Search Results

Search found 47324 results on 1893 pages for 'end users'.

Page 441/1893 | < Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >

  • Developer’s Life – Attitude and Communication – They Can Cause Problems – Notes from the Field #027

    - by Pinal Dave
    [Note from Pinal]: This is a 27th episode of Notes from the Field series. The biggest challenge for anyone is to understand human nature. We human have so many things on our mind at any moment of time. There are cases when what we say is not what we mean and there are cases where what we mean we do not say. We do say and things as per our mood and our agenda in mind. Sometimes there are incidents when our attitude creates confusion in the communication and we end up creating a situation which is absolutely not warranted. In this episode of the Notes from the Field series database expert Mike Walsh explains a very crucial issue we face in our career, which is not technical but more to relate to human nature. Read on this may be the best blog post you might read in recent times. In this week’s note from the field, I’m taking a slight departure from technical knowledge and concepts explained. We’ll be back to it next week, I’m sure. Pinal wanted us to explain some of the issues we bump into and how we see some of our customers arrive at problem situations and how we have helped get them back on the right track. Often it is a technical problem we are officially solving – but in a lot of cases as a consultant, we are really helping fix some communication difficulties. This is a technical blog post and not an “advice column” in a newspaper – but the longer I am a consultant, the more years I add to my experience in technology the more I learn that the vast majority of the problems we encounter have “soft skills” included in the chain of causes for the issue we are helping overcome. This is not going to be exhaustive but I hope that sharing four pieces of advice inspired by real issues starts a process of searching for places where we can be the cause of these challenges and look at fixing them in ourselves. Or perhaps we can begin looking at resolving them in teams that we manage. I’ll share three statements that I’ve either heard, read or said and talk about some of the communication or attitude challenges highlighted by the statement. 1 – “But that’s the SAN Administrator’s responsibility…” I heard that early on in my consulting career when talking with a customer who had serious corruption and no good recent backups – potentially no good backups at all. The statement doesn’t have to be this one exactly, but the attitude here is an attitude of “my job stops here, and I don’t care about the intent or principle of why I’m here.” It’s also a situation of having the attitude that as long as there is someone else to blame, I’m fine…  You see in this case, the DBA had a suspicion that the backups were not being handled right.  They were the DBA and they knew that they had responsibility to ensure SQL backups were good to go – it’s a basic requirement of a production DBA. In my “As A DBA Where Do I start?!” presentation, I argue that is job #1 of a DBA. But in this case, the thought was that there was someone else to blame. Rather than create extra work and take on responsibility it was decided to just let it be another team’s responsibility. This failed the company, the company’s customers and no one won. As technologists – we should strive to go the extra mile. If there is a lack of clarity around roles and responsibilities and we know it – we should push to get it resolved. Especially as the DBAs who should act as the advocates of the data contained in the databases we are responsible for. 2 – “We’ve always done it this way, it’s never caused a problem before!” Complacency. I have to say that many failures I’ve been paid good money to help recover from would have not happened had it been for an attitude of complacency. If any thoughts like this have entered your mind about your situation you may be suffering from it. If, while reading this, you get this sinking feeling in your stomach about that one thing you know should be fixed but haven’t done it.. Why don’t you stop and go fix it then come back.. “We should have better backups, but we’re on a SAN so we should be fine really.” “Technically speaking that could happen, but what are the chances?” “We’ll just clean that up as a fast follow” ..and so on. In the age of tightening IT budgets, increased expectations of up time, availability and performance there is no room for complacency. Our customers and business units expect – no demand – the best. Complacency says “we will give you second best or hopefully good enough and we accept the risk and know this may hurt us later. Sometimes an organization will opt for “good enough” and I agree with the concept that at times the perfect can be the enemy of the good. But when we make those decisions in a vacuum and are not reporting them up and discussing them as an organization that is different. That is us unilaterally choosing to do something less than the best and purposefully playing a game of chance. 3 – “This device must accept interference from other devices but not create any” I’ve paraphrased this one – but it’s something the Federal Communications Commission – a federal agency in the United States that regulates electronic communication – requires of all manufacturers of any device that could cause or receive interference electronically. I blogged in depth about this here (http://www.straightpathsql.com/archives/2011/07/relationship-advice-from-the-fcc/) so I won’t go into much detail other than to say this… If we all operated more on the premise that we should do our best to not be the cause of conflict, and to be less easily offended and less upset when we perceive offense life would be easier in many areas! This doesn’t always cause the issues we are called in to help out. Not directly. But where we see it is in unhealthy relationships between the various technology teams at a client. We’ll see teams hoarding knowledge, not sharing well with others and almost working against other teams instead of working with them. If you trace these problems back far enough it often stems from someone or some group of people violating this principle from the FCC. To Sum It Up Technology problems are easy to solve. At Linchpin People we help many customers get past the toughest technological challenge – and at the end of the day it is really just a repeatable process of pattern based troubleshooting, logical thinking and starting at the beginning and carefully stepping through to the end. It’s easy at the end of the day. The tough part of what we do as consultants is the people skills. Being able to help get teams working together, being able to help teams take responsibility, to improve team to team communication? That is the difficult part, and we get to use the soft skills on every engagement. Work on professional development (http://professionaldevelopment.sqlpass.org/) and see continuing improvement here, not just with technology. I can teach just about anyone how to be an excellent DBA and performance tuner, but some of these soft skills are much more difficult to teach. If you want to get started with performance analytics and triage of virtualized SQL Servers with the help of experts, read more over at Fix Your SQL Server. Reference: Pinal Dave (http://blog.sqlauthority.com)Filed under: Notes from the Field, PostADay, SQL, SQL Authority, SQL Query, SQL Server, SQL Tips and Tricks, T SQL

    Read the article

  • Is it possible to get the client process ID of an application that runs on SQL server?

    - by Andrea.Ko
    Hi all, For my VFP application, i have a program to check currently who is accessing the server (by using sp_who2), also another progam to check who is currently locking which table. But i wish to know which options my users is accessing at the moment. Am thinking if i can write a SP to get the current connected process ID for a specific client, and insert to a table(ActLog) in SQL with the program name pass into this table during users load the program. And delete that particular record when user unload the program. Then from the ActLog, i can know who is currently accessing to which program. At the moment, i wish to know if i able to get the client process ID? rgds/Andrea

    Read the article

  • Sublime Text 2 Keyboard shortcut to open file in Chrome/firefox in windows

    - by samdroid
    I followed the instruction for windows 7 to setup chrome. No luck! { "cmd":["C:\Program Files (x86)\Google\Chrome\Application", "$C:\Users\gmu\Desktop\June_15_2012"] } after entering the file location/path under what format should I have to save. I am a noobie. sorry to ask this question. Anything helps! If I press f7 getting the following message Error trying to parse build system: Invalid escape in C:\Users\gmu\AppData\Roaming\Sublime Text2\Packages\User\Chrome.sublime-build:2:9 Thanks

    Read the article

  • How to query Entities in Entity Framework 4

    - by Picflight
    In VS2008, I think it is EF1.0, this works just fine. string queryString = @"SELECT VALUE USERS FROM ProjectDBEntities.Users AS User INNER JOIN ProjectDBEntities.Favorites AS F ON F.FavUserId = User.UserId WHERE F.UserId = " + 3 + " ORDER BY F.CreateDate DESC "; System.Data.Objects.ObjectQuery<User> usersQuery = new System.Data.Objects.ObjectQuery<User>(queryString, context).Include("Detail"); //int count = usersQuery.Count(); foreach (User result in usersQuery) Console.WriteLine("User Name: {0}", result.UserName); Same code in VS2010 EF4 it crashes on the foreach loop with the following error: The result type of the query is neither an EntityType nor a CollectionType with an entity element type. An Include path can only be specified for a query with one of these result types.

    Read the article

  • Win32 API Question

    - by Lalit_M
    We have developed a ASP.NET web application and has implemented a custom authentication solution using active directory as the credentials store. Our front end application uses a normal login form to capture the user name and password and leverages the Win32 LogonUser method to authenticate the user’s credentials. When we are calling the LogonUser method, we are using the LOGON32_LOGON_NETWORK as the logon type. The issue we have found is that user profile folders are being created under the C:\Users folder of the web server. The folder seems to be created when a new user who has never logged on before is logging in for the first time. As the number of new users logging into the application grows, disk space is shrinking due to the large number of new user folders getting created. Has anyone seen this behavior with the Win32 LogonUser method? Does anyone know how to disable this behavior?

    Read the article

  • Deployment of SQL compact Edition (SDF files) using Setup project

    - by Emad
    Hi, I have a C#.NET desktop application using SQL Compact edition as data store. The application should be used by any user on the machine and all should be seeing the same data ( data should not different per user). I am wondering where should I deploy the SDF file? User's Personal data folder (My Documents) means each user will have a separate database. Deploying on the same folder as the application causes vista to copy the file to \USers\Appdata\local\VirtualStore\ and it seems to make different copies for each user. Where is it best to deploy the SDF file to ensure all users are looking at the same data?

    Read the article

  • Gnome Do not Launching

    - by PyRulez
    When I try running gnome do, I get this. chris@Chris-Ubuntu-Laptop:~$ gnome-do pgrep: invalid user name: -u and it is not writable Trying sudo: chris@Chris-Ubuntu-Laptop:~$ sudo gnome-do [NetworkService] Could not initialize Network Manager dbus: Unable to open the session message bus. [Error 17:54:30.122] [SystemService] Could not initialize dbus: Unable to open the session message bus. (Do:2401): Wnck-CRITICAL **: wnck_set_client_type got called multiple times. (Do:2401): libdo-WARNING **: Binding '<Super>space' failed! [Error 17:54:30.649] [AbstractKeyBindingService] Key "" is already mapped. Tomboy.NotesItemSource "Tomboy Notes" encountered an error in UpdateItems: System.TypeInitializationException: An exception was thrown by the type initializer for Tomboy.TomboyDBus ---> System.Exception: Unable to open the session message bus. ---> System.ArgumentNullException: Argument cannot be null. Parameter name: address at NDesk.DBus.Bus.Open (System.String address) [0x00000] in <filename unknown>:0 at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 at Tomboy.TomboyDBus..cctor () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at Tomboy.NotesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Firefox.PlacesItemSource "Firefox Places" encountered an error in UpdateItems: System.InvalidCastException: Cannot cast from source type to destination type. at Mono.Data.Sqlite.SqliteDataReader.VerifyType (Int32 i, DbType typ) [0x00000] in <filename unknown>:0 at Mono.Data.Sqlite.SqliteDataReader.GetString (Int32 i) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource+<LoadPlaceItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem].AddEnumerable (IEnumerable`1 enumerable) [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem]..ctor (IEnumerable`1 collection) [0x00000] in <filename unknown>:0 at System.Linq.Enumerable.ToArray[PlaceItem] (IEnumerable`1 source) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Do.Universe.Linux.GNOMESpecialLocationsItemSource "GNOME Special Locations" encountered an error in UpdateItems: System.IO.FileNotFoundException: Could not find file "/root/.gtk-bookmarks". File name: '/root/.gtk-bookmarks' at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share, Int32 bufferSize, Boolean anonymous, FileOptions options) [0x00000] in <filename unknown>:0 at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.FileStream:.ctor (string,System.IO.FileMode,System.IO.FileAccess,System.IO.FileShare) at System.IO.File.OpenRead (System.String path) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path, System.Text.Encoding encoding, Boolean detectEncodingFromByteOrderMarks, Int32 bufferSize) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.StreamReader:.ctor (string) at Do.Universe.Linux.GNOMESpecialLocationsItemSource+<ReadBookmarkItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at Do.Universe.Linux.GNOMESpecialLocationsItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . ^[^\Full thread dump: "<unnamed thread>" tid=0x0xb7570700 this=0x0x56f18 thread handle 0x403 state : not waiting owns () at (wrapper managed-to-native) Mono.Unix.Native.Syscall.read (int,intptr,ulong) <0xffffffff> at Mono.Unix.Native.Syscall.read (int,void*,ulong) <0x00023> at Mono.Unix.UnixStream.Read (byte[],int,int) <0x0008b> at NDesk.DBus.Connection.ReadMessage () <0x0003c> at NDesk.DBus.Connection.Iterate () <0x0001b> at NDesk.DBus.BusG/<Init>c__AnonStorey0.<>m__0 (intptr,NDesk.GLib.IOCondition,intptr) <0x00033> at (wrapper native-to-managed) NDesk.DBus.BusG/<Init>c__AnonStorey0.<>m__0 (intptr,NDesk.GLib.IOCondition,intptr) <0xffffffff> at (wrapper managed-to-native) Gtk.Clipboard.gtk_clipboard_wait_is_text_available (intptr) <0xffffffff> at Gtk.Clipboard.WaitIsTextAvailable () <0x00017> at Do.Universe.SelectedTextItem.UpdateSelection (object,System.EventArgs) <0x00027> at Do.Platform.AbstractApplicationService.OnSummoned () <0x00025> at Do.Platform.ApplicationService.<ApplicationService>m__31 (object,System.EventArgs) <0x00013> at Do.Core.Controller.OnSummoned () <0x00025> at Do.Core.Controller.Summon () <0x00027> at Do.Do.Main (string[]) <0x001eb> at (wrapper runtime-invoke) <Module>.runtime_invoke_void_object (object,intptr,intptr,intptr) <0xffffffff> "<unnamed thread>" tid=0x0xb2c81b40 this=0x0x194150 thread handle 0x412 state : interrupted state owns () at (wrapper managed-to-native) System.IO.InotifyWatcher.ReadFromFD (intptr,byte[],intptr) <0xffffffff> at System.IO.InotifyWatcher.Monitor () <0x0005f> at System.Threading.Thread.StartInternal () <0x00057> at (wrapper runtime-invoke) object.runtime_invoke_void__this__ (object,intptr,intptr,intptr) <0xffffffff> "Universe Update Dispatcher" tid=0x0xb29ffb40 this=0x0x569d8 thread handle 0x41b state : interrupted state owns () at (wrapper managed-to-native) System.Threading.WaitHandle.WaitOne_internal (System.Threading.WaitHandle,intptr,int,bool) <0xffffffff> at System.Threading.WaitHandle.WaitOne (System.TimeSpan,bool) <0x00133> at System.Threading.WaitHandle.WaitOne (System.TimeSpan) <0x00022> at Do.Core.UniverseManager.UniverseUpdateLoop () <0x0007a> at System.Threading.Thread.StartInternal () <0x00057> at (wrapper runtime-invoke) object.runtime_invoke_void__this__ (object,intptr,intptr,intptr) <0xffffffff> Tomboy.NotesItemSource "Tomboy Notes" encountered an error in UpdateItems: System.TypeInitializationException: An exception was thrown by the type initializer for Tomboy.TomboyDBus ---> System.Exception: Unable to open the session message bus. ---> System.ArgumentNullException: Argument cannot be null. Parameter name: address at NDesk.DBus.Bus.Open (System.String address) [0x00000] in <filename unknown>:0 at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 at Tomboy.TomboyDBus..cctor () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at Tomboy.NotesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Firefox.PlacesItemSource "Firefox Places" encountered an error in UpdateItems: System.InvalidCastException: Cannot cast from source type to destination type. at Mono.Data.Sqlite.SqliteDataReader.VerifyType (Int32 i, DbType typ) [0x00000] in <filename unknown>:0 at Mono.Data.Sqlite.SqliteDataReader.GetString (Int32 i) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource+<LoadPlaceItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem].AddEnumerable (IEnumerable`1 enumerable) [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem]..ctor (IEnumerable`1 collection) [0x00000] in <filename unknown>:0 at System.Linq.Enumerable.ToArray[PlaceItem] (IEnumerable`1 source) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Do.Universe.Linux.GNOMESpecialLocationsItemSource "GNOME Special Locations" encountered an error in UpdateItems: System.IO.FileNotFoundException: Could not find file "/root/.gtk-bookmarks". File name: '/root/.gtk-bookmarks' at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share, Int32 bufferSize, Boolean anonymous, FileOptions options) [0x00000] in <filename unknown>:0 at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.FileStream:.ctor (string,System.IO.FileMode,System.IO.FileAccess,System.IO.FileShare) at System.IO.File.OpenRead (System.String path) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path, System.Text.Encoding encoding, Boolean detectEncodingFromByteOrderMarks, Int32 bufferSize) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.StreamReader:.ctor (string) at Do.Universe.Linux.GNOMESpecialLocationsItemSource+<ReadBookmarkItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at Do.Universe.Linux.GNOMESpecialLocationsItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . It stops when I try my key combination, ctrl-alt-. It does not pop up though.

    Read the article

  • .gitconfig error

    - by Tanner
    I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

    Read the article

  • File upload iis7

    - by maxwell
    Hi, I have a website and my users can browse the website for general information. If user wants to post any data, they need to register in the website. At the time of registration (in registration form) they can upload their photo. Once registration process is completed they can even modify the previously uploaded photo. My users are facing problem while they uploading their photo at the time of registration. I have given write permission to uploading files folder. But it is giving "Access denied" error. There should be a provision to upload files with or without logging into application. How can we achieve this?

    Read the article

  • In a Rails unit test, how can I get a User fixture to load its associated Profile?

    - by MikeJ
    In the documentation concerning Fixtures (http://api.rubyonrails.org/classes/Fixtures.html) they provide the following example of using label references for associations: ### in pirates.yml reginald: name: Reginald the Pirate monkey: george ### in monkeys.yml george: name: George the Monkey pirate: reginald So following their lead, I have a User model that has_one :profile, a Profile model that belongs_to :user, and tried to set up fixtures per their example: ### in users.yml reginald: id: 1 login: reginald ### in profiles.yml reginalds_profile: id: 1 name: Reginald the Pirate user: reginald (Note: since my association is one-way, the User fixture doesn't have a "profile: reginalds_profile" association--putting it in causes an error because the SQL table has no profile_id attribute.) The problem is, in my unit tests everything seems to load correctly, but users(:reginald).profile is always nil. What am I missing?

    Read the article

  • Crontab + rails3 + bundler

    - by mendelbenjamin
    I'm running a crontab that executes a rake task. I'm getting the following error (with MAILTO from crontab): rake aborted! no such file to load -- bundler /Users/Mendel/Sites/misnooit/Rakefile:4 (See full trace by running task with --trace) I'm using rvm with: ruby: ruby 1.9.1p378 rails: Rails 3.0.0.beta $GEM_HOME: /Users/Mendel/.rvm/gems/ruby-1.9.1-p378 bundler: bundler (0.9.11) The error is pretty self explanatory but I'm not able to fix it.. Is there someone with more knowledge about this matter? Thanks in advance.

    Read the article

  • LVDiff not working in Git

    - by Tanner
    I'm trying to get lvdiff from meta-diff suite to work with Git. My .gitconfig looks like this: [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabVIEW 3-Way Merge driver = 'C:/Program Files/National Instruments/Shared/LabVIEW Merge/LVMerge.exe' 'C:/Program Files/National Instruments/LabVIEW 8.6/LabVIEW.exe' %O %B %A %A recursive = binary [diff "lvdiff"] #command = 'C:/Program Files/meta-diff suite/lvdiff.exe' external = C:/Users/Tanner/Desktop/FIRST 2010 Beta/lvdiff.sh [core] autocrlf = true lvdiff.sh looks like this: #!/bin/sh "C:/Program Files/meta-diff suite/lvdiff.exe" "$2" "%5" | cat And my .gitattributes file looks like this: #Use a cusstom driver to merge LabVIEW files *.vi merge=labview #Use lvdiff as the externel diff program for LabVIEW files *.vi diff=lvdiff But everytime I do a diff, all Git returns is: diff --git a/Build DashBoard Data.vi b/Build DashBoard Data.vi index fd50547..662237f 100644 Binary files a/Build DashBoard Data.vi and b/Build DeashBoard Data.vi differ It is like it is not using it or even recognizing my changes. Any ideas?

    Read the article

  • Updating Lucene index from two different threads in a web application

    - by Jimmy
    Hi, I've a .net web application which uses Lucene.net for company search functionality. When registered users add a new company,it is saved to database and also gets indexed in Lucene based company search index in real time. When adding company in Lucene index, how do I handle use case of two or more logged-in users posting a new company at the same time?Also, will both these companies get indexed without any file lock, lock time out, etc. related issues? Would appreciate if i could help with code as well. Thanks.

    Read the article

  • atomic writes to ehcache

    - by Jacques René Mesrine
    Context I am storing a java.util.List inside ehcache. Key(String) --> List<UserDetail> The ordered List contains a Top 10 ranking of my most active users. Problem Concurrent 3rd party clients might be requesting for this list. I have a requirement to be as current as possible with regards to the ranking. Thus if the ranking is changed due the activities of users, the ordered List in the cache must not be left stale for very long. Once I've recalculated a new List, I want to replace the one in cache immediately. Consider a busy scenario whereby multiple concurrent clients are requesting for the ranking; how can I replace the cache item in an fashion such that: Clients can continue to pull a possibly stale snapshot. They should never get a null value. There will only be 1 server thread that writes to the cache.

    Read the article

  • iPhone - Web Access Authentication

    - by Terry
    I am building a secure app for our exec's... here is my setup. It's a somewhat Macgyver approach, but bear with me :) There are only 10 users, I have a record of each uniqueIdentifier on my backend in a database table. (This is internal only for our users, so I don't believe I am breaking the public user registration rule mentioned in the API docs) Through adhoc distribution I install my app on all 10 devices My app is simply composed of a UIWebView. When the app starts it does a POST to our https site sending the uniqueIdentifier. (Thanks to this answer) The server page that recieves the POST, checks the uniqueIdentifier and if found sets a session cookie that automatically logs them into the site. This way the user doesn't have to enter in their credentials every time. So what do you think, is there a security hole with this? Thanks

    Read the article

  • String search and write into file in jython

    - by kdev
    hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

    Read the article

  • Finding all the shortest paths between two nodes in unweighted directed graphs using BFS algorithm

    - by andra-isan
    Hi All, I am working on a problem that I need to find all the shortest path between two nodes in a given directed unweighted graph. I have used BFS algorithm to do the job, but unfortunately I can only print one shortest path not all of them, for example if they are 4 paths having lenght 3, my algorithm only prints the first one but I would like it to print all the four shortest paths. I was wondering in the following code, how should I change it so that all the shortest paths between two nodes could be printed out? class graphNode{ public: int id; string name; bool status; double weight;}; map<int, map<int,graphNode>* > graph; int Graph::BFS(graphNode &v, graphNode &w){ queue <int> q; map <int, int> map1; // this is to check if the node has been visited or not. std::string str= ""; map<int,int> inQ; // just to check that we do not insert the same iterm twice in the queue map <int, map<int, graphNode>* >::iterator pos; pos = graph.find(v.id); if(pos == graph.end()) { cout << v.id << " does not exists in the graph " <<endl; return 1; } int parents[graph.size()+1]; // this vector keeps track of the parents for the node parents[v.id] = -1; // there is a direct path between these two words, simply print that path as the shortest path if (findDirectEdge(v.id,w.id) == 1 ){ cout << " Shortest Path: " << v.id << " -> " << w.id << endl; return 1; } //if else{ int gn; map <int, map<int, graphNode>* >::iterator pos; q.push(v.id); inQ.insert(make_pair(v.id, v.id)); while (!q.empty()){ gn = q.front(); q.pop(); map<int, int>::iterator it; cout << " Popping: " << gn <<endl; map1.insert(make_pair(gn,gn)); //backtracing to print all the nodes if gn is the same as our target node such as w.id if (gn == w.id){ int current = w.id; cout << current << " - > "; while (current!=v.id){ current = parents[current]; cout << current << " -> "; } cout <<endl; } if ((pos = graph.find(gn)) == graph.end()) { cout << " pos is empty " <<endl; continue; } map<int, graphNode>* pn = pos->second; map<int, graphNode>::iterator p = pn->begin(); while(p != pn->end()) { map<int, int>::iterator it; //map1 keeps track of the visited nodes it = map1.find(p->first); graphNode gn1= p->second; if (it== map1.end()) { map<int, int>::iterator it1; //if the node already exits in the inQ, we do not insert it twice it1 = inQ.find(p->first); if (it1== inQ.end()){ parents[p->first] = gn; cout << " inserting " << p->first << " into the queue " <<endl; q.push(p->first); // add it to the queue } //if } //if p++; } //while } //while } I do appreciate all your great help Thanks, Andra

    Read the article

  • Co-Authors Wordpress Plugin: coauthors_wp_list_authors function not working correctly

    - by rayne
    The Co-Authors Plus Plugin for Wordpress has a very annoying bug. The custom function coauthors_wp_list_authors lists authors the same way the wordpress function wp_list_authors does, but it does not include authors in the list who don't have a post of their own - if they have only entries in which they are listed as co-author but not as author, they will not be included in the list. That is of course missing a very important point. I've looked at the faulty SQL statement, but unfortunately my knowledge of advanced SQL, especially when it comes to JOINs, as well as my knowledge of the wp database structure is too limited and I remain clueless. There is a topic in the WP support forum, but unfortunately the information there is very outdated and the fix is not applicable anymore. I couldn't find any other, more current solutions on the internet. I'd be glad if somewhere here could help fix the SQL statement so it also lists co-authors who don't have posts where they're the sole author, as well as display the correct post count for all authors. Here's the entire function for reference purposes with a comment marking the SQL statement: function coauthors_wp_list_authors($args = '') { global $wpdb, $coauthors_plus; $defaults = array( 'optioncount' => false, 'exclude_admin' => true, 'show_fullname' => false, 'hide_empty' => true, 'feed' => '', 'feed_image' => '', 'feed_type' => '', 'echo' => true, 'style' => 'list', 'html' => true ); $r = wp_parse_args( $args, $defaults ); extract($r, EXTR_SKIP); $return = ''; $authors = $wpdb->get_results("SELECT ID, user_nicename from $wpdb->users " . ($exclude_admin ? "WHERE user_login <> 'admin' " : '') . "ORDER BY display_name"); $author_count = array(); # this is the SQL statement which doesn't work correctly: $query = "SELECT DISTINCT $wpdb->users.ID AS post_author, $wpdb->terms.name AS user_name, $wpdb->term_taxonomy.count AS count"; $query .= " FROM $wpdb->posts"; $query .= " INNER JOIN $wpdb->term_relationships ON ($wpdb->posts.ID = $wpdb->term_relationships.object_id)"; $query .= " INNER JOIN $wpdb->term_taxonomy ON ($wpdb->term_relationships.term_taxonomy_id = $wpdb->term_taxonomy.term_taxonomy_id)"; $query .= " INNER JOIN $wpdb->terms ON ($wpdb->term_taxonomy.term_id = $wpdb->terms.term_id)"; $query .= " INNER JOIN $wpdb->users ON ($wpdb->terms.name = $wpdb->users.user_login)"; $query .= " WHERE post_type = 'post' AND " . get_private_posts_cap_sql( 'post' ); $query .= " AND $wpdb->term_taxonomy.taxonomy = '$coauthors_plus->coauthor_taxonomy'"; $query .= " GROUP BY post_author"; foreach ((array) $wpdb->get_results($query) as $row) { $author_count[$row->post_author] = $row->count; } foreach ( (array) $authors as $author ) { $link = ''; $author = get_userdata( $author->ID ); $posts = (isset($author_count[$author->ID])) ? $author_count[$author->ID] : 0; $name = $author->display_name; if ( $show_fullname && ($author->first_name != '' && $author->last_name != '') ) $name = "$author->first_name $author->last_name"; if( !$html ) { if ( $posts == 0 ) { if ( ! $hide_empty ) $return .= $name . ', '; } else $return .= $name . ', '; continue; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= '<li>'; if ( $posts == 0 ) { if ( ! $hide_empty ) $link = $name; } else { $link = '<a href="' . get_author_posts_url($author->ID, $author->user_nicename) . '" title="' . esc_attr( sprintf(__("Posts by %s", 'co-authors-plus'), $author->display_name) ) . '">' . $name . '</a>'; if ( (! empty($feed_image)) || (! empty($feed)) ) { $link .= ' '; if (empty($feed_image)) $link .= '('; $link .= '<a href="' . get_author_feed_link($author->ID) . '"'; if ( !empty($feed) ) { $title = ' title="' . esc_attr($feed) . '"'; $alt = ' alt="' . esc_attr($feed) . '"'; $name = $feed; $link .= $title; } $link .= '>'; if ( !empty($feed_image) ) $link .= "<img src=\"" . esc_url($feed_image) . "\" style=\"border: none;\"$alt$title" . ' />'; else $link .= $name; $link .= '</a>'; if ( empty($feed_image) ) $link .= ')'; } if ( $optioncount ) $link .= ' ('. $posts . ')'; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= $link . '</li>'; else if ( ! $hide_empty ) $return .= $link . ', '; } $return = trim($return, ', '); if ( ! $echo ) return $return; echo $return; }

    Read the article

  • Using dynamic parameters in email publisher subjectSettings block with CruiseControl.Net

    - by Joe
    I am trying to get dynamic parameters to be used in the email publisher's subjectSettings block. For example, <project> ... <parameters> <textParameter> <name>version</name> <display>Version to install</display> <description>The version to install.</description> <required>true</required> </textParameter> </parameters> <tasks> ... </tasks> <publishers> .... <email includeDetails="TRUE"> <from>buildmaster</from> <mailhost>localhost</mailhost> <users> <user name="Joe" group="buildmaster" address="jdavies" /> </users> <groups> <group name="buildmaster"> <notifications> <notificationType>Always</notificationType> </notifications> </group> <group name="users"> <notifications> <notificationType>Success</notificationType> <notificationType>Fixed</notificationType> </notifications> </group> </groups> <subjectSettings> <subject buildResult="Success" value="Version ${version} installed." /> <subject buildResult="Fixed" value="Version ${version} fixed and installed." /> </subjectSettings> <modifierNotificationTypes> <notificationType>Success</notificationType> </modifierNotificationTypes> </email> </project> I have tried using ${version} and $[version]. When I use $[version], the entire subject line is empty! Are dynamic parameters supported in this case, and if so, what am I doing wrong?

    Read the article

  • Psexec , cmd and batch file

    - by user311130
    Hello. I have a batch file named a.bat on a winserver2008 Desktop. That batch file only write the SessionID (from environment variable) to a local eventlog. I want to execute it remotely using cmd (otherwise the SessionName doesn't appear). so I have tried c:\PsTools\psexec.exe \\<Server> -u test2 -p <Password> -i 2 cmd "c:\Users\test-2\Desktop\a" or c:\PsTools\psexec.exe \\<server> -u test2 -p <Password> -i 2 "cmd \"c:\Users\test-2\Desktop\a\"";exit all of these just open a terminal on the remote machine but don't execute the batch. Any ides? Best Regards,

    Read the article

  • Macports sudo expands ~ to /var/root in python

    - by calavera
    This might be a bit dev-heavy for the site... but here goes. I installed the macports version of sudo. All is well, except for one thing. Using python 2.6 to expand ~ to the user's home directory results in a different output than the version of sudo that comes with Snow Leopard. For example consider the following python code: #expand_home_dir.py import os os.path.expanduser('~') Below are 3 different calls of the code listed above. The first call using sudo is using the Macports version because my $PATH begins with /opt/local/bin: robert$ python2.6 expand_home_dir.py /Users/robert robert$ sudo python2.6 expand_home_dir.py /var/root robert$ /usr/bin/sudo python2.6 expand_home_dir.py /Users/robert Any idea why this is happening?

    Read the article

  • Jersey, Spring, Tomcat and Security Annotations

    - by jr
    I need to secure a simple jersey RESTful API in a Tomcat 6.0.24 container. I'd like to keep the authentication with Basic Authentication using the tomcat-users.xml file to define the users and roles (this is for now, like I said its small). Now, for authorization I'd like to be able to use the JSR 250 annotations like @RolesAllowed, @PermitAll, @DenyAll, etc. I cannot for the life of me figure out how to wire this all up together. I really don't want to go spring-security route, since I need something very simple at the current time. Can someone point me in the right direction.

    Read the article

  • Software to create a knowledge base/FAQ system

    - by H1Man
    Our company is looking to build a web-based knowledge base system that can be used by our clients/end users to reduce the amount of support calls. Couple important notes: This is aimed at our end users, in other words, non-techies. So the UI has to be easy to use Should have the excellent (fast, accurate) search Should have ability to rate and comment on articles This will only be maintained by one or 2 people, so security isn't a big concern Something similar to what Microsoft is doing with their Knowledge Base. http://support.microsoft.com/search/ Does anyone have any recommendations on what software I can use? Thanks, H. Edit: I should have made this clear before but I don't mean build as in having our developers build a support/kb system from the ground up. I am looking to use a existing software package/solution that can be used to implement a knowledge base/support site.

    Read the article

  • C++ Mutexes and STL Lists Across Subclasses

    - by Genesis
    I am currently writing a multi-threaded C++ server using Poco and am now at the point where I need to be keeping information on which users are connected, how many connections each of them have, and given it is a proxy server, where each of those connections are proxying through to. For this purpose I have created a ServerStats class which holds an STL list of ServerUser objects. The ServerStats class includes functions which can add and remove objects from the list as well as find a user in the list an return a pointer to them so I can access member functions within any given ServerUser object in the list. The ServerUser class contains an STL list of ServerConnection objects and much like the ServerStats class it contains functions to add, remove and find elements within this list. Now all of the above is working but I am now trying to make it threadsafe. I have defined a Poco::FastMutex within the ServerStats class and can lock/unlock this in the appropriate places so that STL containers are not modified at the same time as being searched for example. I am however having an issue setting up mutexes within the ServerUser class and am getting the following compiler error: /root/poco/Foundation/include/Poco/Mutex.h: In copy constructor âServerUser::ServerUser(const ServerUser&)â: src/SocksServer.cpp:185: instantiated from âvoid __gnu_cxx::new_allocator<_Tp::construct(_Tp*, const _Tp&) [with _Tp = ServerUser]â /usr/include/c++/4.4/bits/stl_list.h:464: instantiated from âstd::_List_node<_Tp* std::list<_Tp, _Alloc::_M_create_node(const _Tp&) [with _Tp = ServerUser, _Alloc = std::allocator]â /usr/include/c++/4.4/bits/stl_list.h:1407: instantiated from âvoid std::list<_Tp, _Alloc::_M_insert(std::_List_iterator<_Tp, const _Tp&) [with _Tp = ServerUser, _Alloc = std::allocator]â /usr/include/c++/4.4/bits/stl_list.h:920: instantiated from âvoid std::list<_Tp, _Alloc::push_back(const _Tp&) [with _Tp = ServerUser, _Alloc = std::allocator]â src/SocksServer.cpp:301: instantiated from here /root/poco/Foundation/include/Poco/Mutex.h:164: error: âPoco::FastMutex::FastMutex(const Poco::FastMutex&)â is private src/SocksServer.cpp:185: error: within this context In file included from /usr/include/c++/4.4/x86_64-linux-gnu/bits/c++allocator.h:34, from /usr/include/c++/4.4/bits/allocator.h:48, from /usr/include/c++/4.4/string:43, from /root/poco/Foundation/include/Poco/Bugcheck.h:44, from /root/poco/Foundation/include/Poco/Foundation.h:147, from /root/poco/Net/include/Poco/Net/Net.h:45, from /root/poco/Net/include/Poco/Net/TCPServerParams.h:43, from src/SocksServer.cpp:1: /usr/include/c++/4.4/ext/new_allocator.h: In member function âvoid __gnu_cxx::new_allocator<_Tp::construct(_Tp*, const _Tp&) [with _Tp = ServerUser]â: /usr/include/c++/4.4/ext/new_allocator.h:105: note: synthesized method âServerUser::ServerUser(const ServerUser&)â first required here src/SocksServer.cpp: At global scope: src/SocksServer.cpp:118: warning: âstd::string getWord(std::string)â defined but not used make: * [/root/poco/SocksServer/obj/Linux/x86_64/debug_shared/SocksServer.o] Error 1 The code for the ServerStats, ServerUser and ServerConnection classes is below: class ServerConnection { public: bool continue_connection; int bytes_in; int bytes_out; string source_address; string destination_address; ServerConnection() { continue_connection = true; } ~ServerConnection() { } }; class ServerUser { public: string username; int connection_count; string client_ip; ServerUser() { } ~ServerUser() { } ServerConnection* addConnection(string source_address, string destination_address) { //FastMutex::ScopedLock lock(_connection_mutex); ServerConnection connection; connection.source_address = source_address; connection.destination_address = destination_address; client_ip = getWord(source_address, ":"); _connections.push_back(connection); connection_count++; return &_connections.back(); } void removeConnection(string source_address) { //FastMutex::ScopedLock lock(_connection_mutex); for(list<ServerConnection>::iterator it = _connections.begin(); it != _connections.end(); it++) { if(it->source_address == source_address) { it = _connections.erase(it); connection_count--; } } } void disconnect() { //FastMutex::ScopedLock lock(_connection_mutex); for(list<ServerConnection>::iterator it = _connections.begin(); it != _connections.end(); it++) { it->continue_connection = false; } } list<ServerConnection>* getConnections() { return &_connections; } private: list<ServerConnection> _connections; //UNCOMMENTING THIS LINE BREAKS IT: //mutable FastMutex _connection_mutex; }; class ServerStats { public: int current_users; ServerStats() { current_users = 0; } ~ServerStats() { } ServerUser* addUser(string username) { FastMutex::ScopedLock lock(_user_mutex); for(list<ServerUser>::iterator it = _users.begin(); it != _users.end(); it++) { if(it->username == username) { return &(*it); } } ServerUser newUser; newUser.username = username; _users.push_back(newUser); current_users++; return &_users.back(); } void removeUser(string username) { FastMutex::ScopedLock lock(_user_mutex); for(list<ServerUser>::iterator it = _users.begin(); it != _users.end(); it++) { if(it->username == username) { _users.erase(it); current_users--; break; } } } ServerUser* getUser(string username) { FastMutex::ScopedLock lock(_user_mutex); for(list<ServerUser>::iterator it = _users.begin(); it != _users.end(); it++) { if(it->username == username) { return &(*it); } } return NULL; } private: list<ServerUser> _users; mutable FastMutex _user_mutex; }; Now I have never used C++ for a project of this size or mutexes for that matter so go easy please :) Firstly, can anyone tell me why the above is causing a compiler error? Secondly, can anyone suggest a better way of storing the information I require? Bear in mind that I need to update this info whenever connections come or go and it needs to be global to the whole server.

    Read the article

< Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >