Search Results

Search found 47324 results on 1893 pages for 'end users'.

Page 441/1893 | < Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >

• Are PackageMaker installations with preinstall scripts broken on Snow Leopard?

  - by Stu Thompson

  Everything worked on 10.5, but now my PackageMaker installation project is broken. I've been fighting a problem for a few days now, and either Snow Leopard (OS X 10.6.1) has broken PackageMaker installations I am lacking a very, very basic tidbit of knowledge To narrow down the problem, I've gotten to this point: Create a new PackageMaker installation Have it install a jpeg image into my home directoy Define a preinstall script that does nothing #/bin/sh exit 0 Run the above...and watch it fail with the below error message like clock work Sep 14 15:09:45 manoa installd[5620]: PackageKit: ----- Begin install ----- Sep 14 15:09:45 manoa installd[5620]: PackageKit: request=PKInstallRequest <1 packages, destination=/> Sep 14 15:09:45 manoa installd[5620]: PackageKit: packages=(\n "PKLeopardPackage <file://localhost/Users/stu/Desktop/asdf.pkg>"\n) Sep 14 15:09:46 manoa installd[5620]: PackageKit: Extracting /Users/stu/Desktop/asdf.pkg (destination=/var/folders/Hb/HbXJFyEpFaupt5QyLN-pTk+++TI/-Tmp-/PKInstallSandbox-tmp/Root/~, uid=501) Sep 14 15:09:46 manoa installd[5620]: PackageKit: Executing script "./preinstall" in /private/tmp/PKInstallSandbox.cmlS2H/Scripts/test.test.5year_header.pkg.PFrHNB Sep 14 15:09:46 manoa installd[5620]: PackageKit: *** launch path not accessible Sep 14 15:09:46 manoa installd[5620]: PackageKit: Install Failed: PKG: pre-install scripts for "test.test.5year_header.pkg"\nError Domain=PKInstallErrorDomain Code=112 UserInfo=0x100149430 "An error occurred while running scripts from the package “asdf”." {\n NSFilePath = "./preinstall";\n NSLocalizedDescription = "An error occurred while running scripts from the package \U201casdf\U201d.";\n NSURL = "file://localhost/Users/stu/Desktop/asdf.pkg";\n PKInstallPackageIdentifier = "test.test.5year_header.pkg";\n} Sep 14 15:09:46 manoa Installer[5614]: install:didFailWithError:Error Domain=PKInstallErrorDomain Code=112 UserInfo=0x1195917c0 "An error occurred while running scripts from the package “asdf”." Sep 14 15:09:46 manoa Installer[5614]: Install failed: The Installer encountered an error that caused the installation to fail. Contact the software manufacturer for assistance. Sep 14 15:09:47 manoa Installer[5614]: IFDInstallController 144040 state = 7 Sep 14 15:09:47 manoa Installer[5614]: Displaying 'Install Failed' UI. Sep 14 15:09:47 manoa Installer[5614]: 'Install Failed' UI displayed message:'The Installer encountered an error that caused the installation to fail. Contact the software manufacturer for assistance.'. There is no file in /private/tmp/PKInstallSandbox.cmlS2H/Scripts/test.test.5year_header.pkg.PFrHNB/, which makes me think the problem is with PackageMaker, and not me. But I'm new to the world of OS X software installation, so doubts remain. So, the question: Is PackageMaker with a preinstall script broken on OS X 10.6? Or is there some requirement regarding preinstall scripts that I do not understand?

  Read the article

• Is it possible to get the client process ID of an application that runs on SQL server?

  - by Andrea.Ko

  Hi all, For my VFP application, i have a program to check currently who is accessing the server (by using sp_who2), also another progam to check who is currently locking which table. But i wish to know which options my users is accessing at the moment. Am thinking if i can write a SP to get the current connected process ID for a specific client, and insert to a table(ActLog) in SQL with the program name pass into this table during users load the program. And delete that particular record when user unload the program. Then from the ActLog, i can know who is currently accessing to which program. At the moment, i wish to know if i able to get the client process ID? rgds/Andrea

  Read the article

• Sublime Text 2 Keyboard shortcut to open file in Chrome/firefox in windows

  - by samdroid

  I followed the instruction for windows 7 to setup chrome. No luck! { "cmd":["C:\Program Files (x86)\Google\Chrome\Application", "$C:\Users\gmu\Desktop\June_15_2012"] } after entering the file location/path under what format should I have to save. I am a noobie. sorry to ask this question. Anything helps! If I press f7 getting the following message Error trying to parse build system: Invalid escape in C:\Users\gmu\AppData\Roaming\Sublime Text2\Packages\User\Chrome.sublime-build:2:9 Thanks

  Read the article

• How to query Entities in Entity Framework 4

  - by Picflight

  In VS2008, I think it is EF1.0, this works just fine. string queryString = @"SELECT VALUE USERS FROM ProjectDBEntities.Users AS User INNER JOIN ProjectDBEntities.Favorites AS F ON F.FavUserId = User.UserId WHERE F.UserId = " + 3 + " ORDER BY F.CreateDate DESC "; System.Data.Objects.ObjectQuery<User> usersQuery = new System.Data.Objects.ObjectQuery<User>(queryString, context).Include("Detail"); //int count = usersQuery.Count(); foreach (User result in usersQuery) Console.WriteLine("User Name: {0}", result.UserName); Same code in VS2010 EF4 it crashes on the foreach loop with the following error: The result type of the query is neither an EntityType nor a CollectionType with an entity element type. An Include path can only be specified for a query with one of these result types.

  Read the article

• Useful keyboard shortcuts and tips for ESS/R

  - by ggg

  I would like to ask regular ESS/R users what key bindings do they use frequently and tips on using ESS/R.

  Read the article

• Gnome Do not Launching

  - by PyRulez

  When I try running gnome do, I get this. chris@Chris-Ubuntu-Laptop:~$ gnome-do pgrep: invalid user name: -u and it is not writable Trying sudo: chris@Chris-Ubuntu-Laptop:~$ sudo gnome-do [NetworkService] Could not initialize Network Manager dbus: Unable to open the session message bus. [Error 17:54:30.122] [SystemService] Could not initialize dbus: Unable to open the session message bus. (Do:2401): Wnck-CRITICAL **: wnck_set_client_type got called multiple times. (Do:2401): libdo-WARNING **: Binding '<Super>space' failed! [Error 17:54:30.649] [AbstractKeyBindingService] Key "" is already mapped. Tomboy.NotesItemSource "Tomboy Notes" encountered an error in UpdateItems: System.TypeInitializationException: An exception was thrown by the type initializer for Tomboy.TomboyDBus ---> System.Exception: Unable to open the session message bus. ---> System.ArgumentNullException: Argument cannot be null. Parameter name: address at NDesk.DBus.Bus.Open (System.String address) [0x00000] in <filename unknown>:0 at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 at Tomboy.TomboyDBus..cctor () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at Tomboy.NotesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Firefox.PlacesItemSource "Firefox Places" encountered an error in UpdateItems: System.InvalidCastException: Cannot cast from source type to destination type. at Mono.Data.Sqlite.SqliteDataReader.VerifyType (Int32 i, DbType typ) [0x00000] in <filename unknown>:0 at Mono.Data.Sqlite.SqliteDataReader.GetString (Int32 i) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource+<LoadPlaceItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem].AddEnumerable (IEnumerable`1 enumerable) [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem]..ctor (IEnumerable`1 collection) [0x00000] in <filename unknown>:0 at System.Linq.Enumerable.ToArray[PlaceItem] (IEnumerable`1 source) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Do.Universe.Linux.GNOMESpecialLocationsItemSource "GNOME Special Locations" encountered an error in UpdateItems: System.IO.FileNotFoundException: Could not find file "/root/.gtk-bookmarks". File name: '/root/.gtk-bookmarks' at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share, Int32 bufferSize, Boolean anonymous, FileOptions options) [0x00000] in <filename unknown>:0 at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.FileStream:.ctor (string,System.IO.FileMode,System.IO.FileAccess,System.IO.FileShare) at System.IO.File.OpenRead (System.String path) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path, System.Text.Encoding encoding, Boolean detectEncodingFromByteOrderMarks, Int32 bufferSize) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.StreamReader:.ctor (string) at Do.Universe.Linux.GNOMESpecialLocationsItemSource+<ReadBookmarkItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at Do.Universe.Linux.GNOMESpecialLocationsItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . ^[^\Full thread dump: "<unnamed thread>" tid=0x0xb7570700 this=0x0x56f18 thread handle 0x403 state : not waiting owns () at (wrapper managed-to-native) Mono.Unix.Native.Syscall.read (int,intptr,ulong) <0xffffffff> at Mono.Unix.Native.Syscall.read (int,void*,ulong) <0x00023> at Mono.Unix.UnixStream.Read (byte[],int,int) <0x0008b> at NDesk.DBus.Connection.ReadMessage () <0x0003c> at NDesk.DBus.Connection.Iterate () <0x0001b> at NDesk.DBus.BusG/<Init>c__AnonStorey0.<>m__0 (intptr,NDesk.GLib.IOCondition,intptr) <0x00033> at (wrapper native-to-managed) NDesk.DBus.BusG/<Init>c__AnonStorey0.<>m__0 (intptr,NDesk.GLib.IOCondition,intptr) <0xffffffff> at (wrapper managed-to-native) Gtk.Clipboard.gtk_clipboard_wait_is_text_available (intptr) <0xffffffff> at Gtk.Clipboard.WaitIsTextAvailable () <0x00017> at Do.Universe.SelectedTextItem.UpdateSelection (object,System.EventArgs) <0x00027> at Do.Platform.AbstractApplicationService.OnSummoned () <0x00025> at Do.Platform.ApplicationService.<ApplicationService>m__31 (object,System.EventArgs) <0x00013> at Do.Core.Controller.OnSummoned () <0x00025> at Do.Core.Controller.Summon () <0x00027> at Do.Do.Main (string[]) <0x001eb> at (wrapper runtime-invoke) <Module>.runtime_invoke_void_object (object,intptr,intptr,intptr) <0xffffffff> "<unnamed thread>" tid=0x0xb2c81b40 this=0x0x194150 thread handle 0x412 state : interrupted state owns () at (wrapper managed-to-native) System.IO.InotifyWatcher.ReadFromFD (intptr,byte[],intptr) <0xffffffff> at System.IO.InotifyWatcher.Monitor () <0x0005f> at System.Threading.Thread.StartInternal () <0x00057> at (wrapper runtime-invoke) object.runtime_invoke_void__this__ (object,intptr,intptr,intptr) <0xffffffff> "Universe Update Dispatcher" tid=0x0xb29ffb40 this=0x0x569d8 thread handle 0x41b state : interrupted state owns () at (wrapper managed-to-native) System.Threading.WaitHandle.WaitOne_internal (System.Threading.WaitHandle,intptr,int,bool) <0xffffffff> at System.Threading.WaitHandle.WaitOne (System.TimeSpan,bool) <0x00133> at System.Threading.WaitHandle.WaitOne (System.TimeSpan) <0x00022> at Do.Core.UniverseManager.UniverseUpdateLoop () <0x0007a> at System.Threading.Thread.StartInternal () <0x00057> at (wrapper runtime-invoke) object.runtime_invoke_void__this__ (object,intptr,intptr,intptr) <0xffffffff> Tomboy.NotesItemSource "Tomboy Notes" encountered an error in UpdateItems: System.TypeInitializationException: An exception was thrown by the type initializer for Tomboy.TomboyDBus ---> System.Exception: Unable to open the session message bus. ---> System.ArgumentNullException: Argument cannot be null. Parameter name: address at NDesk.DBus.Bus.Open (System.String address) [0x00000] in <filename unknown>:0 at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at NDesk.DBus.Bus.get_Session () [0x00000] in <filename unknown>:0 at Tomboy.TomboyDBus..cctor () [0x00000] in <filename unknown>:0 --- End of inner exception stack trace --- at Tomboy.NotesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Firefox.PlacesItemSource "Firefox Places" encountered an error in UpdateItems: System.InvalidCastException: Cannot cast from source type to destination type. at Mono.Data.Sqlite.SqliteDataReader.VerifyType (Int32 i, DbType typ) [0x00000] in <filename unknown>:0 at Mono.Data.Sqlite.SqliteDataReader.GetString (Int32 i) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource+<LoadPlaceItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem].AddEnumerable (IEnumerable`1 enumerable) [0x00000] in <filename unknown>:0 at System.Collections.Generic.List`1[Firefox.PlaceItem]..ctor (IEnumerable`1 collection) [0x00000] in <filename unknown>:0 at System.Linq.Enumerable.ToArray[PlaceItem] (IEnumerable`1 source) [0x00000] in <filename unknown>:0 at Firefox.PlacesItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . Do.Universe.Linux.GNOMESpecialLocationsItemSource "GNOME Special Locations" encountered an error in UpdateItems: System.IO.FileNotFoundException: Could not find file "/root/.gtk-bookmarks". File name: '/root/.gtk-bookmarks' at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share, Int32 bufferSize, Boolean anonymous, FileOptions options) [0x00000] in <filename unknown>:0 at System.IO.FileStream..ctor (System.String path, FileMode mode, FileAccess access, FileShare share) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.FileStream:.ctor (string,System.IO.FileMode,System.IO.FileAccess,System.IO.FileShare) at System.IO.File.OpenRead (System.String path) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path, System.Text.Encoding encoding, Boolean detectEncodingFromByteOrderMarks, Int32 bufferSize) [0x00000] in <filename unknown>:0 at System.IO.StreamReader..ctor (System.String path) [0x00000] in <filename unknown>:0 at (wrapper remoting-invoke-with-check) System.IO.StreamReader:.ctor (string) at Do.Universe.Linux.GNOMESpecialLocationsItemSource+<ReadBookmarkItems>c__Iterator3.MoveNext () [0x00000] in <filename unknown>:0 at Do.Universe.Linux.GNOMESpecialLocationsItemSource.UpdateItems () [0x00000] in <filename unknown>:0 at Do.Universe.Safe.SafeItemSource.UpdateItems () [0x00000] in <filename unknown>:0 . It stops when I try my key combination, ctrl-alt-. It does not pop up though.

  Read the article

• Win32 API Question

  - by Lalit_M

  We have developed a ASP.NET web application and has implemented a custom authentication solution using active directory as the credentials store. Our front end application uses a normal login form to capture the user name and password and leverages the Win32 LogonUser method to authenticate the user’s credentials. When we are calling the LogonUser method, we are using the LOGON32_LOGON_NETWORK as the logon type. The issue we have found is that user profile folders are being created under the C:\Users folder of the web server. The folder seems to be created when a new user who has never logged on before is logging in for the first time. As the number of new users logging into the application grows, disk space is shrinking due to the large number of new user folders getting created. Has anyone seen this behavior with the Win32 LogonUser method? Does anyone know how to disable this behavior?

  Read the article

• Deployment of SQL compact Edition (SDF files) using Setup project

  - by Emad

  Hi, I have a C#.NET desktop application using SQL Compact edition as data store. The application should be used by any user on the machine and all should be seeing the same data ( data should not different per user). I am wondering where should I deploy the SDF file? User's Personal data folder (My Documents) means each user will have a separate database. Deploying on the same folder as the application causes vista to copy the file to \USers\Appdata\local\VirtualStore\ and it seems to make different copies for each user. Where is it best to deploy the SDF file to ensure all users are looking at the same data?

  Read the article

• File upload iis7

  - by maxwell

  Hi, I have a website and my users can browse the website for general information. If user wants to post any data, they need to register in the website. At the time of registration (in registration form) they can upload their photo. Once registration process is completed they can even modify the previously uploaded photo. My users are facing problem while they uploading their photo at the time of registration. I have given write permission to uploading files folder. But it is giving "Access denied" error. There should be a provision to upload files with or without logging into application. How can we achieve this?

  Read the article

• In a Rails unit test, how can I get a User fixture to load its associated Profile?

  - by MikeJ

  In the documentation concerning Fixtures (http://api.rubyonrails.org/classes/Fixtures.html) they provide the following example of using label references for associations: ### in pirates.yml reginald: name: Reginald the Pirate monkey: george ### in monkeys.yml george: name: George the Monkey pirate: reginald So following their lead, I have a User model that has_one :profile, a Profile model that belongs_to :user, and tried to set up fixtures per their example: ### in users.yml reginald: id: 1 login: reginald ### in profiles.yml reginalds_profile: id: 1 name: Reginald the Pirate user: reginald (Note: since my association is one-way, the User fixture doesn't have a "profile: reginalds_profile" association--putting it in causes an error because the SQL table has no profile_id attribute.) The problem is, in my unit tests everything seems to load correctly, but users(:reginald).profile is always nil. What am I missing?

  Read the article

• .gitconfig error

  - by Tanner

  I edited my .gitconfig file to add support for LabView and it appears that I did something that Git doesn't exactly like. The problem is it (Git) doesn't tell me what it doesn't like. What did I do wrong? The error message doesn't help much either: "fatal: bad config file line 13 in c:/Users/Tanner/.gitconfig" [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabView 3-Way Merge driver = “C:\Program Files\National Instruments\Shared\LabVIEW Merge\LVMerge.exe” “C:\Program Files\National Instruments\LabVIEW 8.6\LabVIEW.exe” %O %B %A %A recursive = binary And I'm not seeing a line 13, but usually that would mean something is wrong at the end? I don't know, Git is new to me.

  Read the article

• atomic writes to ehcache

  - by Jacques René Mesrine

  Context I am storing a java.util.List inside ehcache. Key(String) --> List<UserDetail> The ordered List contains a Top 10 ranking of my most active users. Problem Concurrent 3rd party clients might be requesting for this list. I have a requirement to be as current as possible with regards to the ranking. Thus if the ranking is changed due the activities of users, the ordered List in the cache must not be left stale for very long. Once I've recalculated a new List, I want to replace the one in cache immediately. Consider a busy scenario whereby multiple concurrent clients are requesting for the ranking; how can I replace the cache item in an fashion such that: Clients can continue to pull a possibly stale snapshot. They should never get a null value. There will only be 1 server thread that writes to the cache.

  Read the article

• Updating Lucene index from two different threads in a web application

  - by Jimmy

  Hi, I've a .net web application which uses Lucene.net for company search functionality. When registered users add a new company,it is saved to database and also gets indexed in Lucene based company search index in real time. When adding company in Lucene index, how do I handle use case of two or more logged-in users posting a new company at the same time?Also, will both these companies get indexed without any file lock, lock time out, etc. related issues? Would appreciate if i could help with code as well. Thanks.

  Read the article

• iPhone - Web Access Authentication

  - by Terry

  I am building a secure app for our exec's... here is my setup. It's a somewhat Macgyver approach, but bear with me :) There are only 10 users, I have a record of each uniqueIdentifier on my backend in a database table. (This is internal only for our users, so I don't believe I am breaking the public user registration rule mentioned in the API docs) Through adhoc distribution I install my app on all 10 devices My app is simply composed of a UIWebView. When the app starts it does a POST to our https site sending the uniqueIdentifier. (Thanks to this answer) The server page that recieves the POST, checks the uniqueIdentifier and if found sets a session cookie that automatically logs them into the site. This way the user doesn't have to enter in their credentials every time. So what do you think, is there a security hole with this? Thanks

  Read the article

• Crontab + rails3 + bundler

  - by mendelbenjamin

  I'm running a crontab that executes a rake task. I'm getting the following error (with MAILTO from crontab): rake aborted! no such file to load -- bundler /Users/Mendel/Sites/misnooit/Rakefile:4 (See full trace by running task with --trace) I'm using rvm with: ruby: ruby 1.9.1p378 rails: Rails 3.0.0.beta $GEM_HOME: /Users/Mendel/.rvm/gems/ruby-1.9.1-p378 bundler: bundler (0.9.11) The error is pretty self explanatory but I'm not able to fix it.. Is there someone with more knowledge about this matter? Thanks in advance.

  Read the article

• LVDiff not working in Git

  - by Tanner

  I'm trying to get lvdiff from meta-diff suite to work with Git. My .gitconfig looks like this: [gui] recentrepo = C:/Users/Tanner/Desktop/FIRST 2010 Beta/Java/LoganRover [user] name = Tanner Smith email = [email protected] [merge "labview"] name = LabVIEW 3-Way Merge driver = 'C:/Program Files/National Instruments/Shared/LabVIEW Merge/LVMerge.exe' 'C:/Program Files/National Instruments/LabVIEW 8.6/LabVIEW.exe' %O %B %A %A recursive = binary [diff "lvdiff"] #command = 'C:/Program Files/meta-diff suite/lvdiff.exe' external = C:/Users/Tanner/Desktop/FIRST 2010 Beta/lvdiff.sh [core] autocrlf = true lvdiff.sh looks like this: #!/bin/sh "C:/Program Files/meta-diff suite/lvdiff.exe" "$2" "%5" | cat And my .gitattributes file looks like this: #Use a cusstom driver to merge LabVIEW files *.vi merge=labview #Use lvdiff as the externel diff program for LabVIEW files *.vi diff=lvdiff But everytime I do a diff, all Git returns is: diff --git a/Build DashBoard Data.vi b/Build DashBoard Data.vi index fd50547..662237f 100644 Binary files a/Build DashBoard Data.vi and b/Build DeashBoard Data.vi differ It is like it is not using it or even recognizing my changes. Any ideas?

  Read the article

• Using dynamic parameters in email publisher subjectSettings block with CruiseControl.Net

  - by Joe

  I am trying to get dynamic parameters to be used in the email publisher's subjectSettings block. For example, <project> ... <parameters> <textParameter> <name>version</name> <display>Version to install</display> <description>The version to install.</description> <required>true</required> </textParameter> </parameters> <tasks> ... </tasks> <publishers> .... <email includeDetails="TRUE"> <from>buildmaster</from> <mailhost>localhost</mailhost> <users> <user name="Joe" group="buildmaster" address="jdavies" /> </users> <groups> <group name="buildmaster"> <notifications> <notificationType>Always</notificationType> </notifications> </group> <group name="users"> <notifications> <notificationType>Success</notificationType> <notificationType>Fixed</notificationType> </notifications> </group> </groups> <subjectSettings> <subject buildResult="Success" value="Version ${version} installed." /> <subject buildResult="Fixed" value="Version ${version} fixed and installed." /> </subjectSettings> <modifierNotificationTypes> <notificationType>Success</notificationType> </modifierNotificationTypes> </email> </project> I have tried using ${version} and $[version]. When I use $[version], the entire subject line is empty! Are dynamic parameters supported in this case, and if so, what am I doing wrong?

  Read the article

• String search and write into file in jython

  - by kdev

  hi Everyone , i wish to write a program that can read a file and if a particular str_to_find is found in a bigger string say AACATGCCACCTGAATTGGATGGAATTCATGCGGGACACGCGGATTACACCTATGAGCAGAAATACGGCCTGCGCGATTACCGTGGCGGTGGACGTTCTTCCGCGCGTGAAACCGCGATGCGCGTAGCGGCAGGGGCGATCGCCAAGAAATACCTGGCGGAAAAGTTCGGCATCGAAATCCGCGGCTGCCTGACCCAGATGGGCGACATTCCGCTGGAGATTAAAGACTGGCGTCAGGTTGAGCTTAATCCGTTTTC then write that line and the above line of it into the file and keep repeating it for all the match found. Please suggest i have written the program for printing that particular search line but i dont know how to write the above line. Thanks everyone for your help. import re import string file=open('C:/Users/Administrator/Desktop/input.txt','r') output=open('C:/Users/Administrator/Desktop/output.txt','w') count_record=file.readline() str_to_find='AACCATGC' while count_record: if string.find(list,str_to_find) ==0: output.write(count_record) file.close() output.close()

  Read the article

• Macports sudo expands ~ to /var/root in python

  - by calavera

  This might be a bit dev-heavy for the site... but here goes. I installed the macports version of sudo. All is well, except for one thing. Using python 2.6 to expand ~ to the user's home directory results in a different output than the version of sudo that comes with Snow Leopard. For example consider the following python code: #expand_home_dir.py import os os.path.expanduser('~') Below are 3 different calls of the code listed above. The first call using sudo is using the Macports version because my $PATH begins with /opt/local/bin: robert$ python2.6 expand_home_dir.py /Users/robert robert$ sudo python2.6 expand_home_dir.py /var/root robert$ /usr/bin/sudo python2.6 expand_home_dir.py /Users/robert Any idea why this is happening?

  Read the article

• Finding all the shortest paths between two nodes in unweighted directed graphs using BFS algorithm

  - by andra-isan

  Hi All, I am working on a problem that I need to find all the shortest path between two nodes in a given directed unweighted graph. I have used BFS algorithm to do the job, but unfortunately I can only print one shortest path not all of them, for example if they are 4 paths having lenght 3, my algorithm only prints the first one but I would like it to print all the four shortest paths. I was wondering in the following code, how should I change it so that all the shortest paths between two nodes could be printed out? class graphNode{ public: int id; string name; bool status; double weight;}; map<int, map<int,graphNode>* > graph; int Graph::BFS(graphNode &v, graphNode &w){ queue <int> q; map <int, int> map1; // this is to check if the node has been visited or not. std::string str= ""; map<int,int> inQ; // just to check that we do not insert the same iterm twice in the queue map <int, map<int, graphNode>* >::iterator pos; pos = graph.find(v.id); if(pos == graph.end()) { cout << v.id << " does not exists in the graph " <<endl; return 1; } int parents[graph.size()+1]; // this vector keeps track of the parents for the node parents[v.id] = -1; // there is a direct path between these two words, simply print that path as the shortest path if (findDirectEdge(v.id,w.id) == 1 ){ cout << " Shortest Path: " << v.id << " -> " << w.id << endl; return 1; } //if else{ int gn; map <int, map<int, graphNode>* >::iterator pos; q.push(v.id); inQ.insert(make_pair(v.id, v.id)); while (!q.empty()){ gn = q.front(); q.pop(); map<int, int>::iterator it; cout << " Popping: " << gn <<endl; map1.insert(make_pair(gn,gn)); //backtracing to print all the nodes if gn is the same as our target node such as w.id if (gn == w.id){ int current = w.id; cout << current << " - > "; while (current!=v.id){ current = parents[current]; cout << current << " -> "; } cout <<endl; } if ((pos = graph.find(gn)) == graph.end()) { cout << " pos is empty " <<endl; continue; } map<int, graphNode>* pn = pos->second; map<int, graphNode>::iterator p = pn->begin(); while(p != pn->end()) { map<int, int>::iterator it; //map1 keeps track of the visited nodes it = map1.find(p->first); graphNode gn1= p->second; if (it== map1.end()) { map<int, int>::iterator it1; //if the node already exits in the inQ, we do not insert it twice it1 = inQ.find(p->first); if (it1== inQ.end()){ parents[p->first] = gn; cout << " inserting " << p->first << " into the queue " <<endl; q.push(p->first); // add it to the queue } //if } //if p++; } //while } //while } I do appreciate all your great help Thanks, Andra

  Read the article

• Software to create a knowledge base/FAQ system

  - by H1Man

  Our company is looking to build a web-based knowledge base system that can be used by our clients/end users to reduce the amount of support calls. Couple important notes: This is aimed at our end users, in other words, non-techies. So the UI has to be easy to use Should have the excellent (fast, accurate) search Should have ability to rate and comment on articles This will only be maintained by one or 2 people, so security isn't a big concern Something similar to what Microsoft is doing with their Knowledge Base. http://support.microsoft.com/search/ Does anyone have any recommendations on what software I can use? Thanks, H. Edit: I should have made this clear before but I don't mean build as in having our developers build a support/kb system from the ground up. I am looking to use a existing software package/solution that can be used to implement a knowledge base/support site.

  Read the article

• Jersey, Spring, Tomcat and Security Annotations

  - by jr

  I need to secure a simple jersey RESTful API in a Tomcat 6.0.24 container. I'd like to keep the authentication with Basic Authentication using the tomcat-users.xml file to define the users and roles (this is for now, like I said its small). Now, for authorization I'd like to be able to use the JSR 250 annotations like @RolesAllowed, @PermitAll, @DenyAll, etc. I cannot for the life of me figure out how to wire this all up together. I really don't want to go spring-security route, since I need something very simple at the current time. Can someone point me in the right direction.

  Read the article

• Very simple Error handling with NServiceBus

  - by andy

  hey guys, here's a simple scenario NServiceBus Client/Server setup. The "Message" is a custom Class I wrote. The Client sends a request message. The Server receives the message, and the server does this: Bus.Reply(new UserDataResponseMessage { ID = Guid.NewGuid(), Response = users }); Then nothing. The Client never receives a response. Exception: By trawling through the log4net NServiceBus logs I find an exception, and it turns out that my customs class "users" is not marked as Serializable. Ok, how does one got about "throwing" or "handling" that kind of error? NServiceBus seems to promote the idea of not handling errors, but in this scenario its obvious to see some kind of "throw" would have saved a lot of time. How do I handle such exceptions, where do they occur, where do they go?

  Read the article

• Co-Authors Wordpress Plugin: coauthors_wp_list_authors function not working correctly

  - by rayne

  The Co-Authors Plus Plugin for Wordpress has a very annoying bug. The custom function coauthors_wp_list_authors lists authors the same way the wordpress function wp_list_authors does, but it does not include authors in the list who don't have a post of their own - if they have only entries in which they are listed as co-author but not as author, they will not be included in the list. That is of course missing a very important point. I've looked at the faulty SQL statement, but unfortunately my knowledge of advanced SQL, especially when it comes to JOINs, as well as my knowledge of the wp database structure is too limited and I remain clueless. There is a topic in the WP support forum, but unfortunately the information there is very outdated and the fix is not applicable anymore. I couldn't find any other, more current solutions on the internet. I'd be glad if somewhere here could help fix the SQL statement so it also lists co-authors who don't have posts where they're the sole author, as well as display the correct post count for all authors. Here's the entire function for reference purposes with a comment marking the SQL statement: function coauthors_wp_list_authors($args = '') { global $wpdb, $coauthors_plus; $defaults = array( 'optioncount' => false, 'exclude_admin' => true, 'show_fullname' => false, 'hide_empty' => true, 'feed' => '', 'feed_image' => '', 'feed_type' => '', 'echo' => true, 'style' => 'list', 'html' => true ); $r = wp_parse_args( $args, $defaults ); extract($r, EXTR_SKIP); $return = ''; $authors = $wpdb->get_results("SELECT ID, user_nicename from $wpdb->users " . ($exclude_admin ? "WHERE user_login <> 'admin' " : '') . "ORDER BY display_name"); $author_count = array(); # this is the SQL statement which doesn't work correctly: $query = "SELECT DISTINCT $wpdb->users.ID AS post_author, $wpdb->terms.name AS user_name, $wpdb->term_taxonomy.count AS count"; $query .= " FROM $wpdb->posts"; $query .= " INNER JOIN $wpdb->term_relationships ON ($wpdb->posts.ID = $wpdb->term_relationships.object_id)"; $query .= " INNER JOIN $wpdb->term_taxonomy ON ($wpdb->term_relationships.term_taxonomy_id = $wpdb->term_taxonomy.term_taxonomy_id)"; $query .= " INNER JOIN $wpdb->terms ON ($wpdb->term_taxonomy.term_id = $wpdb->terms.term_id)"; $query .= " INNER JOIN $wpdb->users ON ($wpdb->terms.name = $wpdb->users.user_login)"; $query .= " WHERE post_type = 'post' AND " . get_private_posts_cap_sql( 'post' ); $query .= " AND $wpdb->term_taxonomy.taxonomy = '$coauthors_plus->coauthor_taxonomy'"; $query .= " GROUP BY post_author"; foreach ((array) $wpdb->get_results($query) as $row) { $author_count[$row->post_author] = $row->count; } foreach ( (array) $authors as $author ) { $link = ''; $author = get_userdata( $author->ID ); $posts = (isset($author_count[$author->ID])) ? $author_count[$author->ID] : 0; $name = $author->display_name; if ( $show_fullname && ($author->first_name != '' && $author->last_name != '') ) $name = "$author->first_name $author->last_name"; if( !$html ) { if ( $posts == 0 ) { if ( ! $hide_empty ) $return .= $name . ', '; } else $return .= $name . ', '; continue; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= '<li>'; if ( $posts == 0 ) { if ( ! $hide_empty ) $link = $name; } else { $link = '<a href="' . get_author_posts_url($author->ID, $author->user_nicename) . '" title="' . esc_attr( sprintf(__("Posts by %s", 'co-authors-plus'), $author->display_name) ) . '">' . $name . '</a>'; if ( (! empty($feed_image)) || (! empty($feed)) ) { $link .= ' '; if (empty($feed_image)) $link .= '('; $link .= '<a href="' . get_author_feed_link($author->ID) . '"'; if ( !empty($feed) ) { $title = ' title="' . esc_attr($feed) . '"'; $alt = ' alt="' . esc_attr($feed) . '"'; $name = $feed; $link .= $title; } $link .= '>'; if ( !empty($feed_image) ) $link .= "<img src=\"" . esc_url($feed_image) . "\" style=\"border: none;\"$alt$title" . ' />'; else $link .= $name; $link .= '</a>'; if ( empty($feed_image) ) $link .= ')'; } if ( $optioncount ) $link .= ' ('. $posts . ')'; } if ( !($posts == 0 && $hide_empty) && 'list' == $style ) $return .= $link . '</li>'; else if ( ! $hide_empty ) $return .= $link . ', '; } $return = trim($return, ', '); if ( ! $echo ) return $return; echo $return; }

  Read the article

• Psexec , cmd and batch file

  - by user311130

  Hello. I have a batch file named a.bat on a winserver2008 Desktop. That batch file only write the SessionID (from environment variable) to a local eventlog. I want to execute it remotely using cmd (otherwise the SessionName doesn't appear). so I have tried c:\PsTools\psexec.exe \\<Server> -u test2 -p <Password> -i 2 cmd "c:\Users\test-2\Desktop\a" or c:\PsTools\psexec.exe \\<server> -u test2 -p <Password> -i 2 "cmd \"c:\Users\test-2\Desktop\a\"";exit all of these just open a terminal on the remote machine but don't execute the batch. Any ides? Best Regards,

  Read the article

< Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >