f1:14:c4:    98:60:3e:4f:1f:a3:4d:c8:b7:c1:c7:42:78:9c:63:    cd:e6:7f:df:ea:29:74:b3:da:73:b7:79:28:fb:ef:    de:52:d5:92:9d$ sudo openssl x509 -noout -text -in /etc/ssl/certs/ssl-cert-snakeoil.pemCertificate:    Data:        Version: 1 (0x0)        Serial Number:            fb:3b:75:d7:c1:58:a5:5b        Signature Algorithm: sha1WithRSAEncryption        Issuer: CN=ubuntu        Validity            Not Before: Jun  7 08:03:53 2010 GMT            Not After : Jun  4 08:03:53 2020 GMT        Subject: CN=ubuntu        Subject Public Key Info:            Public Key Algorithm: rsaEncryption            RSA Public Key: (1024 bit)                Modulus (1024 bit):                    00:b6:ec:f8:99:c8:fa:9f:8a:ec:8a:9a:49:06:5d:                    9d:80:71:3a:97:51:1f:4f:fd:8e:dd:50:2a:f9:87:                    eb:cb:fc:d6:1f:7e:7f:56:76:ad:54:7b:66:b7:7f:                    97:ea:ee:13:71:fd:56:fb:b3:c4:c9:4a:b8:c1:fb:                    a8:15:ff:82:68:c3:65:39:63:f5:62:4c:fb:37:34:                    b5:29:3e:7b:6b:9d:cb:d8:5e:db:49:46:cd:3c:6f:                    d2:f6:b2:90:99:2e:29:cb:d2:58:d9:38:58:4f:4d:                    b8:07:60:20:76:6f:8c:a8:28:4d:25:66:bc:cd:40:                    a4:c0:a0:eb:d9:f2:3b:2f:7b                Exponent: 65537 (0x10001)    Signature Algorithm: sha1WithRSAEncryption        93:6a:ef:54:49:31:47:5a:8f:4a:92:62:b9:d0:ee:19:41:ed:        58:a0:4a:5a:25:9b:99:2c:08:dd:11:19:4f:ed:2f:1b:e6:03:        1b:96:b9:e4:d7:71:81:19:37:ce:14:27:b6:a1:7b:80:d6:23:        2b:16:e5:04:1c:81:a5:8e:d6:d1:c8:b4:d2:47:fb:90:58:2f:        5d:63:1e:53:de:8d:49:02:5d:9e:27:7f:63:1c:d0:62:7d:1d:        18:bd:ab:4a:1d:5d:c1:d3:cd:34:f4:25:35:27:e7:11:0d:72:        c4:57:af:47:b6:91:74:2a:93:6d:35:d4:de:6c:62:f1:86:92:        b1:c1The above output can also be seen if you direct your browser client to your website and check the certificate sent by the server to your browser. You will be able to lookup all the details including the validity dates, subject common name and the public key modulus.Capture an SSL connection using WiresharkAnd as you would have expected, looking at the low-level tcp data that has been exchanged between the client and server with a tcp-diagnostics tool (i.e. wireshark/tcpdump) you can also see the modulus in there.These were the settings I used to capture all traffic on the local loopback interface, matching the filter expression: tcp and ip and host 127.0.0.1 and port 443. This tells Wireshark to leave out any other information, I may not have been interested in showing you.

  Read the article

• VMware Player 4.04 on Ubuntu 12.04 will not compile

  - by stephen mew

  I installed VMware-Player-4.0.4-744019.i386.bundle onto Ubuntu 11.10. This worked fine. I then upgraded to Ubuntu 12.04 The upgrade appeared to be successful. I then tried to start VMware Player and I got a popup "VMware Kernel Module Updater" I accept the process (click Install) The updater process runs, the output of which is; Stopping VMWare Services [green tick] Virtual Machine Monitor [RED exclamation mark] Virtual Network Device [green tick] VMware Blocking Filesystem [green tick] Virtual Machine Communication Interface [green tick] VMCI Sockets Error popup; Unable to start services See log file /tmp/vmware-root/modconfig-11912.log" Looking in the log file It seems that these are the complaints. 2012-07-11T15:35:19.829Z| vthread-3| I120: Failed to find /lib/modules/preferred/build/include/linux/version.h 2012-07-11T15:35:19.829Z| vthread-3| I120: Failed version test: /lib/modules/preferred/build/include/linux/version.h 2012-07-11T15:35:49.683Z| vthread-3| I120: Failed to compile module vmnet! I tried the patch for 4.0.3 and it did not work. Can anyone point me in the right direction here ? log file; 2012-07-11T15:35:18.618Z| vthread-3| I120: Log for VMware Workstation pid=11912 version=8.0.4 build=build-744019 option=Release 2012-07-11T15:35:18.618Z| vthread-3| I120: The process is 32-bit. 2012-07-11T15:35:18.618Z| vthread-3| I120: Host codepage=UTF-8 encoding=UTF-8 2012-07-11T15:35:18.618Z| vthread-3| I120: Host is Linux 3.2.0-26-generic Ubuntu 12.04 LTS 2012-07-11T15:35:18.616Z| vthread-3| I120: Msg_Reset: 2012-07-11T15:35:18.616Z| vthread-3| I120: [msg.dictionary.load.openFailed] Cannot open file "/usr/lib/vmware/settings": No such file or directory. 2012-07-11T15:35:18.616Z| vthread-3| I120: ---------------------------------------- 2012-07-11T15:35:18.616Z| vthread-3| I120: PREF Optional preferences file not found at /usr/lib/vmware/settings. Using default values. 2012-07-11T15:35:18.617Z| vthread-3| I120: Msg_Reset: 2012-07-11T15:35:18.617Z| vthread-3| I120: [msg.dictionary.load.openFailed] Cannot open file "/root/.vmware/config": No such file or directory. 2012-07-11T15:35:18.617Z| vthread-3| I120: ---------------------------------------- 2012-07-11T15:35:18.617Z| vthread-3| I120: PREF Optional preferences file not found at /root/.vmware/config. Using default values. 2012-07-11T15:35:18.617Z| vthread-3| I120: Msg_Reset: 2012-07-11T15:35:18.617Z| vthread-3| I120: [msg.dictionary.load.openFailed] Cannot open file "/root/.vmware/preferences": No such file or directory. 2012-07-11T15:35:18.617Z| vthread-3| I120: ---------------------------------------- 2012-07-11T15:35:18.617Z| vthread-3| I120: PREF Failed to load user preferences. 2012-07-11T15:35:18.618Z| vthread-3| W110: Logging to /tmp/vmware-root/modconfig-11912.log 2012-07-11T15:35:19.054Z| vthread-3| I120: modconf query interface initialized 2012-07-11T15:35:19.056Z| vthread-3| I120: modconf library initialized 2012-07-11T15:35:19.158Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.168Z| vthread-3| I120: Validating path /lib/modules/preferred/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.168Z| vthread-3| I120: Failed to find /lib/modules/preferred/build/include/linux/version.h 2012-07-11T15:35:19.168Z| vthread-3| I120: Failed version test: /lib/modules/preferred/build/include/linux/version.h not found. 2012-07-11T15:35:19.168Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.175Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.201Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.291Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:19.292Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.296Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.326Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.417Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:19.480Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.489Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.498Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.507Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.517Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.566Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.575Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.584Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.593Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.602Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.606Z| vthread-3| I120: Validating path /lib/modules/preferred/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.606Z| vthread-3| I120: Failed to find /lib/modules/preferred/build/include/linux/version.h 2012-07-11T15:35:19.606Z| vthread-3| I120: Failed version test: /lib/modules/preferred/build/include/linux/version.h not found. 2012-07-11T15:35:19.606Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.611Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.635Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.741Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:19.787Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.796Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.805Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.814Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.824Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:19.829Z| vthread-3| I120: Validating path /lib/modules/preferred/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.829Z| vthread-3| I120: Failed to find /lib/modules/preferred/build/include/linux/version.h 2012-07-11T15:35:19.829Z| vthread-3| I120: Failed version test: /lib/modules/preferred/build/include/linux/version.h not found. 2012-07-11T15:35:19.829Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:19.834Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.857Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:19.945Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:25.503Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:25.514Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:25.523Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:25.533Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:25.542Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:26.338Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:26.338Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:26.343Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:26.368Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:26.455Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:26.455Z| vthread-3| I120: Building module vmmon. 2012-07-11T15:35:26.455Z| vthread-3| I120: Extracting the sources of the vmmon module. 2012-07-11T15:35:26.484Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vmmon-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:35:35.469Z| vthread-3| I120: Installing module vmmon from /tmp/vmware-root/modules/vmmon.o to /lib/modules/3.2.0-26-generic/misc. 2012-07-11T15:35:35.470Z| vthread-3| I120: Registering file: /usr/lib/vmware-installer/2.0/vmware-installer --register-file vmware-vmx regular /lib/modules/3.2.0-26-generic/misc/vmmon.ko 2012-07-11T15:35:39.713Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:39.713Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:39.719Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:39.753Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:39.845Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:39.845Z| vthread-3| I120: Building module vmnet. 2012-07-11T15:35:39.846Z| vthread-3| I120: Extracting the sources of the vmnet module. 2012-07-11T15:35:39.913Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vmnet-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:35:49.683Z| vthread-3| I120: Failed to compile module vmnet! 2012-07-11T15:35:49.704Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:35:49.705Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:35:49.729Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:49.874Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:35:49.961Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:35:49.961Z| vthread-3| I120: Building module vmblock. 2012-07-11T15:35:49.961Z| vthread-3| I120: Extracting the sources of the vmblock module. 2012-07-11T15:35:50.159Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vmblock-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:35:59.283Z| vthread-3| I120: Installing module vmblock from /tmp/vmware-root/modules/vmblock.o to /lib/modules/3.2.0-26-generic/misc. 2012-07-11T15:35:59.284Z| vthread-3| I120: Registering file: /usr/lib/vmware-installer/2.0/vmware-installer --register-file vmware-vmx regular /lib/modules/3.2.0-26-generic/misc/vmblock.ko 2012-07-11T15:36:04.318Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:36:04.319Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:36:04.324Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:36:04.344Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:36:04.427Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:36:04.427Z| vthread-3| I120: Building module vmci. 2012-07-11T15:36:04.428Z| vthread-3| I120: Extracting the sources of the vmci module. 2012-07-11T15:36:04.456Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vmci-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:36:15.728Z| vthread-3| I120: Installing module vmci from /tmp/vmware-root/modules/vmci.o to /lib/modules/3.2.0-26-generic/misc. 2012-07-11T15:36:15.730Z| vthread-3| I120: Registering file: /usr/lib/vmware-installer/2.0/vmware-installer --register-file vmware-vmx regular /lib/modules/3.2.0-26-generic/misc/vmci.ko 2012-07-11T15:36:20.349Z| vthread-3| I120: Trying to find a suitable PBM set for kernel 3.2.0-26-generic. 2012-07-11T15:36:20.350Z| vthread-3| I120: Validating path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic 2012-07-11T15:36:20.355Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:36:20.378Z| vthread-3| I120: Your GCC version: 4.6 2012-07-11T15:36:20.464Z| vthread-3| I120: Header path /lib/modules/3.2.0-26-generic/build/include for kernel release 3.2.0-26-generic is valid. 2012-07-11T15:36:20.464Z| vthread-3| I120: Building module vmci. 2012-07-11T15:36:20.464Z| vthread-3| I120: Extracting the sources of the vmci module. 2012-07-11T15:36:20.514Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vmci-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:36:22.732Z| vthread-3| I120: Building module vsock. 2012-07-11T15:36:22.732Z| vthread-3| I120: Extracting the sources of the vsock module. 2012-07-11T15:36:22.783Z| vthread-3| I120: Building module with command: /usr/bin/make -j -C /tmp/vmware-root/modules/vsock-only auto-build SUPPORT_SMP=1 HEADER_DIR=/lib/modules/3.2.0-26-generic/build/include CC=/usr/bin/gcc GREP=/usr/bin/make IS_GCC_3=no VMCCVER=4.6 2012-07-11T15:36:33.825Z| vthread-3| I120: Installing module vsock from /tmp/vmware-root/modules/vsock.o to /lib/modules/3.2.0-26-generic/misc. 2012-07-11T15:36:33.826Z| vthread-3| I120: Registering file: /usr/lib/vmware-installer/2.0/vmware-installer --register-file vmware-vmx regular /lib/modules/3.2.0-26-generic/misc/vsock.ko

  Read the article

• Server 2012 DFS New Member Issue

  - by David

  I am trying to add a new member to our DFS topology. We have 3 DCs (VMs - VMware) running Windows server 2012, two servers are located in or Primary site and the third at our DR site. Currently the two servers at our primary site are currently replicating DFS (full mesh) and are working fine. I have tried several times to add the third DC to our DFS topology, every time i configure the replication path e.g E:\MSI and click ok the MMC snap in crashes. Below is the crash info, any idea what is causing this? What i am doing is fairly straight forward and don't see why this would be happening. Windows Crash Error: gnature: Problem Event Name: CLR20r3 Problem Signature 01: mmc.exe Problem Signature 02: 6.2.9200.16496 Problem Signature 03: 50ece2e8 Problem Signature 04: System.Windows.Forms Problem Signature 05: 4.0.30319.18046 Problem Signature 06: 51552cda Problem Signature 07: 6291 Problem Signature 08: 25 Problem Signature 09: RML5K4UDBMA5NI04CIYRWVDHKEWFDHCV OS Version: 6.2.9200.2.0.0.272.7 Locale ID: 3081 Additional Information 1: b979 Additional Information 2: b97911c958b3d076b53a1d80c1c56088 Additional Information 3: 4fee Additional Information 4: 4fee5b9baabd694859b15dfc5e1863b7      Crash Report Version=1 EventType=CLR20r3 EventTime=130165974300817209 ReportType=2 Consent=1 ReportIdentifier=d15d0d38-dd36-11e2-93fb-005056af764c IntegratorReportIdentifier=d15d0d37-dd36-11e2-93fb-005056af764c NsAppName=mmc.exe Response.type=4 Sig[0].Name=Problem Signature 01 Sig[0].Value=mmc.exe Sig[1].Name=Problem Signature 02 Sig[1].Value=6.2.9200.16496 Sig[2].Name=Problem Signature 03 Sig[2].Value=50ece2e8 Sig[3].Name=Problem Signature 04 Sig[3].Value=System.Windows.Forms Sig[4].Name=Problem Signature 05 Sig[4].Value=4.0.30319.18046 Sig[5].Name=Problem Signature 06 Sig[5].Value=51552cda Sig[6].Name=Problem Signature 07 Sig[6].Value=6291 Sig[7].Name=Problem Signature 08 Sig[7].Value=25 Sig[8].Name=Problem Signature 09 Sig[8].Value=RML5K4UDBMA5NI04CIYRWVDHKEWFDHCV DynamicSig[1].Name=OS Version DynamicSig[1].Value=6.2.9200.2.0.0.272.7 DynamicSig[2].Name=Locale ID DynamicSig[2].Value=3081 DynamicSig[22].Name=Additional Information 1 DynamicSig[22].Value=b979 DynamicSig[23].Name=Additional Information 2 DynamicSig[23].Value=b97911c958b3d076b53a1d80c1c56088 DynamicSig[24].Name=Additional Information 3 DynamicSig[24].Value=4fee DynamicSig[25].Name=Additional Information 4 DynamicSig[25].Value=4fee5b9baabd694859b15dfc5e1863b7 UI[2]=C:\Windows\system32\mmc.exe UI[3]=Microsoft Management Console has stopped working UI[4]=Windows can check online for a solution to the problem. UI[5]=Check online for a solution and close the program UI[6]=Check online for a solution later and close the program UI[7]=Close the program LoadedModule[0]=C:\Windows\system32\mmc.exe LoadedModule[1]=C:\Windows\SYSTEM32\ntdll.dll LoadedModule[2]=C:\Windows\system32\KERNEL32.DLL LoadedModule[3]=C:\Windows\system32\KERNELBASE.dll LoadedModule[4]=C:\Windows\system32\GDI32.dll LoadedModule[5]=C:\Windows\system32\USER32.dll LoadedModule[6]=C:\Windows\system32\MFC42u.dll LoadedModule[7]=C:\Windows\system32\msvcrt.dll LoadedModule[8]=C:\Windows\system32\mmcbase.DLL LoadedModule[9]=C:\Windows\system32\ole32.dll LoadedModule[10]=C:\Windows\system32\SHLWAPI.dll LoadedModule[11]=C:\Windows\system32\UxTheme.dll LoadedModule[12]=C:\Windows\system32\DUser.dll LoadedModule[13]=C:\Windows\system32\OLEAUT32.dll LoadedModule[14]=C:\Windows\system32\ODBC32.dll LoadedModule[15]=C:\Windows\SYSTEM32\combase.dll LoadedModule[16]=C:\Windows\system32\RPCRT4.dll LoadedModule[17]=C:\Windows\SYSTEM32\sechost.dll LoadedModule[18]=C:\Windows\system32\ADVAPI32.dll LoadedModule[19]=C:\Windows\system32\SHCORE.DLL LoadedModule[20]=C:\Windows\system32\IMM32.DLL LoadedModule[21]=C:\Windows\system32\MSCTF.dll LoadedModule[22]=C:\Windows\system32\DUI70.dll LoadedModule[23]=C:\Windows\WinSxS\amd64_microsoft.windows.common-controls_6595b64144ccf1df_6.0.9200.16579_none_418ab7ef718b27ef\Comctl32.dll LoadedModule[24]=C:\Windows\system32\SHELL32.dll LoadedModule[25]=C:\Windows\system32\CRYPTBASE.dll LoadedModule[26]=C:\Windows\system32\bcryptPrimitives.dll LoadedModule[27]=C:\Windows\system32\urlmon.dll LoadedModule[28]=C:\Windows\system32\iertutil.dll LoadedModule[29]=C:\Windows\system32\WININET.dll LoadedModule[30]=C:\Windows\SYSTEM32\clbcatq.dll LoadedModule[31]=C:\Windows\system32\mmcndmgr.dll LoadedModule[32]=C:\Windows\System32\msxml6.dll LoadedModule[33]=C:\Windows\system32\profapi.dll LoadedModule[34]=C:\Windows\system32\apphelp.dll LoadedModule[35]=C:\Windows\system32\dwmapi.dll LoadedModule[36]=C:\Windows\System32\oleacc.dll LoadedModule[37]=C:\Windows\system32\CRYPTSP.dll LoadedModule[38]=C:\Windows\system32\rsaenh.dll LoadedModule[39]=C:\Windows\system32\NetworkExplorer.dll LoadedModule[40]=C:\Windows\system32\PROPSYS.dll LoadedModule[41]=C:\Windows\system32\SETUPAPI.dll LoadedModule[42]=C:\Windows\system32\CFGMGR32.dll LoadedModule[43]=C:\Windows\system32\DEVOBJ.dll LoadedModule[44]=C:\Windows\system32\mlang.dll LoadedModule[45]=C:\Windows\system32\xmllite.dll LoadedModule[46]=C:\Windows\system32\VERSION.dll LoadedModule[47]=C:\Windows\SYSTEM32\mscoree.dll LoadedModule[48]=C:\Windows\Microsoft.NET\Framework64\v4.0.30319\mscoreei.dll LoadedModule[49]=C:\Windows\Microsoft.NET\Framework64\v4.0.30319\clr.dll LoadedModule[50]=C:\Windows\SYSTEM32\MSVCR110_CLR0400.dll LoadedModule[51]=C:\Windows\assembly\NativeImages_v4.0.30319_64\mscorlib\fa44d07a6b592198dfeae841489f295b\mscorlib.ni.dll LoadedModule[52]=C:\Windows\system32\sxs.dll LoadedModule[53]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System\577825eedb03a45fd7327050e85d0c44\System.ni.dll LoadedModule[54]=C:\Windows\assembly\NativeImages_v4.0.30319_64\MMCEx\9b714b187bfb304526df6d4e6160e15c\MMCEx.ni.dll LoadedModule[55]=C:\Windows\assembly\NativeImages_v4.0.30319_64\MMCFxCommon\3804721e3998fdf29b06e86bcfe92eb8\MMCFxCommon.ni.dll LoadedModule[56]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Configuration\e3873005e8829578178618d41d012849\System.Configuration.ni.dll LoadedModule[57]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Xml\aea95442f7e98cffc3c849fe3b0658d6\System.Xml.ni.dll LoadedModule[58]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Drawing\f28da0d8140095c5c86e9f2443878807\System.Drawing.ni.dll LoadedModule[59]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Windows.Forms\c2f5f2174cecd9faaf74a0cdeebfdd49\System.Windows.Forms.ni.dll LoadedModule[60]=C:\Windows\Microsoft.NET\Framework64\v4.0.30319\diasymreader.dll LoadedModule[61]=C:\Windows\assembly\NativeImages_v4.0.30319_64\Microsoft.Mff1be75b#\3c16df28b2935a005a7fd0da96e0ff6c\Microsoft.ManagementConsole.ni.dll LoadedModule[62]=C:\Windows\Microsoft.NET\Framework64\v4.0.30319\clrjit.dll LoadedModule[63]=C:\Windows\assembly\NativeImages_v4.0.30319_64\DfsMgmt\ed2ebd5dc4469285040f2e21c5e990dc\DfsMgmt.ni.dll LoadedModule[64]=C:\Windows\assembly\NativeImages_v4.0.30319_64\DfsObjectModel\43ed7ca19e7c26cbf27c5c8a2e0fec93\DfsObjectModel.ni.dll LoadedModule[65]=C:\Windows\assembly\NativeImages_v4.0.30319_64\CfsCommonUIFx\aea54a98ed63ebeaa6703e9f0a724ac8\CfsCommonUIFx.ni.dll LoadedModule[66]=C:\Windows\assembly\NativeImages_v4.0.30319_64\Interop.DFSRHelper\3780b83ee96c137664d8807e7042768f\Interop.DFSRHelper.ni.dll LoadedModule[67]=C:\Windows\system32\WindowsCodecs.dll LoadedModule[68]=C:\Windows\WinSxS\amd64_microsoft.windows.common-controls_6595b64144ccf1df_5.82.9200.16384_none_7762d5fd3178b04e\comctl32.dll LoadedModule[69]=C:\Windows\WinSxS\amd64_microsoft.windows.gdiplus_6595b64144ccf1df_1.1.9200.16518_none_726fbfe0cc22f012\gdiplus.dll LoadedModule[70]=C:\Windows\system32\DWrite.dll LoadedModule[71]=C:\Windows\system32\COMDLG32.dll LoadedModule[72]=C:\Windows\system32\Netapi32.dll LoadedModule[73]=C:\Windows\system32\netutils.dll LoadedModule[74]=C:\Windows\system32\srvcli.dll LoadedModule[75]=C:\Windows\system32\wkscli.dll LoadedModule[76]=C:\Windows\system32\clusapi.dll LoadedModule[77]=C:\Windows\system32\cryptdll.dll LoadedModule[78]=C:\Windows\system32\WS2_32.dll LoadedModule[79]=C:\Windows\system32\NSI.dll LoadedModule[80]=C:\Windows\system32\mswsock.dll LoadedModule[81]=C:\Windows\system32\DNSAPI.dll LoadedModule[82]=C:\Windows\System32\rasadhlp.dll LoadedModule[83]=C:\Windows\system32\IPHLPAPI.DLL LoadedModule[84]=C:\Windows\system32\WINNSI.DLL LoadedModule[85]=C:\Windows\System32\fwpuclnt.dll LoadedModule[86]=C:\Windows\system32\DFSCLI.DLL LoadedModule[87]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Dired13b18a9#\0acd265b442254788d2d1429c296558c\System.DirectoryServices.ni.dll LoadedModule[88]=C:\Windows\system32\ntdsapi.dll LoadedModule[89]=C:\Windows\system32\LOGONCLI.DLL LoadedModule[90]=C:\Windows\system32\activeds.dll LoadedModule[91]=C:\Windows\system32\adsldpc.dll LoadedModule[92]=C:\Windows\system32\WLDAP32.dll LoadedModule[93]=C:\Windows\system32\adsldp.dll LoadedModule[94]=C:\Windows\system32\SspiCli.dll LoadedModule[95]=C:\Windows\system32\DSPARSE.dll LoadedModule[96]=C:\Windows\system32\msv1_0.DLL LoadedModule[97]=C:\Windows\system32\cscapi.dll LoadedModule[98]=C:\Windows\system32\DSROLE.DLL LoadedModule[99]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Dire5d62f0a2#\819205bfacb57978948171e414993369\System.DirectoryServices.Protocols.ni.dll LoadedModule[100]=C:\Windows\System32\objsel.dll LoadedModule[101]=C:\Windows\System32\Secur32.dll LoadedModule[102]=C:\Windows\System32\credui.dll LoadedModule[103]=C:\Windows\system32\CRYPT32.dll LoadedModule[104]=C:\Windows\system32\MSASN1.dll LoadedModule[105]=C:\Windows\System32\DPAPI.DLL LoadedModule[106]=C:\Windows\system32\riched32.dll LoadedModule[107]=C:\Windows\system32\RICHED20.dll LoadedModule[108]=C:\Windows\system32\USP10.dll LoadedModule[109]=C:\Windows\system32\msls31.dll LoadedModule[110]=C:\Windows\System32\Windows.Globalization.dll LoadedModule[111]=C:\Windows\System32\Bcp47Langs.dll LoadedModule[112]=C:\Windows\assembly\NativeImages_v4.0.30319_64\System.Serv759bfb78#\e44b9230fcc7dc263820eff07cfc6353\System.ServiceProcess.ni.dll LoadedModule[113]=C:\Windows\system32\kerberos.DLL LoadedModule[114]=C:\Windows\system32\bcrypt.dll LoadedModule[115]=C:\Windows\assembly\NativeImages_v4.0.30319_64\Accessibility\e69795104b16b74fe9c1e7dff4f3f510\Accessibility.ni.dll LoadedModule[116]=C:\Windows\system32\MPR.dll LoadedModule[117]=C:\Windows\System32\drprov.dll LoadedModule[118]=C:\Windows\System32\WINSTA.dll LoadedModule[119]=C:\Windows\System32\ntlanman.dll LoadedModule[120]=C:\Windows\system32\explorerframe.dll FriendlyEventName=Stopped working ConsentKey=CLR20r3 AppName=Microsoft Management Console AppPath=C:\Windows\system32\mmc.exe NsPartner=windows NsGroup=windows8 Application Log Event ID: 1000 Faulting application name: mmc.exe, version: 6.2.9200.16496, time stamp: 0x50ece2e8 Faulting module name: KERNELBASE.dll, version: 6.2.9200.16451, time stamp: 0x50988aa6 Exception code: 0xe0434352 Fault offset: 0x000000000003811c Faulting process id: 0xd30 Faulting application start time: 0x01ce71411a7b775b Faulting application path: C:\Windows\system32\mmc.exe Faulting module path: C:\Windows\system32\KERNELBASE.dll Report Id: d15d0d37-dd36-11e2-93fb-005056af764c Faulting package full name: Faulting package-relative application ID: Application Log Event ID: 1026 Application: mmc.exe Framework Version: v4.0.30319 Description: The process was terminated due to an unhandled exception. Exception Info: System.Runtime.InteropServices.SEHException Stack: at System.Windows.Forms.UnsafeNativeMethods.ThemingScope.DeactivateActCtx(Int32 dwFlags, IntPtr lpCookie) at System.Windows.Forms.Application.ThreadContext.RunMessageLoop(Int32 reason, ApplicationContext context) at Microsoft.ManagementConsole.Internal.SnapInMessagePumpProxy.Microsoft.ManagementConsole.Internal.ISnapInMessagePumpProxy.Run() at Microsoft.ManagementConsole.Executive.SnapInThread.OnThreadStart() at System.Threading.ExecutionContext.RunInternal(System.Threading.ExecutionContext, System.Threading.ContextCallback, System.Object, Boolean) at System.Threading.ExecutionContext.Run(System.Threading.ExecutionContext, System.Threading.ContextCallback, System.Object, Boolean) at System.Threading.ExecutionContext.Run(System.Threading.ExecutionContext, System.Threading.ContextCallback, System.Object) at System.Threading.ThreadHelper.ThreadStart()

  Read the article

• apt-get update mdadm scary warnings

  - by user568829

  Just ran an apt-get update on one of my dedicated servers to be left with a relatively scary warning: Processing triggers for initramfs-tools ... update-initramfs: Generating /boot/initrd.img-2.6.26-2-686-bigmem W: mdadm: the array /dev/md/1 with UUID c622dd79:496607cf:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/2 with UUID 24120323:8c54087c:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/6 with UUID eef74de5:9267b2a1:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. W: mdadm: the array /dev/md/5 with UUID 5d45b20c:04d8138f:c230666b:5103eba0 W: mdadm: is currently active, but it is not listed in mdadm.conf. if W: mdadm: it is needed for boot, then YOUR SYSTEM IS NOW UNBOOTABLE! W: mdadm: please inspect the output of /usr/share/mdadm/mkconf, compare W: mdadm: it to /etc/mdadm/mdadm.conf, and make the necessary changes. As instructed I inspected the output of /usr/share/mdadm/mkconf and compared with /etc/mdadm/mdadm.conf and they are quite different. Here is the /etc/mdadm/mdadm.conf contents: # mdadm.conf # # Please refer to mdadm.conf(5) for information about this file. # # by default, scan all partitions (/proc/partitions) for MD superblocks. # alternatively, specify devices to scan, using wildcards if desired. DEVICE partitions # auto-create devices with Debian standard permissions CREATE owner=root group=disk mode=0660 auto=yes # automatically tag new arrays as belonging to the local system HOMEHOST <system> # instruct the monitoring daemon where to send mail alerts MAILADDR root # definitions of existing MD arrays ARRAY /dev/md0 level=raid1 num-devices=2 UUID=b93b0b87:5f7c2c46:0043fca9:4026c400 ARRAY /dev/md1 level=raid1 num-devices=2 UUID=c0fa8842:e214fb1a:fad8a3a2:28f2aabc ARRAY /dev/md2 level=raid1 num-devices=2 UUID=cdc2a9a9:63bbda21:f55e806c:a5371897 ARRAY /dev/md3 level=raid1 num-devices=2 UUID=eca75495:9c9ce18c:d2bac587:f1e79d80 # This file was auto-generated on Wed, 04 Nov 2009 11:32:16 +0100 # by mkconf $Id$ And here is the out put from /usr/share/mdadm/mkconf # mdadm.conf # # Please refer to mdadm.conf(5) for information about this file. # # by default, scan all partitions (/proc/partitions) for MD superblocks. # alternatively, specify devices to scan, using wildcards if desired. DEVICE partitions # auto-create devices with Debian standard permissions CREATE owner=root group=disk mode=0660 auto=yes # automatically tag new arrays as belonging to the local system HOMEHOST <system> # instruct the monitoring daemon where to send mail alerts MAILADDR root # definitions of existing MD arrays ARRAY /dev/md1 UUID=c622dd79:496607cf:c230666b:5103eba0 ARRAY /dev/md2 UUID=24120323:8c54087c:c230666b:5103eba0 ARRAY /dev/md5 UUID=5d45b20c:04d8138f:c230666b:5103eba0 ARRAY /dev/md6 UUID=eef74de5:9267b2a1:c230666b:5103eba0 # This configuration was auto-generated on Sat, 25 Feb 2012 13:10:00 +1030 # by mkconf 3.1.4-1+8efb9d1+squeeze1 As I understand it I need to replace the four lines that start with 'ARRAY' in the /etc/mdadm/mdadm.conf file with the different four 'ARRAY' lines from the /usr/share/mdadm/mkconf output. When I did this and then ran update-initramfs -u there were no more warnings. Is what I have done above correct? I am now terrified of rebooting the server for fear it will not reboot and being a remote dedicated server this would certainly mean downtime and possibly would be expensive to get running again. FOLLOW UP (response to question): the output from mount: /dev/md1 on / type ext3 (rw,usrquota,grpquota) tmpfs on /lib/init/rw type tmpfs (rw,nosuid,mode=0755) proc on /proc type proc (rw,noexec,nosuid,nodev) sysfs on /sys type sysfs (rw,noexec,nosuid,nodev) udev on /dev type tmpfs (rw,mode=0755) tmpfs on /dev/shm type tmpfs (rw,nosuid,nodev) devpts on /dev/pts type devpts (rw,noexec,nosuid,gid=5,mode=620) /dev/md2 on /boot type ext2 (rw) /dev/md5 on /tmp type ext3 (rw) /dev/md6 on /home type ext3 (rw,usrquota,grpquota) mdadm --detail /dev/md0 mdadm: md device /dev/md0 does not appear to be active. mdadm --detail /dev/md1 /dev/md1: Version : 0.90 Creation Time : Sun Aug 14 09:43:08 2011 Raid Level : raid1 Array Size : 31463232 (30.01 GiB 32.22 GB) Used Dev Size : 31463232 (30.01 GiB 32.22 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 1 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:03:47 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : c622dd79:496607cf:c230666b:5103eba0 Events : 0.24 Number Major Minor RaidDevice State 0 8 1 0 active sync /dev/sda1 1 8 17 1 active sync /dev/sdb1 mdadm --detail /dev/md2 /dev/md2: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 104320 (101.89 MiB 106.82 MB) Used Dev Size : 104320 (101.89 MiB 106.82 MB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 2 Persistence : Superblock is persistent Update Time : Sat Feb 25 13:20:20 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : 24120323:8c54087c:c230666b:5103eba0 Events : 0.30 Number Major Minor RaidDevice State 0 8 2 0 active sync /dev/sda2 1 8 18 1 active sync /dev/sdb2 mdadm --detail /dev/md3 mdadm: md device /dev/md3 does not appear to be active. mdadm --detail /dev/md5 /dev/md5: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 2104448 (2.01 GiB 2.15 GB) Used Dev Size : 2104448 (2.01 GiB 2.15 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 5 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:09:03 2012 State : clean Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : 5d45b20c:04d8138f:c230666b:5103eba0 Events : 0.30 Number Major Minor RaidDevice State 0 8 5 0 active sync /dev/sda5 1 8 21 1 active sync /dev/sdb5 mdadm --detail /dev/md6 /dev/md6: Version : 0.90 Creation Time : Sun Aug 14 09:43:09 2011 Raid Level : raid1 Array Size : 453659456 (432.64 GiB 464.55 GB) Used Dev Size : 453659456 (432.64 GiB 464.55 GB) Raid Devices : 2 Total Devices : 2 Preferred Minor : 6 Persistence : Superblock is persistent Update Time : Sat Feb 25 14:10:00 2012 State : active Active Devices : 2 Working Devices : 2 Failed Devices : 0 Spare Devices : 0 UUID : eef74de5:9267b2a1:c230666b:5103eba0 Events : 0.31 Number Major Minor RaidDevice State 0 8 6 0 active sync /dev/sda6 1 8 22 1 active sync /dev/sdb6 FOLLOW UP 2 (response to question): Output from /etc/fstab /dev/md1 / ext3 defaults,usrquota,grpquota 1 1 devpts /dev/pts devpts mode=0620,gid=5 0 0 proc /proc proc defaults 0 0 #usbdevfs /proc/bus/usb usbdevfs noauto 0 0 /dev/cdrom /media/cdrom auto ro,noauto,user,exec 0 0 /dev/dvd /media/dvd auto ro,noauto,user,exec 0 0 # # # /dev/md2 /boot ext2 defaults 1 2 /dev/sda3 swap swap pri=42 0 0 /dev/sdb3 swap swap pri=42 0 0 /dev/md5 /tmp ext3 defaults 0 0 /dev/md6 /home ext3 defaults,usrquota,grpquota 1 2

  Read the article

• Puppet's automatically generated certificates failing

  - by gparent

  I am running a default configuration of Puppet on Debian Squeeze 6.0.4. The server's FQDN is master.example.com. The client's FQDN is client.example.com. I am able to contact the puppet master and send a CSR. I sign it using puppetca -sa but the client will still not connect. Date of both machines is within 2 seconds of Tue Apr 3 20:59:00 UTC 2012 as I wrote this sentence. This is what appears in /var/log/syslog: Apr 3 17:03:52 localhost puppet-agent[18653]: Reopening log files Apr 3 17:03:52 localhost puppet-agent[18653]: Starting Puppet client version 2.6.2 Apr 3 17:03:53 localhost puppet-agent[18653]: Could not retrieve catalog from remote server: SSL_connect returned=1 errno=0 state=SSLv3 read server certificate B: certificate verify failed Apr 3 17:03:53 localhost puppet-agent[18653]: Using cached catalog Apr 3 17:03:53 localhost puppet-agent[18653]: Could not retrieve catalog; skipping run Here is some interesting output: OpenSSL client test: client:~# openssl s_client -host master.example.com -port 8140 -cert /var/lib/puppet/ssl/certs/client.example.com.pem -key /var/lib/puppet/ssl/private_keys/client.example.com.pem -CAfile /var/lib/puppet/ssl/certs/ca.pem CONNECTED(00000003) depth=1 /CN=Puppet CA: master.example.com verify return:1 depth=0 /CN=master.example.com verify error:num=7:certificate signature failure verify return:1 depth=0 /CN=master.example.com verify return:1 18509:error:1409441B:SSL routines:SSL3_READ_BYTES:tlsv1 alert decrypt error:s3_pkt.c:1102:SSL alert number 51 18509:error:140790E5:SSL routines:SSL23_WRITE:ssl handshake failure:s23_lib.c:188: client:~# master's certificate: root@master:/etc/puppet# openssl x509 -text -noout -in /etc/puppet/ssl/certs/master.example.com.pem Certificate: Data: Version: 3 (0x2) Serial Number: 2 (0x2) Signature Algorithm: sha1WithRSAEncryption Issuer: CN=Puppet CA: master.example.com Validity Not Before: Apr 2 20:01:28 2012 GMT Not After : Apr 2 20:01:28 2017 GMT Subject: CN=master.example.com Subject Public Key Info: Public Key Algorithm: rsaEncryption RSA Public Key: (1024 bit) Modulus (1024 bit): 00:a9:c1:f9:4c:cd:0f:68:84:7b:f4:93:16:20:44: 7a:2b:05:8e:57:31:05:8e:9c:c8:08:68:73:71:39: c1:86:6a:59:93:6e:53:aa:43:11:83:5b:2d:8c:7d: 54:05:65:c1:e1:0e:94:4a:f0:86:58:c3:3d:4f:f3: 7d:bd:8e:29:58:a6:36:f4:3e:b2:61:ec:53:b5:38: 8e:84:ac:5f:a3:e3:8c:39:bd:cf:4f:3c:ff:a9:65: 09:66:3c:ba:10:14:69:d5:07:57:06:28:02:37:be: 03:82:fb:90:8b:7d:b3:a5:33:7b:9b:3a:42:51:12: b3:ac:dd:d5:58:69:a9:8a:ed Exponent: 65537 (0x10001) X509v3 extensions: X509v3 Basic Constraints: critical CA:FALSE Netscape Comment: Puppet Ruby/OpenSSL Internal Certificate X509v3 Key Usage: critical Digital Signature, Key Encipherment X509v3 Subject Key Identifier: 8C:2F:14:84:B6:A1:B5:0C:11:52:36:AB:E5:3F:F2:B9:B3:25:F3:1C X509v3 Extended Key Usage: critical TLS Web Server Authentication, TLS Web Client Authentication Signature Algorithm: sha1WithRSAEncryption 7b:2c:4f:c2:76:38:ab:03:7f:c6:54:d9:78:1d:ab:6c:45:ab: 47:02:c7:fd:45:4e:ab:b5:b6:d9:a7:df:44:72:55:0c:a5:d0: 86:58:14:ae:5f:6f:ea:87:4d:78:e4:39:4d:20:7e:3d:6d:e9: e2:5e:d7:c9:3c:27:43:a4:29:44:85:a1:63:df:2f:55:a9:6a: 72:46:d8:fb:c7:cc:ca:43:e7:e1:2c:fe:55:2a:0d:17:76:d4: e5:49:8b:85:9f:fa:0e:f6:cc:e8:28:3e:8b:47:b0:e1:02:f0: 3d:73:3e:99:65:3b:91:32:c5:ce:e4:86:21:b2:e0:b4:15:b5: 22:63 root@master:/etc/puppet# CA's certificate: root@master:/etc/puppet# openssl x509 -text -noout -in /etc/puppet/ssl/certs/ca.pem Certificate: Data: Version: 3 (0x2) Serial Number: 1 (0x1) Signature Algorithm: sha1WithRSAEncryption Issuer: CN=Puppet CA: master.example.com Validity Not Before: Apr 2 20:01:05 2012 GMT Not After : Apr 2 20:01:05 2017 GMT Subject: CN=Puppet CA: master.example.com Subject Public Key Info: Public Key Algorithm: rsaEncryption RSA Public Key: (1024 bit) Modulus (1024 bit): 00:b5:2c:3e:26:a3:ae:43:b8:ed:1e:ef:4d:a1:1e: 82:77:78:c2:98:3f:e2:e0:05:57:f0:8d:80:09:36: 62:be:6c:1a:21:43:59:1d:e9:b9:4d:e0:9c:fa:09: aa:12:a1:82:58:fc:47:31:ed:ad:ad:73:01:26:97: ef:d2:d6:41:6b:85:3b:af:70:00:b9:63:e9:1b:c3: ce:57:6d:95:0e:a6:d2:64:bd:1f:2c:1f:5c:26:8e: 02:fd:d3:28:9e:e9:8f:bc:46:bb:dd:25:db:39:57: 81:ed:e5:c8:1f:3d:ca:39:cf:e7:f3:63:75:f6:15: 1f:d4:71:56:ed:84:50:fb:5d Exponent: 65537 (0x10001) X509v3 extensions: X509v3 Basic Constraints: critical CA:TRUE Netscape Comment: Puppet Ruby/OpenSSL Internal Certificate X509v3 Key Usage: critical Certificate Sign, CRL Sign X509v3 Subject Key Identifier: 8C:2F:14:84:B6:A1:B5:0C:11:52:36:AB:E5:3F:F2:B9:B3:25:F3:1C Signature Algorithm: sha1WithRSAEncryption 1d:cd:c6:65:32:42:a5:01:62:46:87:10:da:74:7e:8b:c8:c9: 86:32:9e:c2:2e:c1:fd:00:79:f0:ef:d8:73:dd:7e:1b:1a:3f: cc:64:da:a3:38:ad:49:4e:c8:4d:e3:09:ba:bc:66:f2:6f:63: 9a:48:19:2d:27:5b:1d:2a:69:bf:4f:f4:e0:67:5e:66:84:30: e5:85:f4:49:6e:d0:92:ae:66:77:50:cf:45:c0:29:b2:64:87: 12:09:d3:10:4d:91:b6:f3:63:c4:26:b3:fa:94:2b:96:18:1f: 9b:a9:53:74:de:9c:73:a4:3a:8d:bf:fa:9c:c0:42:9d:78:49: 4d:70 root@master:/etc/puppet# Client's certificate: client:~# openssl x509 -text -noout -in /var/lib/puppet/ssl/certs/client.example.com.pem Certificate: Data: Version: 3 (0x2) Serial Number: 3 (0x3) Signature Algorithm: sha1WithRSAEncryption Issuer: CN=Puppet CA: master.example.com Validity Not Before: Apr 2 20:01:36 2012 GMT Not After : Apr 2 20:01:36 2017 GMT Subject: CN=client.example.com Subject Public Key Info: Public Key Algorithm: rsaEncryption RSA Public Key: (1024 bit) Modulus (1024 bit): 00:ae:88:6d:9b:e3:b1:fc:47:07:d6:bf:ea:53:d1: 14:14:9b:35:e6:70:43:e0:58:35:76:ac:c5:9d:86: 02:fd:77:28:fc:93:34:65:9d:dd:0b:ea:21:14:4d: 8a:95:2e:28:c9:a5:8d:a2:2c:0e:1c:a0:4c:fa:03: e5:aa:d3:97:98:05:59:3c:82:a9:7c:0e:e9:df:fd: 48:81:dc:33:dc:88:e9:09:e4:19:d6:e4:7b:92:33: 31:73:e4:f2:9c:42:75:b2:e1:9f:d9:49:8c:a7:eb: fa:7d:cb:62:22:90:1c:37:3a:40:95:a7:a0:3b:ad: 8e:12:7c:6e:ad:04:94:ed:47 Exponent: 65537 (0x10001) X509v3 extensions: X509v3 Basic Constraints: critical CA:FALSE Netscape Comment: Puppet Ruby/OpenSSL Internal Certificate X509v3 Key Usage: critical Digital Signature, Key Encipherment X509v3 Subject Key Identifier: 8C:2F:14:84:B6:A1:B5:0C:11:52:36:AB:E5:3F:F2:B9:B3:25:F3:1C X509v3 Extended Key Usage: critical TLS Web Server Authentication, TLS Web Client Authentication Signature Algorithm: sha1WithRSAEncryption 33:1f:ec:3c:91:5a:eb:c6:03:5f:a1:58:60:c3:41:ed:1f:fe: cb:b2:40:11:63:4d:ba:18:8a:8b:62:ba:ab:61:f5:a0:6c:0e: 8a:20:56:7b:10:a1:f9:1d:51:49:af:70:3a:05:f9:27:4a:25: d4:e6:88:26:f7:26:e0:20:30:2a:20:1d:c4:d3:26:f1:99:cf: 47:2e:73:90:bd:9c:88:bf:67:9e:dd:7c:0e:3a:86:6b:0b:8d: 39:0f:db:66:c0:b6:20:c3:34:84:0e:d8:3b:fc:1c:a8:6c:6c: b1:19:76:65:e6:22:3c:bf:ff:1c:74:bb:62:a0:46:02:95:fa: 83:41 client:~#

  Read the article

• Resolving data redundancy up front

  - by okeofs

  Introduction As all of us do when confronted with a problem, the resource of choice is to ‘Google it’. This is where the plot thickens. Recently I was asked to stage data from numerous databases which were to be loaded into a data warehouse. To make a long story short, I was looking for a manner in which to obtain the table names from each database, to ascertain potential overlap.   As the source data comes from a SQL database created from dumps of a third party product,  one could say that there were +/- 95 tables for each database.   Yes I know that first instinct is to use the system stored procedure “exec sp_msforeachdb 'select "?" AS db, * from [?].sys.tables'”. However, if one stops to think about this, it would be nice to have all the results in a temporary or disc based  table; which in itself , implies additional labour. This said,  I decided to ‘re-invent’ the wheel. The full code sample may be found at the bottom of this article.   Define a few temporary tables and variables   declare @SQL varchar(max); declare @databasename varchar(75) /* drop table ##rawdata3 drop table #rawdata1 drop table #rawdata11 */ -- A temp table to hold the names of my databases CREATE TABLE #rawdata1 (    database_name varchar(50) ,    database_size varchar(50),    remarks Varchar(50) )     --A temp table with the same database names as above, HOWEVER using an --Identity number (recNO) as a loop variable. --You will note below that I loop through until I reach 25 (see below) as at --that point the system databases, the reporting server database etc begin. --1- 24 are user databases. These are really what I was looking for. --Whilst NOT the best solution,it works and the code was meant as a quick --and dirty. CREATE TABLE #rawdata11 (    recNo int identity(1,1),    database_name varchar(50) ,    database_size varchar(50),    remarks Varchar(50) )   --My output table showing the database name and table name CREATE TABLE ##rawdata3 (    database_name varchar(75) ,    table_name varchar(75), )   Insert the database names into a temporary table I pull the database names using the system stored procedure sp_databases   INSERT INTO #rawdata1 EXEC sp_databases Go   Insert the results from #rawdata1 into a table containing a record number  #rawdata11 so that I can LOOP through the extract   INSERT into #rawdata11 select * from  #rawdata1   We now declare 3 more variables:  @kounter is used to keep track of our position within the loop. @databasename is used to keep track of the’ current ‘ database name being used in the current pass of the loop;  as inorder to obtain the tables for that database we  need to issue a ‘USE’ statement, an insert command and other related code parts. This is the challenging part. @sql is a varchar(max) variable used to contain the ‘USE’ statement PLUS the’ insert ‘ code statements. We now initalize @kounter to 1 .   declare @kounter int; declare @databasename varchar(75); declare @sql varchar(max); set @kounter = 1   The Loop The astute reader will remember that the temporary table #rawdata11 contains our  database names  and each ‘database row’ has a record number (recNo). I am only interested in record numbers under 25. I now set the value of the temporary variable @DatabaseName (see below) .Note that I used the row number as a part of the predicate. Now, knowing the database name, I can create dynamic T-SQL to be executed using the sp_sqlexec stored procedure (see the code in red below). Finally, after all the tables for that given database have been placed in temporary table ##rawdata3, I increment the counter and continue on. Note that I used a global temporary table to ensure that the result set persists after the termination of the run. At some stage, I plan to redo this part of the code, as global temporary tables are not really an ideal solution.    WHILE (@kounter < 25)  BEGIN  select @DatabaseName = database_name from #rawdata11 where recNo = @kounter  set @SQL = 'Use ' + @DatabaseName + ' Insert into ##rawdata3 ' + + ' SELECT table_catalog,Table_name FROM information_schema.tables' exec sp_sqlexec  @Sql  SET @kounter  = @kounter + 1  END   The full code extract   Here is the full code sample.   declare @SQL varchar(max); declare @databasename varchar(75) /* drop table ##rawdata3 drop table #rawdata1 drop table #rawdata11 */ CREATE TABLE #rawdata1 (    database_name varchar(50) ,    database_size varchar(50),    remarks Varchar(50) ) CREATE TABLE #rawdata11 (    recNo int identity(1,1),    database_name varchar(50) ,    database_size varchar(50),    remarks Varchar(50) ) CREATE TABLE ##rawdata3 (    database_name varchar(75) ,    table_name varchar(75), )   INSERT INTO #rawdata1 EXEC sp_databases go INSERT into #rawdata11 select * from  #rawdata1 declare @kounter int; declare @databasename varchar(75); declare @sql varchar(max); set @kounter = 1 WHILE (@kounter < 25)  BEGIN  select @databasename = database_name from #rawdata11 where recNo = @kounter  set @SQL = 'Use ' + @DatabaseName + ' Insert into ##rawdata3 ' + + ' SELECT table_catalog,Table_name FROM information_schema.tables' exec sp_sqlexec  @Sql  SET @kounter  = @kounter + 1  END    select * from ##rawdata3  where table_name like '%SalesOrderHeader%'

  Read the article

• Load application context problem in Maven managed spring-test TestNg

  - by joejax

  I try to setup a project with spring-test using TestNg in Maven. The code is like: @ContextConfiguration(locations={"test-context.xml"}) public class AppTest extends AbstractTestNGSpringContextTests { @Test public void testApp() { assert true; } } A test-context.xml simply defined a bean: <bean id="app" class="org.sonatype.mavenbook.simple.App"/> I got error for Failed to load ApplicationContext when running mvn test from command line, seems it cannot find the test-context.xml file; however, I can get it run correctly inside Eclipse (with TestNg plugin). So, test-context.xml is under src/test/resources/, how do I indicate this in the pom.xml so that 'mvn test' command will work? Thanks, UPDATE: Thanks for the reply. Cannot load context file error was caused by I moved the file arround in different location since I though the classpath was the problem. Now I found the context file seems loaded from the Maven output, but the test is failed: Running TestSuite May 25, 2010 9:55:13 AM org.springframework.beans.factory.xml.XmlBeanDefinitionReader loadBeanDefinitions INFO: Loading XML bean definitions from class path resource [test-context.xml] May 25, 2010 9:55:13 AM org.springframework.context.support.AbstractApplicationContext prepareRefresh INFO: Refreshing org.springframework.context.support.GenericApplicationContext@171bbc9: display name [org.springframework.context.support.GenericApplicationContext@171bbc9]; startup date [Tue May 25 09:55:13 PDT 2010]; root of context hierarchy May 25, 2010 9:55:13 AM org.springframework.context.support.AbstractApplicationContext obtainFreshBeanFactory INFO: Bean factory for application context [org.springframework.context.support.GenericApplicationContext@171bbc9]: org.springframework.beans.factory.support.DefaultListableBeanFactory@1df8b99 May 25, 2010 9:55:13 AM org.springframework.beans.factory.support.DefaultListableBeanFactory preInstantiateSingletons INFO: Pre-instantiating singletons in org.springframework.beans.factory.support.DefaultListableBeanFactory@1df8b99: defining beans [app,org.springframework.context.annotation.internalCommonAnnotationProcessor,org.springframework.context.annotation.internalAutowiredAnnotationProcessor,org.springframework.context.annotation.internalRequiredAnnotationProcessor]; root of factory hierarchy Tests run: 3, Failures: 2, Errors: 0, Skipped: 1, Time elapsed: 0.63 sec If I use spring-test version 3.0.2.RELEASE, the error becomes: org.springframework.test.context.testng.AbstractTestNGSpringContextTests.springTestContextPrepareTestInstance() is depending on nonexistent method null Here is the structure of the project: simple |-- pom.xml `-- src |-- main | `-- java `-- test |-- java `-- resources |-- test-context.xml `-- testng.xml testng.xml: <suite name="Suite" parallel="false"> <test name="Test"> <classes> <class name="org.sonatype.mavenbook.simple.AppTest"/> </classes> </test> </suite> test-context.xml: <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.0.xsd" default-lazy-init="true"> <bean id="app" class="org.sonatype.mavenbook.simple.App"/> </beans> In the pom.xml, I add testng, spring, and spring-test artifacts, and plugin: <dependency> <groupId>org.testng</groupId> <artifactId>testng</artifactId> <version>5.1</version> <classifier>jdk15</classifier> <scope>test</scope> </dependency> <dependency> <groupId>org.springframework</groupId> <artifactId>spring</artifactId> <version>2.5.6</version> </dependency> <dependency> <groupId>org.springframework</groupId> <artifactId>spring-test</artifactId> <version>2.5.6</version> <scope>test</scope> </dependency> <build> <finalName>simple</finalName> <plugins> <plugin> <artifactId>maven-compiler-plugin</artifactId> <configuration> <source>1.6</source> <target>1.6</target> </configuration> </plugin> <plugin> <groupId>org.apache.maven.plugins</groupId> <artifactId>maven-surefire-plugin</artifactId> <configuration> <suiteXmlFiles> <suiteXmlFile>src/test/resources/testng.xml</suiteXmlFile> </suiteXmlFiles> </configuration> </plugin> </plugins> Basically, I replaced 'A Simple Maven Project' Junit with TestNg, hope it works.

  Read the article

• Unix: how to have delimiter as "\t&\t" in paste-tool?

  - by HH

  Results are in clean files. I want to get them to latex-table format with paste. So how can I have a delimiter "\t&\t"? or is there some Latex tool? Pasting Columnwise to have \t&\t delimiter $ paste -d'\t\&\t' d d_powered_-2 rad 5.0 400.0&384.5 7.5 204.1&184.5 10.0 100.0&115.5 15.0 44.4&58.2 20.0 25.0&45.0 25.0 16.0&38.8 30.0 11.1&33.3 35.0 8.2&34.4 37.0 7.3&34.1 40.0 6.2&34.1 $ paste d d_powered_-2 rad 5.0 400.0 384.5 7.5 204.1 184.5 10.0 100.0 115.5 15.0 44.4 58.2 20.0 25.0 45.0 25.0 16.0 38.8 30.0 11.1 33.3 35.0 8.2 34.4 37.0 7.3 34.1 40.0 6.2 34.1

  Read the article

• springTestContextBeforeTestMethod failed in Maven spring-test

  - by joejax

  I try to setup a project with spring-test using TestNg in Maven. The code is like: @ContextConfiguration(locations={"test-context.xml"}) public class AppTest extends AbstractTestNGSpringContextTests { @Test public void testApp() { assert true; } } A test-context.xml simply defined a bean: <bean id="app" class="org.sonatype.mavenbook.simple.App"/> I got error for Failed to load ApplicationContext when running mvn test from command line, seems it cannot find the test-context.xml file; however, I can get it run correctly inside Eclipse (with TestNg plugin). So, test-context.xml is under src/test/resources/, how do I indicate this in the pom.xml so that 'mvn test' command will work? Thanks, UPDATE: Thanks for the reply. Cannot load context file error was caused by I moved the file arround in different location since I though the classpath was the problem. Now I found the context file seems loaded from the Maven output, but the test is failed: Running TestSuite May 25, 2010 9:55:13 AM org.springframework.beans.factory.xml.XmlBeanDefinitionReader loadBeanDefinitions INFO: Loading XML bean definitions from class path resource [test-context.xml] May 25, 2010 9:55:13 AM org.springframework.context.support.AbstractApplicationContext prepareRefresh INFO: Refreshing org.springframework.context.support.GenericApplicationContext@171bbc9: display name [org.springframework.context.support.GenericApplicationContext@171bbc9]; startup date [Tue May 25 09:55:13 PDT 2010]; root of context hierarchy May 25, 2010 9:55:13 AM org.springframework.context.support.AbstractApplicationContext obtainFreshBeanFactory INFO: Bean factory for application context [org.springframework.context.support.GenericApplicationContext@171bbc9]: org.springframework.beans.factory.support.DefaultListableBeanFactory@1df8b99 May 25, 2010 9:55:13 AM org.springframework.beans.factory.support.DefaultListableBeanFactory preInstantiateSingletons INFO: Pre-instantiating singletons in org.springframework.beans.factory.support.DefaultListableBeanFactory@1df8b99: defining beans [app,org.springframework.context.annotation.internalCommonAnnotationProcessor,org.springframework.context.annotation.internalAutowiredAnnotationProcessor,org.springframework.context.annotation.internalRequiredAnnotationProcessor]; root of factory hierarchy Tests run: 3, Failures: 2, Errors: 0, Skipped: 1, Time elapsed: 0.63 sec <<< FAILURE! Results : Failed tests: springTestContextBeforeTestMethod(org.sonatype.mavenbook.simple.AppTest) springTestContextAfterTestMethod(org.sonatype.mavenbook.simple.AppTest) Tests run: 3, Failures: 2, Errors: 0, Skipped: 1 If I use spring-test version 3.0.2.RELEASE, the error becomes: org.springframework.test.context.testng.AbstractTestNGSpringContextTests.springTestContextPrepareTestInstance() is depending on nonexistent method null Here is the structure of the project: simple |-- pom.xml `-- src |-- main | `-- java `-- test |-- java `-- resources |-- test-context.xml `-- testng.xml testng.xml: <suite name="Suite" parallel="false"> <test name="Test"> <classes> <class name="org.sonatype.mavenbook.simple.AppTest"/> </classes> </test> </suite> test-context.xml: <beans xmlns="http://www.springframework.org/schema/beans" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans-2.0.xsd" default-lazy-init="true"> <bean id="app" class="org.sonatype.mavenbook.simple.App"/> </beans> In the pom.xml, I add testng, spring, and spring-test artifacts, and plugin: <dependency> <groupId>org.testng</groupId> <artifactId>testng</artifactId> <version>5.1</version> <classifier>jdk15</classifier> <scope>test</scope> </dependency> <dependency> <groupId>org.springframework</groupId> <artifactId>spring</artifactId> <version>2.5.6</version> </dependency> <dependency> <groupId>org.springframework</groupId> <artifactId>spring-test</artifactId> <version>2.5.6</version> <scope>test</scope> </dependency> <build> <finalName>simple</finalName> <plugins> <plugin> <artifactId>maven-compiler-plugin</artifactId> <configuration> <source>1.6</source> <target>1.6</target> </configuration> </plugin> <plugin> <groupId>org.apache.maven.plugins</groupId> <artifactId>maven-surefire-plugin</artifactId> <configuration> <suiteXmlFiles> <suiteXmlFile>src/test/resources/testng.xml</suiteXmlFile> </suiteXmlFiles> </configuration> </plugin> </plugins> Basically, I replaced 'A Simple Maven Project' Junit with TestNg, hope it works. UPDATE: I think I got the problem (still don't know why) - Whenever I extends AbstractTestNGSpringContextTests or AbstractTransactionalTestNGSpringContextTests, the test will failed with this error: Failed tests: springTestContextBeforeTestMethod(org.sonatype.mavenbook.simple.AppTest) springTestContextAfterTestMethod(org.sonatype.mavenbook.simple.AppTest) So, eventually the error went away when I override the two methods. I don't think this is the right way, didn't find much info from spring-test doc. If you know spring test framework, please shred some light on this.

  Read the article

• Random Page Cost and Planning

  - by Dave Jarvis

  A query (see below) that extracts climate data from weather stations within a given radius of a city using the dates for which those weather stations actually have data. The query uses the table's only index, rather effectively: CREATE UNIQUE INDEX measurement_001_stc_idx ON climate.measurement_001 USING btree (station_id, taken, category_id); Reducing the server's configuration value for random_page_cost from 2.0 to 1.1 had a massive performance improvement for the given range (nearly an order of magnitude) because it suggested to PostgreSQL that it should use the index. While the results now return in 5 seconds (down from ~85 seconds), problematic lines remain. Bumping the query's end date by a single year causes a full table scan: sc.taken_start >= '1900-01-01'::date AND sc.taken_end <= '1997-12-31'::date AND How do I persuade PostgreSQL to use the indexes regardless of years between the two dates? (A full table scan against 43 million rows is probably not the best plan.) Find the EXPLAIN ANALYSE results below the query. Thank you! Query SELECT extract(YEAR FROM m.taken) AS year, avg(m.amount) AS amount FROM climate.city c, climate.station s, climate.station_category sc, climate.measurement m WHERE c.id = 5182 AND earth_distance( ll_to_earth(c.latitude_decimal,c.longitude_decimal), ll_to_earth(s.latitude_decimal,s.longitude_decimal)) / 1000 <= 30 AND s.elevation BETWEEN 0 AND 3000 AND s.applicable = TRUE AND sc.station_id = s.id AND sc.category_id = 1 AND sc.taken_start >= '1900-01-01'::date AND sc.taken_end <= '1996-12-31'::date AND m.station_id = s.id AND m.taken BETWEEN sc.taken_start AND sc.taken_end AND m.category_id = sc.category_id GROUP BY extract(YEAR FROM m.taken) ORDER BY extract(YEAR FROM m.taken) 1900 to 1996: Index "Sort (cost=1348597.71..1348598.21 rows=200 width=12) (actual time=2268.929..2268.935 rows=92 loops=1)" " Sort Key: (date_part('year'::text, (m.taken)::timestamp without time zone))" " Sort Method: quicksort Memory: 32kB" " -> HashAggregate (cost=1348586.56..1348590.06 rows=200 width=12) (actual time=2268.829..2268.886 rows=92 loops=1)" " -> Nested Loop (cost=0.00..1344864.01 rows=744510 width=12) (actual time=0.807..2084.206 rows=134893 loops=1)" " Join Filter: ((m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (sc.station_id = m.station_id))" " -> Nested Loop (cost=0.00..12755.07 rows=1220 width=18) (actual time=0.502..521.937 rows=23 loops=1)" " Join Filter: ((sec_to_gc(cube_distance((ll_to_earth((c.latitude_decimal)::double precision, (c.longitude_decimal)::double precision))::cube, (ll_to_earth((s.latitude_decimal)::double precision, (s.longitude_decimal)::double precision))::cube)) / 1000::double precision) <= 30::double precision)" " -> Index Scan using city_pkey1 on city c (cost=0.00..2.47 rows=1 width=16) (actual time=0.014..0.015 rows=1 loops=1)" " Index Cond: (id = 5182)" " -> Nested Loop (cost=0.00..9907.73 rows=3659 width=34) (actual time=0.014..28.937 rows=3458 loops=1)" " -> Seq Scan on station_category sc (cost=0.00..970.20 rows=3659 width=14) (actual time=0.008..10.947 rows=3458 loops=1)" " Filter: ((taken_start >= '1900-01-01'::date) AND (taken_end <= '1996-12-31'::date) AND (category_id = 1))" " -> Index Scan using station_pkey1 on station s (cost=0.00..2.43 rows=1 width=20) (actual time=0.004..0.004 rows=1 loops=3458)" " Index Cond: (s.id = sc.station_id)" " Filter: (s.applicable AND (s.elevation >= 0) AND (s.elevation <= 3000))" " -> Append (cost=0.00..1072.27 rows=947 width=18) (actual time=6.996..63.199 rows=5865 loops=23)" " -> Seq Scan on measurement m (cost=0.00..25.00 rows=6 width=22) (actual time=0.000..0.000 rows=0 loops=23)" " Filter: (m.category_id = 1)" " -> Bitmap Heap Scan on measurement_001 m (cost=20.79..1047.27 rows=941 width=18) (actual time=6.995..62.390 rows=5865 loops=23)" " Recheck Cond: ((m.station_id = sc.station_id) AND (m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (m.category_id = 1))" " -> Bitmap Index Scan on measurement_001_stc_idx (cost=0.00..20.55 rows=941 width=0) (actual time=5.775..5.775 rows=5865 loops=23)" " Index Cond: ((m.station_id = sc.station_id) AND (m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end) AND (m.category_id = 1))" "Total runtime: 2269.264 ms" 1900 to 1997: Full Table Scan "Sort (cost=1370192.26..1370192.76 rows=200 width=12) (actual time=86165.797..86165.809 rows=94 loops=1)" " Sort Key: (date_part('year'::text, (m.taken)::timestamp without time zone))" " Sort Method: quicksort Memory: 32kB" " -> HashAggregate (cost=1370181.12..1370184.62 rows=200 width=12) (actual time=86165.654..86165.736 rows=94 loops=1)" " -> Hash Join (cost=4293.60..1366355.81 rows=765061 width=12) (actual time=534.786..85920.007 rows=139721 loops=1)" " Hash Cond: (m.station_id = sc.station_id)" " Join Filter: ((m.taken >= sc.taken_start) AND (m.taken <= sc.taken_end))" " -> Append (cost=0.00..867005.80 rows=43670150 width=18) (actual time=0.009..79202.329 rows=43670079 loops=1)" " -> Seq Scan on measurement m (cost=0.00..25.00 rows=6 width=22) (actual time=0.001..0.001 rows=0 loops=1)" " Filter: (category_id = 1)" " -> Seq Scan on measurement_001 m (cost=0.00..866980.80 rows=43670144 width=18) (actual time=0.008..73312.008 rows=43670079 loops=1)" " Filter: (category_id = 1)" " -> Hash (cost=4277.93..4277.93 rows=1253 width=18) (actual time=534.704..534.704 rows=25 loops=1)" " -> Nested Loop (cost=847.87..4277.93 rows=1253 width=18) (actual time=415.837..534.682 rows=25 loops=1)" " Join Filter: ((sec_to_gc(cube_distance((ll_to_earth((c.latitude_decimal)::double precision, (c.longitude_decimal)::double precision))::cube, (ll_to_earth((s.latitude_decimal)::double precision, (s.longitude_decimal)::double precision))::cube)) / 1000::double precision) <= 30::double precision)" " -> Index Scan using city_pkey1 on city c (cost=0.00..2.47 rows=1 width=16) (actual time=0.012..0.014 rows=1 loops=1)" " Index Cond: (id = 5182)" " -> Hash Join (cost=847.87..1352.07 rows=3760 width=34) (actual time=6.427..35.107 rows=3552 loops=1)" " Hash Cond: (s.id = sc.station_id)" " -> Seq Scan on station s (cost=0.00..367.25 rows=7948 width=20) (actual time=0.004..23.529 rows=7949 loops=1)" " Filter: (applicable AND (elevation >= 0) AND (elevation <= 3000))" " -> Hash (cost=800.87..800.87 rows=3760 width=14) (actual time=6.416..6.416 rows=3552 loops=1)" " -> Bitmap Heap Scan on station_category sc (cost=430.29..800.87 rows=3760 width=14) (actual time=2.316..5.353 rows=3552 loops=1)" " Recheck Cond: (category_id = 1)" " Filter: ((taken_start >= '1900-01-01'::date) AND (taken_end <= '1997-12-31'::date))" " -> Bitmap Index Scan on station_category_station_category_idx (cost=0.00..429.35 rows=6376 width=0) (actual time=2.268..2.268 rows=6339 loops=1)" " Index Cond: (category_id = 1)" "Total runtime: 86165.936 ms"

  Read the article

• problem in adding image to the UIButton.

  - by monish

  Hi friends, I got an another problem in my application and I am wasting so much of time on that. Does pls anyone can help with this problem. Actually I had an Event and I should give rating for that event for that I wrote the code as: In CellForRowAtIndexPath......I had the code as: - (UITableViewCell *)tableView:(UITableView *)tv cellForRowAtIndexPath:(NSIndexPath *)indexPath { UITableViewCell *cell = [tableView dequeueReusableCellWithIdentifier:@"MasterViewIdentifier"]; //UITableViewCell *cell = nil; if (cell == nil) { cell = [[[UITableViewCell alloc] initWithFrame:CGRectZero reuseIdentifier:@"MasterViewIdentifier"] autorelease]; cell.selectionStyle = UITableViewCellSelectionStyleNone; UIView* elementView = [[UIView alloc] initWithFrame:CGRectMake(20,170,320,280)]; elementView.tag = 0; elementView.backgroundColor=[UIColor clearColor]; [cell.contentView addSubview:elementView]; [elementView release]; } UIView* elementView = [cell.contentView viewWithTag:0]; elementView.backgroundColor=[UIColor clearColor]; for(UIView* subView in elementView.subviews) { [subView removeFromSuperview]; } if(indexPath.section == 8) { UIImage *whiteImg = [UIImage imageNamed:@"white_star.png"] ; UIImage *yellowImg = [UIImage imageNamed:@"yellow_Star.png"] ; UIButton *button1 = [[UIButton alloc]initWithFrame:CGRectMake(159, 15, 25, 20)]; [button1 addTarget:self action:@selector(buttonAction:) forControlEvents:UIControlEventTouchUpInside]; button1.tag = 1; UIButton *button2 = [[UIButton alloc]initWithFrame:CGRectMake(185, 15, 25, 20)]; [button2 addTarget:self action:@selector(buttonAction:) forControlEvents:UIControlEventTouchUpInside]; button2.tag = 2; UIButton *button3 = [[UIButton alloc]initWithFrame:CGRectMake(211, 15, 25, 20)]; [button3 addTarget:self action:@selector(buttonAction:) forControlEvents:UIControlEventTouchUpInside]; button3.tag = 3; UIButton *button4 = [[UIButton alloc]initWithFrame:CGRectMake(237, 15, 25, 20)]; [button4 addTarget:self action:@selector(buttonAction:) forControlEvents:UIControlEventTouchUpInside]; button4.tag = 4; UIButton *button5 = [[UIButton alloc]initWithFrame:CGRectMake(263, 15, 25, 20)]; [button5 addTarget:self action:@selector(buttonAction:) forControlEvents:UIControlEventTouchUpInside]; button5.tag = 5; if(event.eventRatings == 1) { [button1 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button2 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button3 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button4 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button5 setBackgroundImage:whiteImg forState:UIControlStateNormal]; } else if(event.eventRatings == 2) { [button1 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button2 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button3 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button4 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button5 setBackgroundImage:whiteImg forState:UIControlStateNormal]; } else if(event.eventRatings == 3) { [button1 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button2 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button3 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button4 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button5 setBackgroundImage:whiteImg forState:UIControlStateNormal]; } else if(event.eventRatings == 4) { [button1 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button2 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button3 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button4 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button5 setBackgroundImage:whiteImg forState:UIControlStateNormal]; } else if(event.eventRatings == 5) { [button1 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button2 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button3 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button4 setBackgroundImage:yellowImg forState:UIControlStateNormal]; [button5 setBackgroundImage:yellowImg forState:UIControlStateNormal]; } else { [button1 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button2 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button3 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button4 setBackgroundImage:whiteImg forState:UIControlStateNormal]; [button5 setBackgroundImage:whiteImg forState:UIControlStateNormal]; } [elementView addSubview:button1]; [button1 release]; [elementView addSubview:button2]; [button2 release]; [elementView addSubview:button3]; [button3 release]; [elementView addSubview:button4]; [button4 release]; [elementView addSubview:button5]; [button5 release]; if(isRightButton == YES) { button1.enabled = NO; button2.enabled = NO; button3.enabled = NO; button4.enabled = NO; button5.enabled = NO; } else if(isRightButton == NO) { button1.enabled = YES; button2.enabled = YES; button3.enabled = YES; button4.enabled = YES; button5.enabled = YES; } [elementView addSubview:ratingsTitleLabel]; cell.accessoryType = UITableViewCellAccessoryNone; } return cell; } And the action of the button is written as: -(void)buttonAction:(id)sender { rating = [sender tag]; printf("\n Ratig Value inside Button Action~~~~~~~~~~~~~~~~%d",rating); event.eventRatings = rating; [tableView reloadData]; } When I build the application in simlator of 3.1.2 O.S its working fine by displaying the star images. My porblem is when I build it in 3.1.2 O.S Device the images are not displaying.I checked the code for casesensitivity in file name and its gud but Im not gettig the images to display. Guys help me to solve this. Thank you, Monish Kumar.

  Read the article

• Get Oracle Linux Certified at Much Reduced Price

  - by Antoinette O'Sullivan

  You have already heard the great news that you can now prove your knowledge on Oracle Linux 5 and 6 with the new Oracle Certified Associate, Oracle Linux 5 and 6 System Administrator exam. Until December 21th 2013, this exam is in beta phase so you can get a fully-fledged certification at a much reduced price; for example $50 in the United States or 39 euros in the euro zone. Establishing What You Need to Know Your first step is to click on the Exam Topics tab on the certification page. You will see a list of topics that you will be tested on during the certification exam. These are the areas that you need to improve your knowledge on, if you are not already expert. Registering For a Certification Exam On the certification page, click on Register for this Exam. The Pearson VUE site guides you through signing up for an event at a date and location to suit you. Preparing to Take an Exam On the certification page, click on the Exam Preparation tab. This indicates the recommended training that can help you prepare to sit the exam. The recommended training for this certification is the Oracle Linux System Administration course. You can take this very popular 5-day live instructor-led course as a: Live Virtual Event: Take the training from your own desk, no travel required. Choose from a selection of events already on the schedule to suit different timezones. In-Class: Travel to an education center to take this class. Below is a selection of events already on the schedule.  Location  Date  Delivery Language  Brussels, Belgium  18 November 2013  English  London, England  16 December 2013  English   Manchester, England  27 January 2014  English  Reading, England  12 May 2014  English  Milan, Italy  31 March 2014  Italian   Rome, Italy  10 February 2014  Italian  Utrecht, Netherlands  18 November 2013  Dutch Warsaw, Poland   9 December 2013  Polish  Bucharest, Romania  20 January 2014  Romanian  Ankara, Turkey  12 January 2014  Turkish  Istanbul, Turkey  16 December 2013  Turkish  Panjim, India  4 November 2013  English  Jakarta, Indonesia  9 December 2013  English  Kuala Lumpur, Malaysia  25 November 2013  English  Makati City, Philippines  11 November 2013  English  Singapore  25 November 2013  English  Bangkok, Thailand  11 November 2013  English  Casablanca, Morocco  16 December 2013  English  Muscat, Oman  2 March 2014  English  Johannesburg, South Africa  17 February 2014  English  Tunis, Tunisia  31 March 2014  French  Canberra, Australia 25 November 2013   English  Melbourne, Australia  19 May 2014  English  Sydney, Australia  20 January 2014  English  Mississauga, Canada  24 February 2014  English Ottawa, Canada   28 April 2014  English  Belmont, CA, United States  10 February 2014  English  Irvine, CA, United States  12 May 2014  English  San Francisco, CA, United States  18 November 2013  English  Chicago, IL, United States  14 April 2014  English  Cambridge, MA, United States  18 November 2013  English  Roseville, MA, United States  2 December 2013  English  Edison, NJ, United States  10 March 2014  English   Pittsburg, PA, United States  9 December 2013  English   Reston, VA, United States 13 January 2014   English For more information on the Oracle Linux curriculum, go to http://oracle.com/education/linux.

  Read the article

• Easy and Rapid Deployment of Application Workloads with Oracle VM

  - by Antoinette O'Sullivan

  Oracle VM is designed for easy and rapid deployment of application workloads. In addition to allowing for rapid deployment of an entire application stack, Oracle VM now gives administrators more fine-grained control of the application payloads inside the virtual machine. To get started on Oracle VM Server for x86 or Oracle VM Server fo SPARC, what better solution than to take the corresponding training course. You can take this training from your own desk, by choosing from a selection of live-virtual events already on the schedule on the Oracle University Portal. Alternatively, you can travel to an education center to take these courses. Below is a selection of in-class events already on the schedule for each course: Oracle VM Administration: Oracle VM Server for x86  Location  Date  Delivery Language  Paris, France  11 December 2013  French  Rome, Italy  22 April 2014  Italian  Budapest, Hungary  4 November 2013  Hungarian  Riga, Latvia  3 February 2014  Latvian  Oslo, Norway  9 December 2013  English  Warsaw, Poland  12 February 2014  Polish  Ljubjana, Slovenia  25 November 2013 Slovenian   Barcelona, Spain  29 October 2013  Spanish  Istanbul, Turkey  23 December 2013  Turkish  Cairo, Egypt  1 December 2013  Arabic  Johannesburg, South Africa  9 December 2013   English   Melbourne, Australia  12 February 2014  English  Sydney, Australia  25 November 2013   English   Singapore 27 November 2013    English   Montreal, Canada 18 February 2014  English  Ottawa, Canada  18 February 2014  English  Toronto, Canada  18 February 2014  English  Phoenix, AZ, United States  18 February 2014   English   Sacramento, CA, United States 18 February 2014    English   San Francisco, CA, United States 18 February 2014   English  San Jose, CA, United States  18 February 2014  English  Denver, CO, United States 22 January 2014   English  Roseville, MN, United States 10 February 2014    English   Edison, NJ, United States  18 February 2014  English  King of Prussia, PA, United States  18 February 2014  English  Reston, VA, United States  26 March 2014  English Oracle VM Server for SPARC: Installation and Configuration  Location  Date  Delivery Language  Prague, Czech Republic  2 December 2013  Czech  Paris, France  9 December 2013  French  Utrecht, Netherlands  9 December 2013  Dutch  Madrid, Spain  28 November 2013  Spanish  Dubai, United Arab Emirates  5 February 2014  English  Melbourne, Australia  31 October 2013  English  Sydney, Australia  10 February 2014  English  Tokyo, Japan  6 February 2014  Japanese  Petaling Jaya, Malaysia  23 December 2013  English  Auckland, New Zealand  21 November 2013  English  Singapore  7 November 2013  English  Toronto, Canada  25 November 2013  English  Sacramento, CA, United States  2 December 2013  English  San Francisco, CA, United States  2 December 2013  English  San Jose, CA, United States  2 December 2013  English  Caracas, Venezuela 5 November 2013   Spanish

  Read the article

• Speed up SQL Server queries with PREFETCH

  - by Akshay Deep Lamba

  Problem The SAN data volume has a throughput capacity of 400MB/sec; however my query is still running slow and it is waiting on I/O (PAGEIOLATCH_SH). Windows Performance Monitor shows data volume speed of 4MB/sec. Where is the problem and how can I find the problem? Solution This is another summary of a great article published by R. Meyyappan at www.sqlworkshops.com.  In my opinion, this is the first article that highlights and explains with working examples how PREFETCH determines the performance of a Nested Loop join.  First of all, I just want to recall that Prefetch is a mechanism with which SQL Server can fire up many I/O requests in parallel for a Nested Loop join. When SQL Server executes a Nested Loop join, it may or may not enable Prefetch accordingly to the number of rows in the outer table. If the number of rows in the outer table is greater than 25 then SQL will enable and use Prefetch to speed up query performance, but it will not if it is less than 25 rows. In this section we are going to see different scenarios where prefetch is automatically enabled or disabled. These examples only use two tables RegionalOrder and Orders.  If you want to create the sample tables and sample data, please visit this site www.sqlworkshops.com. The breakdown of the data in the RegionalOrders table is shown below and the Orders table contains about 6 million rows. In this first example, I am creating a stored procedure against two tables and then execute the stored procedure.  Before running the stored proceudre, I am going to include the actual execution plan. --Example provided by www.sqlworkshops.com --Create procedure that pulls orders based on City --Do not forget to include the actual execution plan CREATE PROC RegionalOrdersProc @City CHAR(20) AS BEGIN DECLARE @OrderID INT, @OrderDetails CHAR(200) SELECT @OrderID = o.OrderID, @OrderDetails = o.OrderDetails       FROM RegionalOrders ao INNER JOIN Orders o ON (o.OrderID = ao.OrderID)       WHERE City = @City END GO SET STATISTICS time ON GO --Example provided by www.sqlworkshops.com --Execute the procedure with parameter SmallCity1 EXEC RegionalOrdersProc 'SmallCity1' GO After running the stored procedure, if we right click on the Clustered Index Scan and click Properties we can see the Estimated Numbers of Rows is 24.    If we right click on Nested Loops and click Properties we do not see Prefetch, because it is disabled. This behavior was expected, because the number of rows containing the value ‘SmallCity1’ in the outer table is less than 25.   Now, if I run the same procedure with parameter ‘BigCity’ will Prefetch be enabled? --Example provided by www.sqlworkshops.com --Execute the procedure with parameter BigCity --We are using cached plan EXEC RegionalOrdersProc 'BigCity' GO As we can see from the below screenshot, prefetch is not enabled and the query takes around 7 seconds to execute. This is because the query used the cached plan from ‘SmallCity1’ that had prefetch disabled. Please note that even if we have 999 rows for ‘BigCity’ the Estimated Numbers of Rows is still 24.   Finally, let’s clear the procedure cache to trigger a new optimization and execute the procedure again. DBCC freeproccache GO EXEC RegionalOrdersProc 'BigCity' GO This time, our procedure runs under a second, Prefetch is enabled and the Estimated Number of Rows is 999.   The RegionalOrdersProc can be optimized by using the below example where we are using an optimizer hint. I have also shown some other hints that could be used as well. --Example provided by www.sqlworkshops.com --You can fix the issue by using any of the following --hints --Create procedure that pulls orders based on City DROP PROC RegionalOrdersProc GO CREATE PROC RegionalOrdersProc @City CHAR(20) AS BEGIN DECLARE @OrderID INT, @OrderDetails CHAR(200) SELECT @OrderID = o.OrderID, @OrderDetails = o.OrderDetails       FROM RegionalOrders ao INNER JOIN Orders o ON (o.OrderID = ao.OrderID)       WHERE City = @City       --Hinting optimizer to use SmallCity2 for estimation       OPTION (optimize FOR (@City = 'SmallCity2'))       --Hinting optimizer to estimate for the currnet parameters       --option (recompile)       --Hinting optimize not to use histogram rather       --density for estimation (average of all 3 cities)       --option (optimize for (@City UNKNOWN))       --option (optimize for UNKNOWN) END GO Conclusion, this tip was mainly aimed at illustrating how Prefetch can speed up query execution and how the different number of rows can trigger this.

  Read the article

• The enterprise vendor con - connecting SSD's using SATA 2 (3Gbits) thus limiting there performance

  - by tonyrogerson

  When comparing SSD against Hard drive performance it really makes me cross when folk think comparing an array of SSD running on 3GBits/sec to hard drives running on 6GBits/second is somehow valid. In a paper from DELL (http://www.dell.com/downloads/global/products/pvaul/en/PowerEdge-PowerVaultH800-CacheCade-final.pdf) on increasing database performance using the DELL PERC H800 with Solid State Drives they compare four SSD drives connected at 3Gbits/sec against ten 10Krpm drives connected at 6Gbits [Tony slaps forehead while shouting DOH!]. It is true in the case of hard drives it probably doesn’t make much difference 3Gbit or 6Gbit because SAS and SATA are both end to end protocols rather than shared bus architecture like SCSI, so the hard drive doesn’t share bandwidth and probably can’t get near the 600MiBytes/second throughput that 6Gbit gives unless you are doing contiguous reads, in my own tests on a single 15Krpm SAS disk using IOMeter (8 worker threads, queue depth of 16 with a stripe size of 64KiB, an 8KiB transfer size on a drive formatted with an allocation size of 8KiB for a 100% sequential read test) I only get 347MiBytes per second sustained throughput at an average latency of 2.87ms per IO equating to 44.5K IOps, ok, if that was 3GBits it would be less – around 280MiBytes per second, oh, but wait a minute [...fingers tap desk] You’ll struggle to find in the commodity space an SSD that doesn’t have the SATA 3 (6GBits) interface, SSD’s are fast not only low latency and high IOps but they also offer a very large sustained transfer rate, consider the OCZ Agility 3 it so happens that in my masters dissertation I did the same test but on a difference box, I got 374MiBytes per second at an average latency of 2.67ms per IO equating to 47.9K IOps – cost of an 240GB Agility 3 is £174.24 (http://www.scan.co.uk/products/240gb-ocz-agility-3-ssd-25-sata-6gb-s-sandforce-2281-read-525mb-s-write-500mb-s-85k-iops), but that same drive set in a box connected with SATA 2 (3Gbits) would only yield around 280MiBytes per second thus losing almost 100MiBytes per second throughput and a ton of IOps too. So why the hell are “enterprise” vendors still only connecting SSD’s at 3GBits? Well, my conspiracy states that they have no interest in you moving to SSD because they’ll lose so much money, the argument that they use SATA 2 doesn’t wash, SATA 3 has been out for some time now and all the commodity stuff you buy uses it now. Consider the cost, not in terms of price per GB but price per IOps, SSD absolutely thrash Hard Drives on that, it was true that the opposite was also true that Hard Drives thrashed SSD’s on price per GB, but is that true now, I’m not so sure – a 300GByte 2.5” 15Krpm SAS drive costs £329.76 ex VAT (http://www.scan.co.uk/products/300gb-seagate-st9300653ss-savvio-15k3-25-hdd-sas-6gb-s-15000rpm-64mb-cache-27ms) which equates to £1.09 per GB compared to a 480GB OCZ Agility 3 costing £422.10 ex VAT (http://www.scan.co.uk/products/480gb-ocz-agility-3-ssd-25-sata-6gb-s-sandforce-2281-read-525mb-s-write-410mb-s-30k-iops) which equates to £0.88 per GB. Ok, I compared an “enterprise” hard drive with a “commodity” SSD, ok, so things get a little more complicated here, most “enterprise” SSD’s are SLC and most commodity are MLC, SLC gives more performance and wear, I’ll talk about that another day. For now though, don’t get sucked in by vendor marketing, SATA 2 (3Gbit) just doesn’t cut it, SSD need 6Gbit to breath and even that SSD’s are pushing. Alas, SSD’s are connected using SATA so all the controllers I’ve seen thus far from HP and DELL only do SATA 2 – deliberate? Well, I’ll let you decide on that one.

  Read the article

• hall.dll errors

  - by Robert Elliott

  I am getting frequent BSoDs, mostly with hall.dll errors. I have Dell Inspiron laptop running Windows 7 SP1. The following file, werfault, is shown below. Can anyone help me work out what is wrong? Version=1 EventType=BlueScreen EventTime=129987824768810026 ReportType=4 Consent=1 ReportIdentifier=1c3e1c58-3b30-11e2-9074-002219f61870 IntegratorReportIdentifier=113012-32557-01 Response.type=4 DynamicSig[1].Name=OS Version DynamicSig[1].Value=6.1.7601.2.1.0.768.3 DynamicSig[2].Name=Locale ID DynamicSig[2].Value=2057 UI[2]=C:\Windows\system32\wer.dll UI[3]=Windows has recovered from an unexpected shutdown UI[4]=Windows can check online for a solution to the problem. UI[5]=&Check for solution UI[6]=&Check later UI[7]=Cancel UI[8]=Windows has recovered from an unexpected shutdown UI[9]=A problem caused Windows to stop working correctly. Windows will notify you if a solution is available. UI[10]=Close Sec[0].Key=BCCode Sec[0].Value=a Sec[1].Key=BCP1 Sec[1].Value=0000000000000000 Sec[2].Key=BCP2 Sec[2].Value=0000000000000002 Sec[3].Key=BCP3 Sec[3].Value=0000000000000000 Sec[4].Key=BCP4 Sec[4].Value=FFFFF80002C0E477 Sec[5].Key=OS Version Sec[5].Value=6_1_7601 Sec[6].Key=Service Pack Sec[6].Value=1_0 Sec[7].Key=Product Sec[7].Value=768_1 File[0].CabName=113012-32557-01.dmp File[0].Path=113012-32557-01.dmp File[0].Flags=589826 File[0].Type=2 File[0].Original.Path=C:\Windows\Minidump\113012-32557-01.dmp File[1].CabName=sysdata.xml File[1].Path=WER-75941-0.sysdata.xml File[1].Flags=589826 File[1].Type=5 File[1].Original.Path=C:\Users\Robert\AppData\Local\Temp\WER-75941-0.sysdata.xml File[2].CabName=Report.cab File[2].Path=Report.cab File[2].Flags=196608 File[2].Type=7 File[2].Original.Path=Report.cab FriendlyEventName=Shut down unexpectedly ConsentKey=BlueScreen AppName=Windows AppPath=C:\Windows\System32\WerFault.exe *********From the minidump file**** RAX = fffff88002f22150 RBX = fffffa80074141f0 RCX = 000000000000000a RDX = 0000000000000000 RSI = fffffa8007278180 RDI = 0000000000000001 R9 = 0000000000000000 R10 = fffff80002c0e477 R11 = 0000000000000000 R12 = fffffa800523e7a0 R13 = 0000000000001000 R14 = 0000000000000028 R15 = fffffa80074141f0 RBP = fffff88002f22210 RIP = fffff80002cd3fc0 RSP = fffff88002f22048 SS = 0000 GS = 002b FS = 0053 ES = 002b DS = 002b CS = 0010 Flags = 00200286 fffff800`02e99ac0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99ad0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99ae0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99af0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b10 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b20 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b30 00 00 00 00 00 00 00 00 00 00 00 00 04 00 00 00 ................ fffff800`02e99b40 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e99b50 00 00 00 00 00 00 00 00 00 00 00 00 ............ fffff800`02e81928 00 00 00 00 .... fffff800`02e81924 00 00 00 00 .... fffff800`02e0a880 37 36 30 31 2E 31 37 39 34 34 2E 61 6D 64 36 34 7601.17944.amd64 fffff800`02e0a890 66 72 65 2E 77 69 6E 37 73 70 31 5F 67 64 72 2E fre.win7sp1_gdr. fffff800`02e0a8a0 31 32 30 38 33 30 2D 30 33 33 33 00 00 00 00 00 120830-0333..... fffff800`02e0a8b0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8c0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8d0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8e0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a8f0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a900 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a910 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a920 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a930 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a940 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a950 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 ................ fffff800`02e0a960 35 36 65 38 62 61 31 33 2D 37 30 32 39 2D 34 37 56e8ba13-7029-47 fffff800`02e0a970 32 38 2D 61 35 30 36 2D 32 64 64 62 34 61 30 63 28-a506-2ddb4a0c fffff800`02c0e000 C5 0F 85 79 02 00 00 8B 9C 24 90 00 00 00 E9 A5 ...y.....$...... fffff800`02c0e010 00 00 00 44 2B C3 45 33 C9 E8 5E 14 00 00 49 3B ...D+.E3..^...I; fffff800`02c0e020 C5 74 2B 44 8B 8C 24 90 00 00 00 48 8B C8 41 8D .t+D..$....H..A. fffff800`02c0e030 51 FF 41 3B D5 76 0D 44 8B C2 49 83 E8 01 48 8B Q.A;.v.D..I...H. fffff800`02c0e040 49 08 75 F6 48 89 79 08 41 03 D9 48 8B F8 3B DD I.u.H.y.A..H..;. fffff800`02c0e050 75 08 48 8B C7 E9 26 02 00 00 48 8B 96 98 00 00 u.H...&...H..... fffff800`02c0e060 00 48 8D 84 24 90 00 00 00 44 8B C5 48 89 44 24 .H..$....D..H.D$ fffff800`02c0e070 28 44 2B C3 45 33 C9 48 8B CE 44 88 6C 24 20 E8 (D+.E3.H..D.l$ . fffff800`02c0e080 CC 14 00 00 49 3B C5 74 2B 44 8B 8C 24 90 00 00 ....I;.t+D..$... fffff800`02c0e090 00 48 8B C8 41 8D 51 FF 41 3B D5 76 0D 44 8B C2 .H..A.Q.A;.v.D.. fffff800`02c0e0a0 49 83 E8 01 48 8B 49 08 75 F6 48 89 79 08 41 03 I...H.I.u.H.y.A. fffff800`02c0e0b0 D9 48 8B F8 3B DD 74 9A 44 38 AE 28 01 00 00 0F .H..;.t.D8.(.... fffff800`02c0e0c0 85 DF 00 00 00 48 8D 44 24 30 4C 8D 8C 24 A0 00 .....H.D$0L..$.. fffff800`02c0e0d0 00 00 4C 8D 84 24 A8 00 00 00 8B D5 48 8B CE 48 ..L..$......H..H fffff800`02c0e0e0 89 44 24 20 E8 F7 1F 00 00 8B F8 89 84 24 90 00 .D$ .........$.. fffff800`02c0e0f0 00 00 41 3B C5 0F 84 83 01 00 00 4C 8B A4 24 A8 ..A;.......L..$. fffff800`02c0e100 00 00 00 44 8B 84 24 A0 00 00 00 48 8B 8E 98 00 ...D..$....H.... fffff800`02c0e110 00 00 49 8B D4 44 8B C8 E8 DB 1B 00 00 49 3B C5 ..I..D.......I;. fffff800`02c0e120 74 35 48 8B 96 98 00 00 00 48 8D 84 24 90 00 00 t5H......H..$... fffff800`02c0e130 00 41 B1 01 48 89 44 24 28 44 8B C5 48 8B CE 44 .A..H.D$(D..H..D fffff800`02c0e140 88 6C 24 20 E8 43 12 00 00 49 3B C5 0F 84 2C 01 .l$ .C...I;...,. fffff800`02c0e150 00 00 E9 29 01 00 00 48 8B 5C 24 30 49 3B DD 74 ...)...H.\$0I;.t fffff800`02c0e160 2A 4D 3B E5 74 0C 48 8B D3 49 8B CC FF 15 AE CE *M;.t.H..I...... fffff800`02c0e170 01 00 48 8B CB FF 15 95 CF 01 00 33 D2 48 8B CB ..H........3.H.. fffff800`02c0e180 FF 15 AA CE 01 00 E9 F3 00 00 00 C1 E7 0C 41 B8 ..............A. fffff800`02c0e190 01 00 00 00 49 8B CC 8B D7 FF 15 99 CE 01 00 E9 ....I........... fffff800`02c0e1a0 DA 00 00 00 2B EB 33 C9 41 B8 48 61 6C 20 8B D5 ....+.3.A.Hal .. fffff800`02c0e1b0 44 8B FD 48 C1 E2 03 FF 15 33 D4 01 00 4C 8B F0 D..H.....3...L.. fffff800`02c0e1c0 49 3B C5 0F 84 8F 00 00 00 45 8B E5 41 3B ED 76 I;.......E..A;.v fffff800`02c0e1d0 3F 4C 8B E8 BA 00 10 00 00 B9 04 00 00 00 41 B8 ?L............A. fffff800`02c0e1e0 48 61 6C 20 FF 15 06 D4 01 00 49 89 45 00 48 85 Hal ......I.E.H. fffff800`02c0e1f0 C0 74 39 48 8B C8 FF 15 BC CE 01 00 48 C1 E8 20 .t9H........H.. fffff800`02c0e200 85 C0 75 28 41 FF C4 49 83 C5 08 44 3B E5 72 C4 ..u(A..I...D;.r. fffff800`02c0e210 48 8B 8E 98 00 00 00 44 8B C5 BA 01 00 00 00 E8 H......D........ fffff800`02c0e220 58 19 00 00 4C 8B E8 48 85 C0 75 6C 45 33 ED 45 X...L..H..ulE3.E fffff800`02c0e230 3B E5 76 19 49 8B EE 48 8B 4D 00 33 D2 FF 15 ED ;.v.I..H.M.3.... fffff800`02c0e240 CD 01 00 48 83 C5 08 49 83 EC 01 75 EA 33 D2 49 ...H...I...u.3.I fffff800`02c0e250 8B CE FF 15 D8 CD 01 00 41 3B DD 76 21 8B EB 48 ........A;.v!..H fffff800`02c0e260 8B 96 98 00 00 00 48 8B 5F 08 4C 8B C7 48 8B CE ......H._.L..H.. fffff800`02c0e270 E8 2B 15 00 00 48 83 ED 01 48 8B FB 75 E1 33 C0 .+...H...H..u.3. fffff800`02c0e280 48 8B 9C 24 98 00 00 00 48 83 C4 50 41 5F 41 5E H..$....H..PA_A^ fffff800`02c0e290 41 5D 41 5C 5F 5E 5D C3 8D 4D FF 85 C9 74 0C 8B A]A\_^]..M...t.. fffff800`02c0e2a0 D1 48 83 EA 01 48 8B 40 08 75 F6 48 89 78 08 49 [email protected] fffff800`02c0e2b0 8B FD 85 ED 74 29 49 8B DE 48 8B 0B FF 15 F6 CD ....t)I..H...... fffff800`02c0e2c0 01 00 41 89 45 00 48 8B 03 48 83 C3 08 48 83 C8 ..A.E.H..H...H.. fffff800`02c0e2d0 0F 49 83 EF 01 49 89 45 10 4D 8B 6D 08 75 DA 48 .I...I.E.M.m.u.H fffff800`02c0e2e0 8B 8E 98 00 00 00 48 8D 54 24 38 48 83 C1 78 FF ......H.T$8H..x. fffff800`02c0e2f0 15 83 CD 01 00 4C 8B 9E 98 00 00 00 48 8D 4C 24 .....L......H.L$ fffff800`02c0e300 38 41 01 AB D0 00 00 00 FF 15 3A CD 01 00 33 D2 8A........:...3. fffff800`02c0e310 49 8B CE FF 15 17 CD 01 00 E9 34 FD FF FF 90 90 I.........4..... fffff800`02c0e320 90 90 90 90 45 85 C0 74 43 48 89 5C 24 08 48 89 ....E..tCH.\$.H. fffff800`02c0e330 74 24 10 57 48 83 EC 20 48 8B F1 41 8B F8 48 8B t$.WH.. H..A..H. fffff800`02c0e340 5A 08 4C 8B C2 48 8B 96 98 00 00 00 48 8B CE E8 Z.L..H......H... fffff800`02c0e350 4C 14 00 00 48 83 EF 01 48 8B D3 75 E1 48 8B 5C L...H...H..u.H.\ fffff800`02c0e360 24 30 48 8B 74 24 38 48 83 C4 20 5F C3 90 90 90 $0H.t$8H.. _.... fffff800`02c0e370 90 90 90 90 48 8B C4 48 89 58 08 48 89 68 10 48 ....H..H.X.H.h.H fffff800`02c0e380 89 70 18 48 89 78 20 41 54 41 55 4C 8B D9 4D 8B .p.H.x ATAUL..M. fffff800`02c0e390 E0 48 8B F2 B9 FF 0F 00 00 4D 85 DB 75 08 4C 8B .H.......M..u.L. fffff800`02c0e3a0 D1 40 32 FF EB 12 4D 8B 93 88 00 00 00 41 8A BB [email protected].. fffff800`02c0e3b0 91 00 00 00 49 C1 EA 0C 44 8B 44 24 38 41 8B C1 ....I...D.D$8A.. fffff800`02c0e3c0 4C 2B 4E 20 23 C1 49 C1 E9 0C 41 BD 00 10 00 00 L+N #.I...A..... fffff800`02c0e3d0 41 8B D5 41 8B E9 2B D0 8B CA 4C 39 54 EE 30 76 A..A..+...L9T.0v fffff800`02c0e3e0 04 33 C9 EB 4F 41 3B D0 73 43 4C 8D 4C EE 38 4D .3..OA;.sCL.L.8M fffff800`02c0e3f0 39 11 77 39 49 8B 59 F8 48 8D 43 01 49 3B 01 75 9.w9I.Y.H.C.I;.u fffff800`02c0e400 2C 48 8B C3 49 33 01 48 A9 00 00 F0 FF 75 1E 40 ,H..I3.H.....u.@ fffff800`02c0e410 80 FF 01 74 0C 49 33 19 48 F7 C3 F0 FF FF FF 75 ...t.I3.H......u fffff800`02c0e420 0C 41 03 CD 49 83 C1 08 41 3B C8 72 C2 41 3B C8 .A..I...A;.r.A;. fffff800`02c0e430 41 0F 47 C8 4D 85 DB 0F 84 92 00 00 00 41 80 BB A.G.M........A.. fffff800`02c0e440 28 01 00 00 00 0F 84 84 00 00 00 4C 39 54 EE 30 (..........L9T.0 fffff800`02c0e450 76 7D 8B CA 48 8D 44 EE 38 41 3B D0 73 11 4C 39 v}..H.D.8A;.s.L9 fffff800`02c0e460 10 76 0C 41 03 CD 48 83 C0 08 41 3B C8 72 EF 49 .v.A..H...A;.r.I fffff800`02c0e470 8B 44 24 18 41 3B C8 44 8B 08 4C 8B 50 08 41 0F .D$.A;.D..L.P.A. fffff800`02c0e480 47 C8 41 C1 E9 0C EB 3A 45 8B 02 41 8D 41 01 41 G.A....:E..A.A.A fffff800`02c0e490 C1 E8 0C 44 3B C0 75 2E 41 8B C0 41 33 C1 A9 00 ...D;.u.A..A3... fffff800`02c0e4a0 00 F0 FF 75 21 40 80 FF 01 74 0D 41 8B C0 41 33 [email protected] fffff800`02c0e4b0 C1 A9 F0 FF FF FF 75 0E 4D 8B 52 08 45 8B C8 41 ......u.M.R.E..A fffff800`02c0e4c0 03 D5 3B D1 72 C2 3B D1 0F 47 D1 8B C2 EB 02 8B ..;.r.;..G...... fffff800`02c0e4d0 C1 48 8B 5C 24 18 48 8B 6C 24 20 48 8B 74 24 28 .H.\$.H.l$ H.t$( fffff800`02c0e4e0 48 8B 7C 24 30 41 5D 41 5C C3 90 90 90 90 90 90 H.|$0A]A\....... fffff800`02c0e4f0 48 89 5C 24 08 48 89 6C 24 10 48 89 74 24 18 57 H.\$.H.l$.H.t$.W fffff800`02c0e500 41 54 41 55 48 83 EC 30 48 8B 5C 24 70 4D 8B E1 ATAUH..0H.\$pM.. fffff800`02c0e510 49 8B F0 8B 03 4C 8B EA 48 8B E9 89 44 24 20 E8 I....L..H...D$ . fffff800`02c0e520 50 FE FF FF 49 8B CC 89 03 49 2B 4D 20 8B F8 48 P...I....I+M ..H fffff800`02c0e530 C1 E9 0C 8B C9 49 8B 54 CD 30 49 8B CC 48 C1 E2 .....I.T.0I..H.. fffff800`02c0e540 0C 81 E1 FF 0F 00 00 48 03 D1 48 85 F6 74 72 48 .......H..H..trH fffff800`02c0e550 39 95 88 00 00 00 73 69 4C 8B 4E 18 48 8B 84 24 9.....siL.N.H..$ fffff800`02c0e560 80 00 00 00 41 8B DC 41 8B 09 81 E3 FF 0F 00 00 ....A..A........ fffff800`02c0e570 03 CB 80 7C 24 78 01 48 89 08 75 17 4D 8B C4 49 ...|$x.H..u.M..I fffff800`02c0e580 8B D5 48 8B CD C6 44 24 28 01 89 7C 24 20 E8 C5 ..H...D$(..|$ .. fffff800`02c0e590 06 00 00 8B C7 C1 EF 0C 25 FF 0F 00 00 8D 8C 18 ........%....... fffff800`02c0e5a0 FF 0F 00 00 48 8B 46 18 C1 E9 0C 03 CF 74 0C 8B ....H.F......t.. fffff800`02c0e5b0 D1 48 83 EA 01 48 8B 40 08 75 F6 48 89 46 18 EB [email protected].. fffff800`02c0e5c0 0B 48 8B 84 24 80 00 00 00 48 89 10 48 8B 5C 24 .H..$....H..H.\$ fffff800`02c0e5d0 50 48 8B 6C 24 58 48 8B 74 24 60 48 83 C4 30 41 PH.l$XH.t$`H..0A fffff800`02c0e5e0 5D 41 5C 5F C3 90 90 90 90 90 90 90 4D 85 C0 0F ]A\_........M... fffff800`02c0e5f0 84 09 01 00 00 48 8B C4 48 89 58 08 48 89 68 10 .....H..H.X.H.h. fffff800`02c0e600 48 89 70 18 48 89 78 20 41 54 41 55 41 56 48 83 H.p.H.x ATAUAVH. fffff800`02c0e610 EC 30 44 8A 64 24 78 49 8B D8 49 8B F1 4C 8B EA .0D.d$xI..I..L.. fffff800`02c0e620 4C 8B F1 49 89 58 18 41 80 FC 01 0F 84 AF 00 00 L..I.X.A........ fffff800`02c0e630 00 8B 7C 24 70 85 FF 0F 84 9F 00 00 00 4C 8B CE ..|$p........L.. fffff800`02c0e640 4C 8B C3 49 8B D5 49 8B CE 89 7C 24 20 E8 22 FD L..I..I...|$ .". fffff800`02c0e650 FF FF 48 8B CE 49 2B 4D 20 8B E8 48 C1 E9 0C 8B ..H..I+M ..H.... fffff800`02c0e660 C9 49 8B 54 CD 30 48 8B CE 48 C1 E2 0C 81 E1 FF .I.T.0H..H...... fffff800`02c0e670 0F 00 00 48 03 D1 49 39 96 88 00 00 00 73 52 4C ...H..I9.....sRL fffff800`02c0e680 8B 4B 18 4C 8B C6 49 8B D5 49 8B CE 44 88 64 24 .K.L..I..I..D.d$ fffff800`02c0e690 28 89 6C 24 20 E8 BE 05 00 00 8B C5 44 8B DE 25 (.l$ .......D..% fffff800`02c0e6a0 FF 0F 00 00 41 81 E3 FF 0F 00 00 41 8D 8C 03 FF ....A......A.... fffff800`02c0e6b0 0F 00 00 8B C5 C1 E8 0C C1 E9 0C 03 C8 48 8B 43 .............H.C fffff800`02c0e6c0 18 74 0A 48 83 E9 01 48 8B 40 08 75 F6 48 89 43 [email protected] fffff800`02c0e6d0 18 48 03 F5 2B FD 0F 85 61 FF FF FF 48 89 5B 18 .H..+...a...H.[. fffff800`02c0e6e0 48 8B 5C 24 50 48 8B 6C 24 58 48 8B 74 24 60 48 H.\$PH.l$XH.t$`H fffff800`02c0e6f0 8B 7C 24 68 48 83 C4 30 41 5E 41 5D 41 5C C3 90 .|$hH..0A^A]A\.. fffff800`02c0e700 90 90 90 90 90 90 90 90 48 89 54 24 10 53 55 56 ........H.T$.SUV fffff800`02c0e710 57 41 54 41 55 41 56 41 57 48 83 EC 58 48 8B F2 WATAUAVAWH..XH.. fffff800`02c0e720 48 8B D9 48 8D 54 24 30 48 8D 0D B9 67 02 00 45 H..H.T$0H...g..E fffff800`02c0e730 8B E1 49 8B F8 4C 89 84 24 B0 00 00 00 FF 15 35 ..I..L..$......5 fffff800`02c0e740 C9 01 00 4C 8B 2D 86 67 02 00 4C 8B 35 77 67 02 ...L.-.g..L.5wg. fffff800`02c0e750 00 48 8B C6 44 8B C6 48 2B 43 20 41 81 E0 FF 0F .H..D..H+C A.... fffff800`02c0e760 00 00 BD 00 10 00 00 48 C1 E8 0C 45 89 45 2C 8B .......H...E.E,. fffff800`02c0e770 CD 8B C0 41 2B C8 41 89 4D 28 4C 8D 4C C3 30 48 ...A+.A.M(L.L.0H fffff800`02c0e780 8B C6 48 25 00 F0 FF FF 49 89 45 20 49 89 46 20 ..H%....I.E I.F fffff800`02c0e790 45 89 46 2C 41 89 4E 28 44 89 84 24 B8 00 00 00 E.F,A.N(D..$.... fffff800`02c0e7a0 4C 89 8C 24 A0 00 00 00 45 85 E4 0F 84 90 01 00 L..$....E....... fffff800`02c0e7b0 00 48 8B 5F 10 48 81 E3 00 F0 FF FF 75 3C 8B 07 .H._.H......u<.. fffff800`02c0e7c0 48 8B 0D 49 67 02 00 44 8D 4B 01 48 C1 E8 0C 4D H..Ig..D.K.H...M fffff800`02c0e7d0 8B C6 BA 48 61 6C 20 49 89 46 30 FF 15 DF C8 01 ...Hal I.F0..... fffff800`02c0e7e0 00 48 8B D8 48 85 C0 0F 84 36 01 00 00 4C 8B 8C .H..H....6...L.. fffff800`02c0e7f0 24 A0 00 00 00 41 B7 01 EB 09 41 8B C0 48 03 D8 $....A....A..H.. fffff800`02c0e800 45 32 FF 49 8B 01 33 FF 49 89 45 30 48 8B 0D C5 E2.I..3.I.E0H... fffff800`02c0e810 66 02 00 44 8B CF 4D 8B C5 BA 48 61 6C 20 FF 15 f..D..M...Hal .. fffff800`02c0e820 9C C8 01 00 48 8B F0 48 85 C0 75 24 FF C7 83 FF ....H..H..u$.... fffff800`02c0e830 06 7C D9 48 21 44 24 20 45 33 C9 41 B8 01 EF 00 .|.H!D$ E3.A.... fffff800`02c0e840 00 48 8B D5 B9 AC 00 00 00 FF 15 A1 CA 01 00 CC .H.............. fffff800`02c0e850 8B FD 2B BC 24 B8 00 00 00 44 3B E7 41 0F 42 FC ..+.$....D;.A.B. fffff800`02c0e860 80 BC 24 C0 00 00 00 01 8B EF 44 8B C7 75 0E 48 ..$.......D..u.H fffff800`02c0e870 8B D0 48 8B CB FF 15 AD 33 02 00 EB 0B 48 8B D3 ..H.....3....H.. fffff800`02c0e880 48 8B C8 E8 C8 A6 01 00 4D 8B C5 BA 48 61 6C 20 H.......M...Hal fffff800`02c0e890 48 8B CE FF 15 47 C8 01 00 41 80 FF 01 75 11 4D H....G...A...u.M fffff800`02c0e8a0 8B C6 BA 48 61 6C 20 48 8B CB FF 15 30 C8 01 00 ...Hal H....0... fffff800`02c0e8b0 48 8B 84 24 A8 00 00 00 4C 8B 8C 24 A0 00 00 00 H..$....L..$.... fffff800`02c0e8c0 44 2B E7 48 8B BC 24 B0 00 00 00 48 03 C5 BD 00 D+.H..$....H.... fffff800`02c0e8d0 10 00 00 48 8B 7F 08 49 83 C1 08 45 33 C0 44 3B ...H..I...E3.D; fffff800`02c0e8e0 E5 48 8B C8 41 8B D4 0F 47 D5 48 81 E1 00 F0 FF .H..A...G.H..... fffff800`02c0e8f0 FF 48 89 84 24 A8 00 00 00 49 89 4D 20 41 89 55 .H..$....I.M A.U fffff800`02c0e900 28 25 FF 0F 00 00 41 89 45 2C 49 89 4E 20 41 89 (%....A.E,I.N A. fffff800`02c0e910 46 2C 41 89 56 28 48 89 BC 24 B0 00 00 00 E9 75 F,A.V(H..$.....u fffff800`02c0e920 FE FF FF 48 83 64 24 20 00 45 33 C9 41 B8 00 EF ...H.d$ .E3.A... fffff800`02c0e930 00 00 48 8B D5 B9 AC 00 00 00 FF 15 B0 C9 01 00 ..H............. fffff800`02c0e940 CC 48 8D 4C 24 30 FF 15 FC C6 01 00 48 83 C4 58 .H.L$0......H..X fffff800`02c0e950 41 5F 41 5E 41 5D 41 5C 5F 5E 5D 5B C3 90 90 90 A_A^A]A\_^][.... fffff800`02c0e960 90 90 90 90 48 89 5C 24 08 48 89 6C 24 10 48 89 ....H.\$.H.l$.H. fffff800`02c0e970 74 24 18 57 41 54 41 55 48 83 EC 50 33 C0 49 8B t$.WATAUH..P3.I. fffff800`02c0e980 F9 41 8B F0 4C 8B E2 48 8B CA 49 C7 C3 00 F0 FF .A..L..H..I..... fffff800`02c0e990 FF 45 85 C0 74 10 4C 85 59 10 74 0A 48 8B 49 08 .E..t.L.Y.t.H.I. fffff800`02c0e9a0 FF C0 3B C6 72 F0 3B C6 75 09 49 83 21 00 E9 FB ..;.r.;.u.I.!... fffff800`02c0e9b0 00 00 00 65 48 8B 04 25 20 00 00 00 33 C9 44 8B ...eH..% ...3.D. fffff800`02c0e9c0 50 24 48 8B 05 F7 64 02 00 4A 8B 2C D0 4C 8D 4D P$H...d..J.,.L.M fffff800`02c0e9d0 30 45 85 C0 74 22 4C 8B C6 4C 85 5A 10 75 0F 8B 0E..t"L..L.Z.u.. fffff800`02c0e9e0 02 FF C1 48 C1 E8 0C 49 89 01 49 83 C1 08 49 83 ...H...I..I...I. fffff800`02c0e9f0 E8 01 48 8B 52 08 75 E1 33 DB C1 E1 0C 41 B5 01 ..H.R.u.3....A.. fffff800`02c0ea00 48 21 5D 20 21 5D 2C 89 4D 28 44 38 2D 07 65 02 H!] !],.M(D8-.e. fffff800`02c0ea10 00 75 10 48 8B 05 C6 64 02 00 4A 8B 1C D0 E9 29 .u.H...d..J....) fffff800`02c0ea20 01 00 00 48 8D 0D D6 64 02 00 FF 15 50 C6 01 00 ...H...d....P... fffff800`02c0ea30 48 85 C0 0F 85 F9 00 00 00 44 8D 40 01 45 33 C9 [email protected]. fffff800`02c0ea40 33 D2 48 8B CD C7 44 24 28 20 00 00 00 21 5C 24 3.H...D$( ...!\$ fffff800`02c0ea50 20 FF 15 71 C6 01 00 4C 8B D8 48 85 C0 74 69 45 ..q...L..H..tiE fffff800`02c0ea60 32 ED 49 8B D3 85 F6 74 36 48 8B CE 49 F7 44 24 2.I....t6H..I.D$ fffff800`02c0ea70 10 00 F0 FF FF 75 1D 41 8B 44 24 10 25 EF 0F 00 .....u.A.D$.%... fffff800`02c0ea80 00 48 0B C2 48 83 C8 10 48 81 C2 00 10 00 00 49 .H..H...H......I fffff800`02c0ea90 89 44 24 10 48 83 E9 01 4D 8B 64 24 08 75 CD 48 .D$.H...M.d$.u.H fffff800`02c0eaa0 89 2F 4C 89 5F 08 48 89 5F 10 44 88 6F 30 4C 8D ./L._.H._.D.o0L. fffff800`02c0eab0 5C 24 50 49 8B 5B 20 49 8B 6B 28 49 8B 73 30 49 \$PI.[ I.k(I.s0I fffff800`02c0eac0 8B E3 41 5D 41 5C 5F C3 48 8D 54 24 30 48 8D 0D ..A]A\_.H.T$0H.. fffff800`02c0ead0 4C 64 02 00 FF 15 66 C5 01 00 48 8B 15 FF 63 02 Ld....f...H...c. fffff800`02c0eae0 00 44 8B 0D 10 64 02 00 48 8B 02 B9 01 00 00 00 .D...d..H....... fffff800`02c0eaf0 44 8B 40 18 44 3B C9 76 1E 48 83 C2 08 48 8B 02 [email protected];.v.H...H.. fffff800`02c0eb00 44 39 40 18 7D 06 44 8B 40 18 8B D9 FF C1 48 83 D9@.}[email protected]. fffff800`02c0eb10 C2 08 41 3B C9 72 E6 48 8D 4C 24 30 FF 15 0E C6 ..A;.r.H.L$0.... fffff800`02c0eb20 01 00 48 8B 05 B7 63 02 00 44 8B DB 4A 8B 1C D8 ..H...c..D..J... fffff800`02c0eb30 EB 07 83 60 1C 00 48 8B D8 F0 83 43 18 01 48 8D ...`..H....C..H. fffff800`02c0eb40 57 18 48 8D 4B 20 FF 15 F4 C4 01 00 48 8B 4B 10 W.H.K ......H.K. fffff800`02c0eb50 41 B9 01 00 00 00 4C 8B C5 BA 48 61 6C 20 FF 15 A.....L...Hal .. fffff800`02c0eb60 5C C5 01 00 4C 8B D8 48 85 C0 0F 85 F2 FE FF FF \...L..H........ fffff800`02c0eb70 48 21 44 24 20 45 33 C9 BA 00 10 00 00 B9 AC 00 H!D$ E3......... fffff800`02c0eb80 00 00 41 B8 02 EF 00 00 FF 15 62 C7 01 00 CC 90 ..A.......b..... fffff800`02c0eb90 90 90 90 90 90 90 90 90 48 89 5C 24 08 48 89 6C ........H.\$.H.l fffff800`02c0eba0 24 18 48 89 74 24 20 57 48 83 EC 20 41 80 78 30 $.H.t$ WH.. A.x0 fffff800`02c0ebb0 00 49 8B F8 8B F2 48 8B D9 BD 01 00 00 00 75 0F .I....H.......u. fffff800`02c0ebc0 49 8B 10 49 8B 48 08 FF 15 53 C4 01 00 EB 4A 4D I..I.H...S....JM fffff800`02c0ebd0 8B 00 48 8B 4F 08 BA 48 61 6C 20 FF 15 FF C4 01 ..H.O..Hal ..... fffff800`02c0ebe0 00 80 3D 30 63 02 00 00 75 2F 48 8D 4F 18 FF 15 ..=0c...u/H.O... fffff800`02c0ebf0 3C C5 01 00 48 8B 57 10 83 C8 FF F0 0F C1 42 18 <...H.W.......B. fffff800`02c0ec00 83 C0 FF 75 14 F0 0F B1 6A 1C 75 0D 48 8D 0D ED ...u....j.u.H... fffff800`02c0ec10 62 02 00 FF 15 4F C4 01 00 85 F6 74 1E 48 8B CE b....O.....t.H.. fffff800`02c0ec20 F6 43 10 10 74 0C 8B 43 10 25 EF 0F 00 00 48 89 .C..t..C.%....H. fffff800`02c0ec30 43 10 48 2B CD 48 8B 5B 08 75 E5 48 8B 5C 24 30 C.H+.H.[.u.H.\$0 fffff800`02c0ec40 48 8B 6C 24 40 48 8B 74 24 48 48 83 C4 20 5F C3 [email protected]$HH.. _. fffff800`02c0ec50 90 90 90 90 90 90 90 90 48 89 5C 24 18 48 89 4C ........H.\$.H.L fffff800`02c0ec60 24 08 55 56 57 41 54 41 55 41 56 41 57 48 83 EC $.UVWATAUAVAWH.. fffff800`02c0ec70 70 4D 8B F1 4D 8B E8 48 8B F2 4C 8B D1 44 0F 20 pM..M..H..L..D. fffff800`02c0ec80 C7 F6 42 0A 05 74 06 48 8B 5A 18 EB 2A 45 33 C9 ..B..t.H.Z..*E3. fffff800`02c0ec90 33 D2 48 8B CE 45 8D 41 01 C7 44 24 28 20 00 00 3.H..E.A..D$( .. fffff800`02c0eca0 00 83 64 24 20 00 FF 15 1C C4 01 00 4C 8B 94 24 ..d$ .......L..$ fffff800`02c0ecb0 B0 00 00 00 48 8B D8 BD 02 00 00 00 48 85 DB 75 ....H.......H..u fffff800`02c0ecc0 4A 40 3A FD 76 1F 48 21 5C 24 20 45 33 C9 BA 00 J@:.v.H!\$ E3... fffff800`02c0ecd0 10 00 00 B9 AC 00 00 00 41 B8 05 EF 00 00 FF 15 ........A....... fffff800`02c0ece0 0C C6 01 00 CC 8A 84 24 D8 00 00 00 44 8B 8C 24 .......$....D..$ fffff800`02c0ecf0 D0 00 00 00 4D 8B C6 49 8B D5 48 8B CE 88 44 24 ....M..I..H...D$ fffff800`02c0ed00 20 E8 02 FA FF FF E9 4D 01 00 00 44 8B BC 24 D0 ......M...D..$. fffff800`02c0ed10 00 00 00 BA FF 0F 00 00 41 8B CD 23 CA 41 8B C7 ........A..#.A.. fffff800`02c0ed20 C6 84 24 B8 00 00 00 00 23 C2 44 8D A4 01 FF 0F ..$.....#.D..... fffff800`02c0ed30 00 00 41 8B C7 41 C1 EC 0C C1 E8 0C 44 03 E0 44 ..A..A......D..D fffff800`02c0ed40 89 64 24 30 40 3A FD 76 41 33 C9 49 8B C6 45 85 .d$0@:.vA3.I..E. fffff800`02c0ed50 E4 74 64 48 F7 40 10 00 F0 FF FF 74 0D 48 8B 40 [email protected].@ fffff800`02c0ed60 08 FF C1 41 3B CC 72 EB EB 4D 48 83 64 24 20 00 ...A;.r..MH.d$ .

  Read the article

• "ERROR:Could not find java.nio.file.Paths" when using Oracle JDK 1.7

  - by Ankit

  I want to try out some features rolled out in Oracle's new JDK 1.7. I followed the post:- Oracle JDK 1.7 but the post doesn't seem to help. I was trying to fetch out the structure for java.nio.file.Paths class file but got the following error:- buffer@ankit:~$ javap java.nio.file.Paths ERROR:Could not find java.nio.file.Paths However i can easily get the information about class structures till JAVA SE 1.6, here is an example:- buffer@ankit:~$ javap java.lang.Object Compiled from "Object.java" public class java.lang.Object{ public java.lang.Object(); public final native java.lang.Class getClass(); public native int hashCode(); public boolean equals(java.lang.Object); protected native java.lang.Object clone() throws java.lang.CloneNotSupportedException; public java.lang.String toString(); public final native void notify(); public final native void notifyAll(); public final native void wait(long) throws java.lang.InterruptedException; public final void wait(long, int) throws java.lang.InterruptedException; public final void wait() throws java.lang.InterruptedException; protected void finalize() throws java.lang.Throwable; static {}; } Running java -version gives the following result:- buffer@ankit:~$ java -version java version "1.7.0_09" Java(TM) SE Runtime Environment (build 1.7.0_09-b05) Java HotSpot(TM) 64-Bit Server VM (build 23.5-b02, mixed mode) SYSTEM INFORMATION buffer@ankit:~$ sudo update-alternatives --config java [sudo] password for buffer: There are 4 choices for the alternative java (providing /usr/bin/java). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/java 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/java 1061 manual mode 2 /usr/lib/jvm/java-7-openjdk-amd64/jre/bin/java 1051 manual mode 3 /usr/lib/jvm/jdk1.7.0_09/ 1 manual mode * 4 /usr/lib/jvm/jdk1.7.0_09/bin/java 1 manual mode buffer@ankit:~$ sudo update-alternatives --config javac There are 2 choices for the alternative javac (providing /usr/bin/javac). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/bin/javac 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/bin/javac 1061 manual mode * 2 /usr/lib/jvm/jdk1.7.0_09/bin/javac 1 manual mode buffer@ankit:~$ sudo update-alternatives --config javaws There are 3 choices for the alternative javaws (providing /usr/bin/javaws). Selection Path Priority Status ------------------------------------------------------------ 0 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/javaws 1061 auto mode 1 /usr/lib/jvm/java-6-openjdk-amd64/jre/bin/javaws 1061 manual mode 2 /usr/lib/jvm/java-7-openjdk-amd64/jre/bin/javaws 1060 manual mode * 3 /usr/lib/jvm/jdk1.7.0_09/bin/javaws 1 manual mode The directory structure of /usr/lib/jvm/ is as follows:- buffer@ankit:~$ ls -l /usr/lib/jvm/ total 24 lrwxrwxrwx 1 root root 24 Dec 2 2011 default-java -> java-1.6.0-openjdk-amd64 drwxr-xr-x 4 root root 4096 Nov 8 16:24 java-1.5.0-gcj-4.6 lrwxrwxrwx 1 root root 24 Dec 2 2011 java-1.6.0-openjdk -> java-1.6.0-openjdk-amd64 lrwxrwxrwx 1 root root 20 Oct 25 00:01 java-1.6.0-openjdk-amd64 -> java-6-openjdk-amd64 lrwxrwxrwx 1 root root 20 Oct 25 06:59 java-1.7.0-openjdk-amd64 -> java-7-openjdk-amd64 lrwxrwxrwx 1 root root 24 Dec 2 2011 java-6-openjdk -> java-1.6.0-openjdk-amd64 drwxr-xr-x 7 root root 4096 Nov 8 16:24 java-6-openjdk-amd64 drwxr-xr-x 3 root root 4096 Nov 8 16:24 java-6-openjdk-common drwxr-xr-x 5 root root 4096 Nov 8 05:48 java-7-openjdk-amd64 drwxr-xr-x 3 root root 4096 Nov 8 05:48 java-7-openjdk-common drwxr-xr-x 8 buffer buffer 4096 Sep 25 09:08 jdk1.7.0_09 Any help would be highly appreciated.

  Read the article

• nvidia driver problems after upgrading to 3.2.0-26 on Ubuntu 12.04 64bit

  - by Lev Levitsky

  After installing latest updates I can't set screen resolution higher than 1024x768; every time after the boot I get a message Could not apply the stored configuration for the monitors (Note: removing ~/.config/monitors.xml stopped the message, but not the problem) I can boot with 3.2.0-25 and the graphics look normal. Here's what I have in /var/log/apt/term.log (excerpt): Setting up linux-image-3.2.0-26-generic (3.2.0-26.41) ... Running depmod. update-initramfs: deferring update (hook will be called later) Examining /etc/kernel/postinst.d. run-parts: executing /etc/kernel/postinst.d/dkms 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic Error! Problems with depmod detected. Automatically uninstalling this module. DKMS: Install Failed (depmod problems). Module rolled back to built state. run-parts: executing /etc/kernel/postinst.d/initramfs-tools 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic update-initramfs: Generating /boot/initrd.img-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/pm-utils 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/update-notifier 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic run-parts: executing /etc/kernel/postinst.d/zz-update-grub 3.2.0-26-generic /boot/vmlinuz-3.2.0-26-generic Generating grub.cfg ... Found linux image: /boot/vmlinuz-3.2.0-26-generic Found initrd image: /boot/initrd.img-3.2.0-26-generic Found linux image: /boot/vmlinuz-3.2.0-25-generic Found initrd image: /boot/initrd.img-3.2.0-25-generic Found linux image: /boot/vmlinuz-3.2.0-24-generic Found initrd image: /boot/initrd.img-3.2.0-24-generic Found linux image: /boot/vmlinuz-3.2.0-23-generic Found initrd image: /boot/initrd.img-3.2.0-23-generic Found linux image: /boot/vmlinuz-3.0.0-17-generic Found initrd image: /boot/initrd.img-3.0.0-17-generic Found memtest86+ image: /boot/memtest86+.bin I went to "additional drivers" and saw some updates available there, but an attempt to install them failed, leaving the following in /var/log/jockey.log (long log, pasted here). The full log won't fit in the question, so I'm showing $ fgrep 'ERROR' /var/log/jockey.log 2012-06-30 17:29:57,897 WARNING: modinfo for module vmxnet failed: ERROR: modinfo: could not find module vmxnet 2012-06-30 17:29:57,937 WARNING: modinfo for module wl failed: ERROR: modinfo: could not find module wl 2012-06-30 17:29:58,072 WARNING: modinfo for module nvidia_96 failed: ERROR: modinfo: could not find module nvidia_96 2012-06-30 17:29:58,240 WARNING: modinfo for module nvidia_current failed: ERROR: modinfo: could not find module nvidia_current 2012-06-30 17:29:58,293 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:29:58,351 WARNING: modinfo for module nvidia_173_updates failed: ERROR: modinfo: could not find module nvidia_173_updates 2012-06-30 17:29:58,385 WARNING: modinfo for module nvidia_173 failed: ERROR: modinfo: could not find module nvidia_173 2012-06-30 17:29:58,420 WARNING: modinfo for module nvidia_96_updates failed: ERROR: modinfo: could not find module nvidia_96_updates 2012-06-30 17:29:58,455 WARNING: modinfo for module ath_pci failed: ERROR: modinfo: could not find module ath_pci 2012-06-30 17:29:58,478 WARNING: modinfo for module fglrx_updates failed: ERROR: modinfo: could not find module fglrx_updates 2012-06-30 17:29:58,531 WARNING: modinfo for module fglrx failed: ERROR: modinfo: could not find module fglrx 2012-06-30 17:29:58,588 WARNING: modinfo for module omapdrm_pvr failed: ERROR: modinfo: could not find module omapdrm_pvr 2012-06-30 17:29:59,537 WARNING: modinfo for module nvidia_current failed: ERROR: modinfo: could not find module nvidia_current 2012-06-30 17:29:59,613 WARNING: modinfo for module nvidia_173_updates failed: ERROR: modinfo: could not find module nvidia_173_updates 2012-06-30 17:29:59,686 WARNING: modinfo for module nvidia_173 failed: ERROR: modinfo: could not find module nvidia_173 2012-06-30 17:29:59,764 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:30:29,544 WARNING: modinfo for module nvidia_current_updates failed: ERROR: modinfo: could not find module nvidia_current_updates 2012-06-30 17:30:29,545 ERROR: XorgDriverHandler.enable(): package or module not installed, aborting I'm not sure if it's a bug, as the first log shows some errors. What can I try?

  Read the article

• javax.ejb.NoSuchEJBException after redeploying EJBs

  - by vetler

  Using Glassfish 3.0.1 ... If I have a web application accessing EJBs in another application remotely, and the remote application containing the EJBs is redeployed, I get a javax.ejb.NoSuchEJBException (see stacktrace below). Shouldn't this work? I can see that the EJB in question was successfully deployed, using the exact same JNDI name. Is there any other way to fix this than to restart the web application? It should be noted that in this particular example that the stacktrace is from, I'm accessing a servlet that injects the bean with CDI: public class StatusServlet extends HttpServlet { @Inject private StatusService statusService; @Override public void doGet(final HttpServletRequest req, final HttpServletResponse res) throws IOException { res.getWriter().write(statusService.getStatus()); } } The injection is done with the following producer to get the right EJB: public class StatusServiceProducer extends AbstractServiceProducer { @EJB(name = "StatusService") private StatusService service; @Produces public StatusService getService(final InjectionPoint ip) { return service; } } A producer is used to make it easier to wrap the service in a proxy, and to make it easier to change how the EJBs are looked up. The StatusService interface and implementation is as follows: @Stateless(name = "StatusService") public class StatusServiceImpl implements StatusService { private static final String OK = "OK"; public String getStatus() { // Some code return OK; } } public interface StatusService { String getStatus(); } Full stacktrace: [#|2011-01-12T10:45:28.273+0100|WARNING|glassfish3.0.1|javax.enterprise.system.container.web.com.sun.enterprise.web|_ThreadID=50;_ThreadName=http-thread-pool-8080-(1);|StandardWrapperValve[Load Balancer status servlet]: PWC1406: Servlet.service() for servlet Load Balancer status servlet threw exception javax.ejb.NoSuchEJBException at org.example.service._StatusService_Wrapper.getStatus(org/example/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: java.rmi.NoSuchObjectException: CORBA OBJECT_NOT_EXIST 1330446338 No; nested exception is: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.javax.rmi.CORBA.Util.mapSystemException(Util.java:280) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:200) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) ... 39 more Caused by: org.omg.CORBA.OBJECT_NOT_EXIST: ----------BEGIN server-side stack trace---------- org.omg.CORBA.OBJECT_NOT_EXIST: vmcid: OMG minor code: 2 completed: No at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3457) at com.sun.corba.ee.impl.logging.OMGSystemException.noObjectAdaptor(OMGSystemException.java:3475) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:222) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.findObjectAdapter(CorbaServerRequestDispatcherImpl.java:450) at com.sun.corba.ee.impl.protocol.CorbaServerRequestDispatcherImpl.dispatch(CorbaServerRequestDispatcherImpl.java:209) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.handleRequestRequest(CorbaMessageMediatorImpl.java:1841) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:119) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.invoke(StubInvocationHandlerImpl.java:147) at com.sun.corba.ee.impl.presentation.rmi.codegen.CodegenStubBase.invoke(CodegenStubBase.java:225) at no.evote.service.__StatusService_Remote_DynamicStub.getStatus(no/evote/service/__StatusService_Remote_DynamicStub.java) at no.evote.service._StatusService_Wrapper.getStatus(no/evote/service/_StatusService_Wrapper.java) at sun.reflect.NativeMethodAccessorImpl.invoke0(Native Method) at sun.reflect.NativeMethodAccessorImpl.invoke(NativeMethodAccessorImpl.java:39) at sun.reflect.DelegatingMethodAccessorImpl.invoke(DelegatingMethodAccessorImpl.java:25) at java.lang.reflect.Method.invoke(Method.java:597) at no.evote.service.cache.ServiceInvocationHandler.invoke(ServiceInvocationHandler.java:34) at $Proxy760.getStatus(Unknown Source) at no.evote.presentation.StatusServlet.doGet(StatusServlet.java:25) at javax.servlet.http.HttpServlet.service(HttpServlet.java:734) at javax.servlet.http.HttpServlet.service(HttpServlet.java:847) at org.apache.catalina.core.StandardWrapper.service(StandardWrapper.java:1523) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:343) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at net.balusc.http.multipart.MultipartFilter.doFilter(MultipartFilter.java:78) at org.apache.catalina.core.ApplicationFilterChain.internalDoFilter(ApplicationFilterChain.java:256) at org.apache.catalina.core.ApplicationFilterChain.doFilter(ApplicationFilterChain.java:215) at org.apache.catalina.core.StandardWrapperValve.invoke(StandardWrapperValve.java:277) at org.apache.catalina.core.StandardContextValve.invoke(StandardContextValve.java:188) at org.apache.catalina.core.StandardPipeline.invoke(StandardPipeline.java:641) at com.sun.enterprise.web.WebPipeline.invoke(WebPipeline.java:97) at com.sun.enterprise.web.PESessionLockingStandardPipeline.invoke(PESessionLockingStandardPipeline.java:85) at org.apache.catalina.core.StandardHostValve.invoke(StandardHostValve.java:185) at org.apache.catalina.connector.CoyoteAdapter.doService(CoyoteAdapter.java:325) at org.apache.catalina.connector.CoyoteAdapter.service(CoyoteAdapter.java:226) at com.sun.enterprise.v3.services.impl.ContainerMapper.service(ContainerMapper.java:165) at com.sun.grizzly.http.ProcessorTask.invokeAdapter(ProcessorTask.java:791) at com.sun.grizzly.http.ProcessorTask.doProcess(ProcessorTask.java:693) at com.sun.grizzly.http.ProcessorTask.process(ProcessorTask.java:954) at com.sun.grizzly.http.DefaultProtocolFilter.execute(DefaultProtocolFilter.java:170) at com.sun.grizzly.DefaultProtocolChain.executeProtocolFilter(DefaultProtocolChain.java:135) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:102) at com.sun.grizzly.DefaultProtocolChain.execute(DefaultProtocolChain.java:88) at com.sun.grizzly.http.HttpProtocolChain.execute(HttpProtocolChain.java:76) at com.sun.grizzly.ProtocolChainContextTask.doCall(ProtocolChainContextTask.java:53) at com.sun.grizzly.SelectionKeyContextTask.call(SelectionKeyContextTask.java:57) at com.sun.grizzly.ContextTask.run(ContextTask.java:69) at com.sun.grizzly.util.AbstractThreadPool$Worker.doWork(AbstractThreadPool.java:330) at com.sun.grizzly.util.AbstractThreadPool$Worker.run(AbstractThreadPool.java:309) at java.lang.Thread.run(Thread.java:662) Caused by: org.omg.PortableServer.POAPackage.AdapterNonExistent: IDL:omg.org/PortableServer/POA/AdapterNonExistent:1.0 at com.sun.corba.ee.impl.oa.poa.POAImpl.find_POA(POAImpl.java:1057) at com.sun.corba.ee.impl.oa.poa.POAFactory.find(POAFactory.java:218) ... 48 more ----------END server-side stack trace---------- vmcid: OMG minor code: 2 completed: No at sun.reflect.NativeConstructorAccessorImpl.newInstance0(Native Method) at sun.reflect.NativeConstructorAccessorImpl.newInstance(NativeConstructorAccessorImpl.java:39) at sun.reflect.DelegatingConstructorAccessorImpl.newInstance(DelegatingConstructorAccessorImpl.java:27) at java.lang.reflect.Constructor.newInstance(Constructor.java:513) at com.sun.corba.ee.impl.protocol.giopmsgheaders.MessageBase.getSystemException(MessageBase.java:913) at com.sun.corba.ee.impl.protocol.giopmsgheaders.ReplyMessage_1_2.getSystemException(ReplyMessage_1_2.java:129) at com.sun.corba.ee.impl.protocol.CorbaMessageMediatorImpl.getSystemExceptionReply(CorbaMessageMediatorImpl.java:681) at com.sun.corba.ee.impl.protocol.CorbaClientRequestDispatcherImpl.processResponse(CorbaClientRequestDispatcherImpl.java:510) at com.sun.corba.ee.impl.protocol.SharedCDRClientRequestDispatcherImpl.marshalingComplete(SharedCDRClientRequestDispatcherImpl.java:153) at com.sun.corba.ee.impl.protocol.CorbaClientDelegateImpl.invoke(CorbaClientDelegateImpl.java:235) at com.sun.corba.ee.impl.presentation.rmi.StubInvocationHandlerImpl.privateInvoke(StubInvocationHandlerImpl.java:187) ... 42 more |#]

  Read the article

• How to select from tableA sum of grouped numbers from tableB above their sums average in Oracle?

  - by Nazgulled

  I have data like this: tableA.ID --------- 1 2 3 tableB.ID tableB.NUM -------------------- 1 10 1 15 2 18 3 12 2 15 3 13 1 12 I need to select tableA IDs where the sum of their NUMs in tableB is above the average of all tableA IDs sums. In other words: SUM ID=1 -> 10+15+12 = 37 SUM ID=2 -> 18+12+15 = 45 SUM ID=3 -> 12+13 = 25 AVG ALL IDs -> (37+45+25)/3 = 35 The SELECT must only show ID 1 and 2 because 37 35, 45 35 but 25 < 35. This is my current query which is working fine: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > ( SELECT AVG(MY_SUM) FROM ( SELECT SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID GROUP BY tableA.ID ) ) GROUP BY tableA.ID But I have a feeling there might be a better way without all those nested SELECTs. Perhaps 2, but 3 feels like too much. I'm probably wrong though. For instance, why can't I do something simple like this: SELECT tableA.ID FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING SUM(tableB.NUM) > AVG(SUM(tableB.NUM)) GROUP BY tableA.ID Or this: SELECT tableA.ID, SUM(tableB.NUM) MY_SUM FROM tableA, tableB WHERE tableA.ID = tableB.ID HAVING MY_SUM > AVG(MY_SUM) GROUP BY tableA.ID

  Read the article

• Why can't I send SOAP requests to Ebay finding API with this php?

  - by Jay

  This is my code: <?php error_reporting(E_ALL); //new instance of soapClient pointing to Ebay finding api $client = new SoapClient("http://developer.ebay.com/webservices/finding/latest/FindingService.wsdl"); //attach required parameters to soap message header $header_arr = array(); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "SOAP11"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-NAME", "FindingService"); $header_arr[] = new SoapHeader("X-EBAY-SOA-OPERATION-NAME", "findItemsByKeywords"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SERVICE-VERSION", "1.0.0"); $header_arr[] = new SoapHeader("X-EBAY-SOA-GLOBAL-ID", "EBAY-GB"); $header_arr[] = new SoapHeader("X-EBAY-SOA-SECURITY-APPNAME", "REMOVED"); $header_arr[] = new SoapHeader("X-EBAY-SOA-REQUEST-DATA-FORMAT", "XML"); $header_arr[] = new SoapHeader("X-EBAY-SOA-MESSAGE-PROTOCOL", "XML"); $test = $client->__setSoapHeaders($header_arr); $client->__setLocation("http://svcs.ebay.com/services/search/FindingService/v1");//endpoint $FindItemsByKeywordsRequest = array( "keywords" => "potter" ); $result = $client->__soapCall("findItemsByKeywords", $FindItemsByKeywordsRequest); //print_r($client->__getFunctions()); //print_r($client->__getTypes()); //print_r($result); ? And this is the error I receive: Fatal error: Uncaught SoapFault exception: [axis2ns2:Server] Missing SOA operation name header in C:\xampplite\htdocs\OOP\newfile.php:25 Stack trace: #0 C:\xampplite\htdocs\OOP\newfile.php(25): SoapClient-__soapCall('findItemsByKeyw...', Array) #1 {main} thrown in C:\xampplite\htdocs\OOP\newfile.php on line 25 It doesnt make sense, I have already set the operation name in the header of the request... Does anyone know what is wrong here?

  Read the article

• word wrap in tcpdf

  - by ChuckO

  I'm using tcpdf to creat a pdf version of the html table below. How do I word wrap the text in the cells? <!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN"> <html> <head> <style type="text/css"> table.frm { width: 960px; Height:400px; margin-left: auto; margin-right: auto; border-width: 0px 0px 0px 0px; border-spacing: 0px; border-style: solid solid solid solid; border-color: gray gray gray gray; border-collapse: collapse; background-color: white; font-family: Verdana,Arial,Helvetica,sans-serif; font-size: 11px; } table.frm th { Width: 120px; border-width: 1px 1px 1px 1px; padding: 1px 1px 1px 1px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } table.frm td { width: 120px; height: 80px; vertical-align: top; border-width: 1px 1px 1px 1px; padding: 2px 2px 2px 2px; border-style: solid solid solid solid; border-collapse: collapse; border-color: gray gray gray gray; background-color: white; } </style> <title>Weekly Menu</title> </head> <body> <table class="frm"> <tr> <th align="center" colspan="8"><b>WEEKLY MENU</b></th> </tr> <tr> <th align="center" colspan="8"><b>Your Name Here</b></th> </tr> <tr> <th></th> <th>Monday</th> <th>Tuesday</th> <th>Wednesday</th> <th>Thursday</th> <th>Friday</th> <th>Saturday</th> <th>Sunday</th> </tr> <tr> <td><b>Breakfast</b></td> <td>Scrambled Eggs Black Coffee</td> <td>Vegetable Omelet Black Coffee</td> <td>2 slices Toast Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Orange Juice Black Coffee</td> <td>Cereal w/milk Black Coffee</td> <td>Pancakes w/syrup Black Coffee</td> </tr> <tr> <td><b>Lunch</b></td> <td>Tuna Salad Sandwich Diet Coke</td> <td>Greek Salad Black Coffee</td> <td></td> <td>Amer Cheese Sandwich Orange Juice</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Dinner</b></td> <td>Burger Fried Onions Diet Coke</td> <td>Steak Fries Diet Sprite</td> <td></td> <td>Chicken Cutlet Baked Potato Peas</td> <td></td> <td></td> <td></td> </tr> <tr> <td><b>Snack</b></td> <td>Apple</td> <td>Orange</td> <td>Sm bag of chips</td> <td>Celery Sticks</td> <td></td> <td></td> <td></td> </tr> </table> </body> </html> This is the tcpdf code: $pdf = new TCPDF('Landscape', 'mm', '', true, 'UTF-8', false); $pdf->SetTitle('Weekly Menu'); $pdf->SetMargins(15, 7.5, 12.5); $pdf->SetAutoPageBreak(TRUE, PDF_MARGIN_BOTTOM); $pdf->SetPrintHeader(false); $pdf->SetPrintFooter(false); $pdf->AddPage(); $pdf->setFormDefaultProp(array('lineWidth'=>0, 'borderStyle'=>'dot', 'fillColor'=>array(235, 235, 255), 'strokeColor'=>array(255,255,250))); $pdf->SetFont('times', 'BU', 12); $pdf->cell(250, 8, 'Weekly Menu', 0, 1, 'C'); $pdf->cell(250, 8, $yourname, 0, 1, 'C'); $pdf->SetFont('times', '', 10); $cw=35; $ch=25; $pdf->SetXY(15,50); $pdf->cell(25,5,'',1,0,'L'); $pdf->cell($cw,5,$day1,1,0,'C'); $pdf->cell($cw,5,$day2,1,0,'C'); $pdf->cell($cw,5,$day3,1,0,'C'); $pdf->cell($cw,5,$day4,1,0,'C'); $pdf->cell($cw,5,$day5,1,0,'C'); $pdf->cell($cw,5,$day6,1,0,'C'); $pdf->cell($cw,5,$day7,1,1,'C'); $pdf->cell(25,$ch,'Breakfast',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->breakfast,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->breakfast,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Lunch',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->lunch,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->lunch,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Dinner',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->dinner,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->dinner,1,1,'L',0,0,false,'','T'); $pdf->cell(25,$ch,'Snack',1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[0]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[1]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[2]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[3]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[4]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[5]->snack,1,0,'L',0,0,false,'','T'); $pdf->cell($cw,$ch,$record[6]->snack,1,1,'L',0,0,false,'','T'); EOD;

  Read the article

• XML String into a DataGridView (C#)

  - by Justin Daniels

  I am currently working with a webservice to pull a report about users in a remote support system. After pulling my report and receiving the result, I am given the following string back by the method: <report><header><field id="0">Source</field><field id="1">Session ID</field><field id="2">Date</field><field id="3">Name</field><field id="24">Technician Name</field><field id="25">Technician ID</field></header><data><row><field id="0">Email</field><field id="1">55037806</field><field id="2">4/13/2010 2:28:06 AM</field><field id="3">Bill Gates</field><field id="24">John</field><field id="25">1821852</field></row><row><field id="0">Telephone</field><field id="1">55034548</field><field id="2">4/13/2010 12:59:44 AM</field><field id="3">Steve Jobs</field><field id="24">John</field><field id="25">1821852</field></row></data></report> After receiving this string, I need to take it and display the actual data in a datagridview. I've tried putting it into an XMLDocument then reading that, but it seems to keep failing. Just interested in another set of eyes :) Application is written in C# in VS2010.

  Read the article

• Search for string allowing for one mismatches in any location of the string, Python

  - by Vincent

  I am working with DNA sequences of length 25 (see examples below). I have a list of 230,000 and need to look for each sequence in the entire genome (toxoplasma gondii parasite) I am not sure how large the genome is but much more that 230,000 sequences. I need to look for each of my sequences of 25 characters example(AGCCTCCCATGATTGAACAGATCAT). The genome is formatted as a continuous string ie (CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT.........) I don't care where or how many times it is found, just yes or no. This is simple I think, str.find(AGCCTCCCATGATTGAACAGATCAT) But I also what to find a close match defined as wrong(mismatched) at any location but only 1 location and record the location in the sequnce. I am not sure how do do this. The only thing I can think of is using a wildcard and performing the search with a wildcard in each position. ie search 25 times. For example AGCCTCCCATGATTGAACAGATCAT AGCCTCCCATGATAGAACAGATCAT close match with a miss-match at position 13 Speed is not a big issue I am only doing it 3 times. i hope but it would be nice it was fast. The are programs that do this find matches and partial matches but I am looking for a type of partial match that is not available with these applications. Here is a similar post for pearl but they are only comparing sequnces not searching a continuous string Related post

  Read the article

• Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server.

  - by Hiru

  When a form with a run at server is added there will be two forms with runat server and another error occurs. Can some one give me an idea. Thankx in advance. The details of the error are as follows. Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server. Description: An unhandled exception occurred during the execution of the current web request. Please review the stack trace for more information about the error and where it originated in the code. Exception Details: System.Web.HttpException: Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server. Source Error: An unhandled exception was generated during the execution of the current web request. Information regarding the origin and location of the exception can be identified using the exception stack trace below. Stack Trace: [HttpException (0x80004005): Control 'ctl00_TextBox1' of type 'TextBox' must be placed inside a form tag with runat=server.] System.Web.UI.Page.VerifyRenderingInServerForm(Control control) +2052287 System.Web.UI.WebControls.TextBox.AddAttributesToRender(HtmlTextWriter writer) +49 System.Web.UI.WebControls.WebControl.RenderBeginTag(HtmlTextWriter writer) +17 System.Web.UI.WebControls.TextBox.Render(HtmlTextWriter writer) +17 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +199 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +20 System.Web.UI.Control.Render(HtmlTextWriter writer) +7 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Control.RenderChildrenInternal(HtmlTextWriter writer, ICollection children) +199 System.Web.UI.Control.RenderChildren(HtmlTextWriter writer) +20 System.Web.UI.Page.Render(HtmlTextWriter writer) +26 System.Web.UI.Control.RenderControlInternal(HtmlTextWriter writer, ControlAdapter adapter) +25 System.Web.UI.Control.RenderControl(HtmlTextWriter writer, ControlAdapter adapter) +121 System.Web.UI.Control.RenderControl(HtmlTextWriter writer) +22 System.Web.UI.Page.ProcessRequestMain(Boolean includeStagesBeforeAsyncPoint, Boolean includeStagesAfterAsyncPoint) +2558 Version Information: Microsoft .NET Framework Version:2.0.50727.1873; ASP.NET Version:2.0.50727.1433

  Read the article

< Previous Page | 40 41 42 43 44 45 46 47 48 49 50 51  | Next Page >