Search Results

Search found 12601 results on 505 pages for 'z index'.

Page 441/505 | < Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >

  • Is this overly clever or unsafe?

    - by Liberalkid
    I was working on some code recently and decided to work on my operator overloading in c++, because I've never really implemented it before. So I overloaded the comparison operators for my matrix class using a compare function that returned 0 if LHS was less than RHS, 1 if LHS was greater than RHS and 2 if they were equal. Then I exploited the properties of logical not in c++ on integers, to get all of my compares in one line: inline bool Matrix::operator<(Matrix &RHS){ return ! (compare(*this,RHS)); } inline bool Matrix::operator>(Matrix &RHS){ return ! (compare((*this),RHS)-1); } inline bool Matrix::operator>=(Matrix &RHS){ return compare((*this),RHS); } inline bool Matrix::operator<=(Matrix &RHS){ return compare((*this),RHS)-1; } inline bool Matrix::operator!=(Matrix &RHS){ return compare((*this),RHS)-2; } inline bool Matrix::operator==(Matrix &RHS){ return !(compare((*this),RHS)-2); } Obviously I should be passing RHS as a const, I'm just probably not going to use this matrix class again and I didn't feel like writing another function that wasn't a reference to get the array index values solely for the comparator operation.

    Read the article

  • Cleaning up PHP Code

    - by Michael
    Hi, I've noticed I am a very sloppy coder and do things out of the ordinary. Can you take a look at my code and give me some tips on how to code more efficiently? What can I do to improve? session_start(); /check if the token is correct/ if ($_SESSION['token'] == $_GET['custom1']){ /*connect to db*/ mysql_connect('localhost','x','x') or die(mysql_error()); mysql_select_db('x'); /*get data*/ $orderid = mysql_real_escape_string($_GET['order_id']); $amount = mysql_real_escape_string($_GET['amount']); $product = mysql_real_escape_string($_GET['product1Name']); $cc = mysql_real_escape_string($_GET['Credit_Card_Number']); $length = strlen($cc); $last = 4; $start = $length - $last; $last4 = substr($cc, $start, $last); $ipaddress = mysql_real_escape_string($_GET['ipAddress']); $accountid = $_SESSION['user_id']; $credits = mysql_real_escape_string($_GET['custom3']); /*insert history into db*/ mysql_query("INSERT into billinghistory (orderid, price, description, credits, last4, orderip, accountid) VALUES ('$orderid', '$amount', '$product', '$credits', '$last4', '$ipaddress', '$accountid')"); /*add the credits to the users account*/ mysql_query("UPDATE accounts SET credits = credits + $credits WHERE user_id = '$accountid'"); /*redirect is successful*/ header("location: index.php?x=1"); }else{ /*something messed up*/ header("location: error.php"); }

    Read the article

  • Iphone - cannot grant permission for publishing on a Facebook page that i administer

    - by user323817
    I want to open a dialog on the IPhone so a user can grant my application permission to post on a Facebook page that the user administers. Following the docs, I can grant permissions for the user's stream and I can even post on a page that he is a fan of. However, the post on the page is listed as from the username, not on behalf of the page itself, even though he is an administrator of the page. According to the Prompting for Permissions section at: http://wiki.developers.facebook.com/index.php/Authorization_and_Authentication_for_Desktop_Applications I should be able to create a prompt on the IPhone for granting permission to publish_stream on a Facebook page that he administers. The sample url they give for a web "popup" dialog is: http://www.facebook.com/connect/prompt_permissions.php?api_key=YOURAPIKEY&v=1.0&next=http://www.facebook.com/connect/login_success.html?xxRESULTTOKENxx&display=popup&ext_perm=read_stream,publish_stream&enable_profile_selector=1&profile_selector_ids=1234%2C5454 This works as expected and a drop down of the pages is displayed. However, since my application is on the IPhone, I change the display=popup to display=touch. This does not seem to work and I've tried fiddling with the parameters several ways but the drop down never comes up. Anyone find a way around this? The popup option doesn't seem to work since I get an error trying to display it.

    Read the article

  • sort files by date in PHP

    - by sasori
    hi, I currently have an index.php file which allows me to output the list of files inside the same directory, the output shows the names then I used filemtime() function to show the date when the file was modified. my problem now is, how will I sort the output to show the latest modified file ?, I've been thinking for awhile how to do this. if only I am doing it with mysql interaction there will be no problem at all. please show me an example how to sort and output the list of files starting from the latest modified one. this is what i have for now if ($handle = opendir('.')) { while (false !== ($file = readdir($handle))) { if ($file != "." && $file != "..") { $lastModified = date('F d Y, H:i:s',filemtime($file)); if(strlen($file)-strpos($file,".swf")== 4){ echo "<tr><td><input type=\"checkbox\" name=\"box[]\"></td><td><a href=\"$file\" target=\"_blank\">$file</a></td><td>$lastModified</td></tr>"; } } } closedir($handle); }

    Read the article

  • ASP.NET MVC twitter/myspace style routing

    - by Astrofaes
    Hi guys, This is my first post after being a long-time lurker - so please be gentle :-) I have a website similar to twitter, in that people can sign up and choose a 'friendly url', so on my site they would have something like: mydomain.com/benjones I also have root level static pages such as: mydomain.com/about and of course my homepage: mydomain.com/ I'm new to ASP.NET MVC 2 (in fact I just started today) and I've set up the following routes to try and achieve the above. public static void RegisterRoutes(RouteCollection routes) { routes.IgnoreRoute("{resource}.axd/{*pathInfo}"); routes.IgnoreRoute("content/{*pathInfo}"); routes.IgnoreRoute("images/{*pathInfo}"); routes.MapRoute("About", "about", new { controller = "Common", action = "About" } ); // User profile sits at root level so check for this before displaying the homepage routes.MapRoute("UserProfile", "{url}", new { controller = "User", action = "Profile", url = "" } ); routes.MapRoute("Home", "", new { controller = "Home", action = "Index", id = "" } ); } For the most part this works fine, however, my homepage is not being triggered! Essentially, when you browser to mydomain.com, it seems to trigger the User Profile route with an empty {url} parameter and so the homepage is never reached! Any ideas on how I can show the homepage?

    Read the article

  • Sort ranges in an array in google apps script

    - by user1637113
    I have a timesheet spreadsheet for our company and I need to sort the employees by each timesheet block (15 rows by 20 columns). I have the following code which I had help with, but the array quits sorting once it comes to a block without an employee name (I would like these to be shuffled to the bottom). Another complication I am having is there are numerous formulas in these cells and when I run it as is, it removes them. I would like to keep these intact if at all possible. Here's the code: function sortSections() { var activeSheet = SpreadsheetApp.getActiveSheet(); //SETTINGS var sheetName = activeSheet.getSheetName(); //name of sheet to be sorted var headerRows = 53; //number of header rows var pageHeaderRows = 5; //page totals to top of next emp section var sortColumn = 11; //index of column to be sorted by; 1 = column A var pageSize = 65; var sectionSize = 15; //number of rows in each section var col = sortColumn-1; var sheet = SpreadsheetApp.getActive().getSheetByName(sheetName); var data = sheet.getRange(headerRows+1, 1, sheet.getMaxRows()-headerRows, sheet.getLastColumn()).getValues(); var data3d = []; var dataLength = data.length/sectionSize; for (var i = 0; i < dataLength; i++) { data3d[i] = data.splice(0, sectionSize); } data3d.sort(function(a,b){return(((a[0][col]<b[0][col])&&a[0][col])?-1:((a[0][col]>b[0][col])?1:0))}); var sortedData = []; for (var k in data3d) { for (var l in data3d[k]) { sortedData.push(data3d[k][l]); } } sheet.getRange(headerRows+1, 1, sortedData.length, sortedData[0].length).setValues(sortedData);

    Read the article

  • OCaml delimiters and scopes

    - by Jack
    Hello! I'm learning OCaml and although I have years of experience with imperative programming languages (C, C++, Java) I'm getting some problems with delimiters between declarations or expressions in OCaml syntax. Basically I understood that I have to use ; to concatenate expressions and the value returned by the sequence will be the one of last expression used, so for example if I have exp1; exp2; exp3 it will be considered as an expression that returns the value of exp3. Starting from this I could use let t = something in exp1; exp2; exp3 and it should be ok, right? When am I supposed to use the double semicol ;;? What does it exactly mean? Are there other delimiters that I must use to avoid syntax errors? I'll give you an example: let rec satisfy dtmc state pformula = match (state, pformula) with (state, `Next sformula) -> let s = satisfy_each dtmc sformula and adder a state = let p = 0.; for i = 0 to dtmc.matrix.rows do p <- p +. get dtmc.matrix i state.index done; a +. p in List.fold_left adder 0. s | _ -> [] It gives me syntax error on | but I don't get why.. what am I missing? This is a problem that occurs often and I have to try many different solutions until it suddently works :/ A side question: declaring with let instead that let .. in will define a var binding that lasts whenever after it has been defined? What I basically ask is: what are the delimiters I have to use and when I have to use them. In addition are there differences I should consider while using the interpreter ocaml instead that the compiler ocamlc? Thanks in advance!

    Read the article

  • Echoing users by group name in PHP

    - by BobSapp
    What I want to do is click a name of a group(every group what I create other than poweruser and admin groups) and that will echo all of the users in that group from the database. I have figured out the code so far but now my problem is how will I print it all out when clicking the name of the group? My code so far is: <h3>Groups</h3> <?php include('db.php'); if (isset($_GET["groupID"])) { $sql="SELECT `group`.*, `user`.* FROM `user` inner join `group` on group.groupID=user.groupID where group.groupID= " . mysql_real_escape_string($_GET["groupID"]) ; } else { $sql="SELECT * FROM `group` WHERE groupName <> 'admin' AND groupName <> 'poweruser'" ; } $result=mysql_query($sql,$connection); while($line=mysql_fetch_array($result)){ echo "<a href='index.php?page=groups&group=".$line['groupID']."'>".$line['groupName'].'</a><br />'; } mysql_free_result($result); mysql_close($connection); ?>

    Read the article

  • Out-of-memory algorithms for addressing large arrays

    - by reve_etrange
    I am trying to deal with a very large dataset. I have k = ~4200 matrices (varying sizes) which must be compared combinatorially, skipping non-unique and self comparisons. Each of k(k-1)/2 comparisons produces a matrix, which must be indexed against its parents (i.e. can find out where it came from). The convenient way to do this is to (triangularly) fill a k-by-k cell array with the result of each comparison. These are ~100 X ~100 matrices, on average. Using single precision floats, it works out to 400 GB overall. I need to 1) generate the cell array or pieces of it without trying to place the whole thing in memory and 2) access its elements (and their elements) in like fashion. My attempts have been inefficient due to reliance on MATLAB's eval() as well as save and clear occurring in loops. for i=1:k [~,m] = size(data{i}); cur_var = ['H' int2str(i)]; %# if i == 1; save('FileName'); end; %# If using a single MAT file and need to create it. eval([cur_var ' = cell(1,k-i);']); for j=i+1:k [~,n] = size(data{j}); eval([cur_var '{i,j} = zeros(m,n,''single'');']); eval([cur_var '{i,j} = compare(data{i},data{j});']); end save(cur_var,cur_var); %# Add '-append' when using a single MAT file. clear(cur_var); end The other thing I have done is to perform the split when mod((i+j-1)/2,max(factor(k(k-1)/2))) == 0. This divides the result into the largest number of same-size pieces, which seems logical. The indexing is a little more complicated, but not too bad because a linear index could be used. Does anyone know/see a better way?

    Read the article

  • jQuery preventing RedirectToAction from working?

    - by DaveDev
    I'm trying to redirect the user if they login successfully but the code I have on my page seems to be preventing the redirection from working. If I remove the jQuery below the redirection works. Can somebody tell me tell me if there's something I'm doing wrong? Thanks I have the following Action: [AcceptVerbs(HttpVerbs.Post)] public ActionResult Login(User user) { var myErrors = new Dictionary<string, string>(); try { if (ModelState.IsValid) { if (userRepository.ValidUser(user)) { return RedirectToAction("Index", "Group", new {page = (int?)null}); } else { return Json("Username or password seems to be incorrect"); } } else { foreach (KeyValuePair<string, ModelState> keyValuePair in ViewData.ModelState) { if (keyValuePair.Value.Errors.Count > 0) { List<string> errors = new List<string>(); myErrors.Add(keyValuePair.Key, keyValuePair.Value.Errors[0].ErrorMessage); } } return Json(myErrors); } } catch (Exception) { return Json("Invalid"); } } and the following code on my page: <script language="javascript" type="text/javascript"> $(document).ready(function() { $("#SaveSuccess").hide(); $("#btnLogin").click(function() { $("form").submit(function(event) { var formData = $(this).serialize(); $.post($(this).attr("action"), formData, function(res) { ShowErrors(res); if (res == true) { $("#SaveSuccess").text("Saved"); } else { $("#divError").html(res); } $("#SaveSuccess").fadeIn(100); }, "json"); return false; }); }); }); </script>

    Read the article

  • using facelet1.1.15 (external facelet) in JSF2

    - by Odelya
    Hi! I have upgrated to JSF2 but still running with facelet1.1.15. I have these parameters in web.xml: <context-param> <param-name>org.ajax4jsf.VIEW_HANDLERS</param-name> <param-value>com.sun.facelets.FaceletViewHandler</param-value> </context-param> <context-param> <param-name>javax.faces.DISABLE_FACELET_JSF_VIEWHANDLER</param-name> <param-value>true</param-value> </context-param> I am trying to create my own componet step by step of this example : http://www.ibm.com/developerworks/java/library/j-jsf2fu2/index.html#tip3 everything looks fine but i get an error that it doesn't recognize the tag. Has it got to do with the facelet 1.1.15? and it works only with VDL? it there a way to use 1.1.15 and custom components in JSF2? As well - I use tomcat 6

    Read the article

  • Why does my floating div push around other divs?

    - by Meke
    I have a div which has a table which has a google map. I want to place a info box within the google map external to the map, just floating on top But I can't seem to get it right, the info div just pushes around the google map despite being on top of the map... CSS .google_map { height: 270px; width: 100%; } #flightMapInfo { position: relative; float: left; z-index: 100; color: #FFFFFF; top: 30px; left: 50px; background:#5a85a5; padding: 5px; -moz-border-radius: 10px; -webkit-border-radius: 10px; } div.tabContent { border: 1px solid #c9c3ba; padding: 0.5em; background-color: #f1f0ee; min-height: 300px; } .tableLeft { width: 75%; float: left; border-right: dotted 2px black; } HTML <div class="mapBlock tabContent"> <div id="flightMapInfo">WHARGL</div> <table class="tableLeft"> <tr><td><div id="flightMap" class="google_map"></div> </table></td></tr></div>

    Read the article

  • Converting "A* Search" code from C++ to Java [on hold]

    - by mr5
    Updated! I get this code from this site It's A* Search Algorithm(finding shortest path with heuristics) I modify most of variable names and some if conditions from the original version to satisfy my syntactic taste. It works in C++ (as I can't see any trouble with it) but fails in Java version. Java Code: String findPath(int startX, int startY, int finishX, int finishY) { @SuppressWarnings("unchecked") LinkedList<Node>[] nodeList = (LinkedList<Node>[]) new LinkedList<?>[2]; nodeList[0] = new LinkedList<Node>(); nodeList[1] = new LinkedList<Node>(); Node n0; Node m0; int nlIndex = 0; // queueList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = new Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[nlIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[nlIndex].isEmpty() ) { LinkedList<Node> pq = nodeList[nlIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = new Node( pq.peek().getX(), pq.peek().getY(), pq.peek().getIterCount(), pq.peek().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[nlIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions String path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; int c = '0' + ( j + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; path = (char)c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < Node.DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!(xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( gridMap.getData( ydy, xdx ) == GridMap.WALKABLE || gridMap.getData( ydy, xdx ) == GridMap.FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = new Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[nlIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + Node.DIRECTION_COUNT / 2 ) % Node.DIRECTION_COUNT; // replace the node // by emptying one queueList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while( !(nodeList[nlIndex].peek().getX() == xdx && nodeList[nlIndex].peek().getY() == ydy ) ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nodeList[nlIndex].pop(); // remove the wanted node // empty the larger size queueList to the smaller one if( nodeList[nlIndex].size() > nodeList[ 1 - nlIndex ].size() ) nlIndex = 1 - nlIndex; while( !nodeList[nlIndex].isEmpty() ) { nodeList[1 - nlIndex].push( nodeList[nlIndex].pop() ); } nlIndex = 1 - nlIndex; nodeList[nlIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output1: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Misleading path) Output2: Changing these lines: n0 = new Node( a, b, c, d ); m0 = new Node( e, f, g, h ); to n0.set( a, b, c, d ); m0.set( e, f, g, h ); I get (I'm really confused) C++ Code: std::string A_Star::findPath(int startX, int startY, int finishX, int finishY) { typedef std::queue<Node> List_Container; List_Container nodeList[2]; // list of open (not-yet-tried) nodes Node n0; Node m0; int pqIndex = 0; // nodeList index // reset the node maps for(int y = 0;y < ROW_COUNT; ++y) { for(int x = 0;x < COL_COUNT; ++x) { close_nodes_map[y][x] = 0; open_nodes_map[y][x] = 0; } } // create the start node and push into list of open nodes n0 = Node( startX, startY, 0, 0 ); n0.updatePriority( finishX, finishY ); nodeList[pqIndex].push( n0 ); open_nodes_map[startY][startX] = n0.getPriority(); // mark it on the open nodes map // A* search while( !nodeList[pqIndex].empty() ) { List_Container &pq = nodeList[pqIndex]; // get the current node w/ the highest priority // from the list of open nodes n0 = Node( pq.front().getX(), pq.front().getY(), pq.front().getIterCount(), pq.front().getPriority()); int x = n0.getX(); int y = n0.getY(); nodeList[pqIndex].pop(); // remove the node from the open list open_nodes_map[y][x] = 0; // mark it on the closed nodes map close_nodes_map[y][x] = 1; // quit searching when the goal state is reached //if((*n0).estimate(finishX, finishY) == 0) if( x == finishX && y == finishY ) { // generate the path from finish to start // by following the directions std::string path = ""; while( !( x == startX && y == startY) ) { int j = dir_map[y][x]; char c = '0' + ( j + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; path = c + path; x += DIR_X[j]; y += DIR_Y[j]; } return path; } // generate moves (child nodes) in all possible directions for(int i = 0; i < DIRECTION_COUNT; ++i) { int xdx = x + DIR_X[i]; int ydy = y + DIR_Y[i]; // boundary check if (!( xdx >= 0 && xdx < COL_COUNT && ydy >= 0 && ydy < ROW_COUNT)) continue; if ( ( pGrid->getData(ydy,xdx) == WALKABLE || pGrid->getData(ydy, xdx) == FINISH) && close_nodes_map[ydy][xdx] != 1 ) { // generate a child node m0 = Node( xdx, ydy, n0.getIterCount(), n0.getPriority() ); m0.nextLevel( i ); m0.updatePriority( finishX, finishY ); // if it is not in the open list then add into that if( open_nodes_map[ydy][xdx] == 0 ) { open_nodes_map[ydy][xdx] = m0.getPriority(); nodeList[pqIndex].push( m0 ); // mark its parent node direction dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; } else if( open_nodes_map[ydy][xdx] > m0.getPriority() ) { // update the priority info open_nodes_map[ydy][xdx] = m0.getPriority(); // update the parent direction info dir_map[ydy][xdx] = ( i + DIRECTION_COUNT / 2 ) % DIRECTION_COUNT; // replace the node // by emptying one nodeList to the other one // except the node to be replaced will be ignored // and the new node will be pushed in instead while ( !( nodeList[pqIndex].front().getX() == xdx && nodeList[pqIndex].front().getY() == ydy ) ) { nodeList[1 - pqIndex].push( nodeList[pqIndex].front() ); nodeList[pqIndex].pop(); } nodeList[pqIndex].pop(); // remove the wanted node // empty the larger size nodeList to the smaller one if( nodeList[pqIndex].size() > nodeList[ 1 - pqIndex ].size() ) pqIndex = 1 - pqIndex; while( !nodeList[pqIndex].empty() ) { nodeList[1-pqIndex].push(nodeList[pqIndex].front()); nodeList[pqIndex].pop(); } pqIndex = 1 - pqIndex; nodeList[pqIndex].push( m0 ); // add the better node instead } } } } return ""; // no route found } Output: Legends . = PATH ? = START X = FINISH 3,2,1 = OBSTACLES (Just right) From what I read about Java's documentation, I came up with the conclusion: C++'s std::queue<T>::front() == Java's LinkedList<T>.peek() Java's LinkedList<T>.pop() == C++'s std::queue<T>::front() + std::queue<T>::pop() What might I be missing in my Java version? In what way does it became different algorithmically from the C++ version?

    Read the article

  • No event is firing when placing a custom data bound control in DataRepeater control in Windows forms

    - by Remo
    Hi, Custom events in a custom data bound control are not firing in DataRepeater control. When I debug it I found that the DataRepeater Control recreates the control using Activator.CreateInstance and Copies the Properties and Events. In my case copying events doesn't copy the custom events that I hooked in. For example public class MyClass : Control { public event EventHandler MyEvent; protected virtual void OnMyEvent() { if(this.MyEvent != null) { this.MyEvent(this,EventArgs.Empty); } } private int selectedIndex= -1; public int SelectedIndex { get { return this.selectedIndex; } set { if(this.selectedIndex != value) { this.selectedIndex = value; this.OnMyEvent(); } } } // // DataBinding stuff goes here // } public Form1() { InitialiseComponent(); ArrayList list = new ArrayList(); list.Add("one"); this.dataRepeater1.DataSource = list; // One Repeater MyClass test = new Myclass(); test.DataSource = GetDataTable(); this.dataRepeater1.ItemTemplate.Controls.Add(test); test.MyEvent +=new EventHandler(test_MyEvent); } // This Event should fire when selected index of Datatable is changed and is firing when placed directly in the form and not firing when place in DataRepeater control/////////////////////// private void test_MyEvent(object sender, EventArgss e) { // This event is not fired/////////////////////// } private DataTable GetDataTable() { ..// Create a data Table and return } Any help Appreciated. Thanks,

    Read the article

  • Issue with transparent texture on 3D primitive, XNA 4.0

    - by Bevin
    I need to draw a large set of cubes, all with (possibly) unique textures on each side. Some of the textures also have parts of transparency. The cubes that are behind ones with transparent textures should show through the transparent texture. However, it seems that the order in which I draw the cubes decides if the transparency works or not, which is something I want to avoid. Look here: cubeEffect.CurrentTechnique = cubeEffect.Techniques["Textured"]; Block[] cubes = new Block[4]; cubes[0] = new Block(BlockType.leaves, new Vector3(0, 0, 3)); cubes[1] = new Block(BlockType.dirt, new Vector3(0, 1, 3)); cubes[2] = new Block(BlockType.log, new Vector3(0, 0, 4)); cubes[3] = new Block(BlockType.gold, new Vector3(0, 1, 4)); foreach(Block b in cubes) { b.shape.RenderShape(GraphicsDevice, cubeEffect); } This is the code in the Draw method. It produces this result: As you can see, the textures behind the leaf cube are not visible on the other side. When i reverse index 3 and 0 on in the array, I get this: It is clear that the order of drawing is affecting the cubes. I suspect it may have to do with the blend mode, but I have no idea where to start with that.

    Read the article

  • How to start matching and saving matched from exact point in a text

    - by yuliya
    I have a text and I write a parser for it using regular expressions and perl. I can match what I need with two empty lines (I use regexp), because there is a pattern that allows recognize blocks of text after two empty lines. But the problem is that the whole text has Introduction part and some text in the end I do not need. Here is a code which matches text when it finds two empty lines #!/usr/bin/perl use strict; use warnings; my $file = 'first'; open(my $fh, '<', $file); my $empty = 0; my $block_num = 1; open(OUT, '>', $block_num . '.txt'); while (my $line = <$fh>) { chomp ($line); if ($line =~ /^\s*$/) { $empty++; } elsif ($empty == 2) { close(OUT); open(OUT, '>', ++$block_num . '.txt'); $empty = 0; } else { $empty = 0;} print OUT "$line\n"; } close(OUT); This is example of the text I need (it's really small :)) this is file example I think that I need to iterate over the text till the moment it will find the word LOREM IPSUM with regexps this kind "/^LOREM IPSUM/", because it is the point from which needed text starts(and save the text in one file when i reach the word). And I need to finish iterating over the text when INDEX word is fount or save the text in separate file. How could I implement it. Should I use next function to proceed with lines or what? BR, Yuliya

    Read the article

  • get path of Array (PHP)

    - by Kawah Grafis
    i have an array input like this .. Array ( [0] => Array ( [0] => 42 ) [**42**] => Array ( [0] => 12 [1] => 14 ) [**14**] => Array ( [0] => 317 ) [317] => Array ( [0] => 319 ) [**12**] => Array ( [0] => 306 [1] => 307 ) [307] => Array ( [0] => 311 ) [306] => Array ( [0] => 309 ) ) and i want to get result array like bellow : $paths[]=array(42,12,306,309); $paths[]=array(42,12,307,311); $paths[]=array(42,14,317,319); see array input root in array input = 42 (index of array 0) 42 have child = 12, 14 12 have child = 306, 307 14 have child = 317 306 have child = 309 307 have child = 311 317 have child = 319 like this.. and output array insert into $paths $paths[0]=array(42,12,306,309); $paths[1]=array(42,12,307,311); $paths[2]=array(42,14,317,319);

    Read the article

  • jquery tabbed interface breaks when using images

    - by Steve
    hello all, using jquery to create a tabbed interface. coding is quite typical: html: <div id="tabbed-interface"> <ul> <li><a href="#option1">Option1</a></li> <li><a href="#option2">Option2</a></li> <li><a href="#option3">Option3</a></li> </ul> </div> jquery: $(document).ready(function(){ $('#tabbed-interface li:first').addClass('active'); $('#tabbed-interface div').not(':first').hide(); $('#tabbed-interface>ul>li>a').click(function(event){ $('#tabbed-interface>ul>li').removeClass('active'); $(event.target).parent().addClass('active'); $('#tabbed-interface>div').fadeOut().filter(this.hash).fadeIn(250); return false;});}); css: ul li {background: #232323; list-style: none; border: 1px solid #616161; } ul li.active {background: none; list-style: none; border: 1px solid: #616161; border-bottom: 1px solid #121212; z-index: 1; } as you can see, all this does is add the class 'active' to the li that is clicked, and this corresponds to whether a background is shown or not. this works perfectly with text, but i am required to use non standard fonts. when i try to side step the issue using transparent .png images, it is unreliable. For instance, changing the HTML to: <div id="tabbed-interface"> <ul> <li><a href="#option1"><img src="option1.png" /></a></li>

    Read the article

  • Codeigniter only loads the default controller

    - by fh47331
    I am very new to CodeIgniter, but have been programming PHP for ages. I'm writing some software at the moment and using CI for the first time with it. The default controller is set to the first controller I want to action call 'login' (the controller is login.php, the view is login.php. When the form is submitted it calls the 'authenticate' controller. This executes fine, process the login data correctly and then does a redirect command (without any output to the screen prior) to the next page in this case 'newspage'. The problem is that the redirect, never reaches 'newspage' but the default controller runs again. It doesn't matter what I put ... ht tp://domain.name/anything ... (yes im using .htaccess to remove the index.php) the anything never gets called, just the default controller. I have left the standard 'welcome.php' controller and 'welcome_message.php' in the folders and even putting ht tp://domain.name/welcome all I get is the login screen! (Obviously there shouldn't be a space between the http - thats just done so it does not show as a hyperlink!) Can anyone tell me what i've done wrong!

    Read the article

  • grails question (sample 1 of Grails To Action book) problem with Controller and Service

    - by fegloff
    Hi, I'm doing Grails To Action sample for chapter one. Every was just fine until I started to work with Services. When I run the app I have the following error: groovy.lang.MissingPropertyException: No such property: quoteService for class: qotd.QuoteController at qotd.QuoteController$_closure3.doCall(QuoteController.groovy:14) at qotd.QuoteController$_closure3.doCall(QuoteController.groovy) at java.lang.Thread.run(Thread.java:619) Here is my groovie QuoteService class, which has an error within the definition of GetStaticQuote (ERROR: Groovy:unable to resolve class Quote) package qotd class QuoteService { boolean transactional = false def getRandomQuote() { def allQuotes = Quote.list() def randomQuote = null if (allQuotes.size() > 0) { def randomIdx = new Random().nextInt(allQuotes.size()) randomQuote = allQuotes[randomIdx] } else { randomQuote = getStaticQuote() } return randomQuote } def getStaticQuote() { return new Quote(author: "Anonymous",content: "Real Programmers Don't eat quiche") } } Controller groovie class package qotd class QuoteController { def index = { redirect(action: random) } def home = { render "<h1>Real Programmers do not each quiche!</h1>" } def random = { def randomQuote = quoteService.getRandomQuote() [ quote : randomQuote ] } def ajaxRandom = { def randomQuote = quoteService.getRandomQuote() render "<q>${randomQuote.content}</q>" + "<p>${randomQuote.author}</p>" } } Quote Class: package qotd class Quote { String content String author Date created = new Date() static constraints = { author(blank:false) content(maxSize:1000, blank:false) } } I'm doing the samples using Eclipse with grails addin. Any advice? Regards, Francisco

    Read the article

  • qTip pop ups come in from top left of screen (on first load)

    - by franko75
    Hi, not sure if i'm set things up incorrectly - I don't seem to see anyone else with this problem, but my qTip popups (all ajax loaded content) are loading quite erratically, in that they are often animating in from off screen before appearing in the correct position. Is there a simple solution to this which I may have missed? Thanks again for your help. HTML markup: <span class="formInfo"> <a href="http://localhost/httpdocs/index.php/help/kc_dob" class="jTip" name="" id="dob_help">?</a> </span> qTip initialisation.. //set up for qtip function initQtip() { $('a.jTip').each(function() { $(this).qtip( { content: { // Set the text to an image HTML string with the correct src URL to the loading image you want to use text: '<img src="/media/images/wait.gif" alt="Loading..." />', url: $(this).attr('href') // Use the rel attribute of each element for the url to load }, position: { adjust: { screen: true // Keep the tooltip on-screen at all times } }, show: { when: 'click', solo: true // Only show one tooltip at a time }, hide: 'unfocus', style: { tip: true, // Apply a speech bubble tip to the tooltip at the designated tooltip corner border: { width: 10, radius: 10 }, width: { min: 200, max: 500 }, name: 'light' // Use the default light style } }); //prevent default event on click }).bind('click', function(event){ event.preventDefault(); return false; }); }

    Read the article

  • Show iPad keyboard on select, focus or always (jQuery)

    - by Ryan
    I have a web app that is using jQuery to replace the RETURN key with TAB so that when I user presses return the form is not submitted but rather the cursor moves to the next text field. This works in all browsers but only 1/2 works on the iPad. On the iPad the next field is highlighted but the keyboard is hidden. How can I keep the keyboard visible or force it somehow? Here's my code (thanks to http://thinksimply.com/blog/jquery-enter-tab): function checkForEnter (event) { if (event.keyCode == 13) { currentBoxNumber = textboxes.index(this); if (textboxes[currentBoxNumber + 1] != null) { nextBox = textboxes[currentBoxNumber + 1] nextBox.focus(); nextBox.select(); event.preventDefault(); return false; } } } Drupal.behaviors.formFields = function(context) { $('input[type="text"]').focus(function() { $(this).removeClass("idleField").addClass("focusField"); }); $('input[type="text"]').blur(function() { $(this).removeClass("focusField").addClass("idleField"); }); // replaces the enter/return key function with tab textboxes = $("input.form-text"); if ($.browser.mozilla) { $(textboxes).keypress (checkForEnter); } else { $(textboxes).keydown (checkForEnter); } };

    Read the article

  • Why cant Git merge file changes with a modified parent/master.

    - by Andy
    I have a file with one line in it. I create a branch and add a second line to the same file. Save and commit to the branch. I switch back to the master. And add a different, second line to the file. Save and commit to the master. So there's now 3 unique lines in total. If I now try and merge the branch back to the master, it suffers a merge conflict. Why cant Git simple merge each line, one after the other? My attempt at merge behaves something like this: PS D:\dev\testing\test1> git merge newbranch Auto-merging hello.txt CONFLICT (content): Merge conflict in hello.txt Automatic merge failed; fix conflicts and then commit the result. PS D:\dev\testing\test1> git diff diff --cc hello.txt index 726eeaf,e48d31a..0000000 --- a/hello.txt +++ b/hello.txt @@@ -1,2 -1,2 +1,6 @@@ This is the first line. - New line added by master. -Added a line in newbranch. ++<<<<<<< HEAD ++New line added by master. ++======= ++Added a line in newbranch. ++>>>>>>> newbranch Is there a way to make it slot lines in automatically, one after the other?

    Read the article

  • Why doesn't this PHP execute?

    - by cam
    I copied the code from this site exactly: http://davidwalsh.name/web-service-php-mysql-xml-json as follows, /* require the user as the parameter */ if(isset($_GET['user']) && intval($_GET['user'])) { /* soak in the passed variable or set our own */ $number_of_posts = isset($_GET['num']) ? intval($_GET['num']) : 10; //10 is the default $format = strtolower($_GET['format']) == 'json' ? 'json' : 'xml'; //xml is the default $user_id = intval($_GET['user']); //no default /* connect to the db */ $link = mysql_connect('localhost','username','password') or die('Cannot connect to the DB'); mysql_select_db('db_name',$link) or die('Cannot select the DB'); /* grab the posts from the db */ $query = "SELECT post_title, guid FROM wp_posts WHERE post_author = $user_id AND post_status = 'publish' ORDER BY ID DESC LIMIT $number_of_posts"; $result = mysql_query($query,$link) or die('Errant query: '.$query); /* create one master array of the records */ $posts = array(); if(mysql_num_rows($result)) { while($post = mysql_fetch_assoc($result)) { $posts[] = array('post'=>$post); } } /* output in necessary format */ if($format == 'json') { header('Content-type: application/json'); echo json_encode(array('posts'=>$posts)); } else { header('Content-type: text/xml'); echo '<posts>'; foreach($posts as $index => $post) { if(is_array($post)) { foreach($post as $key => $value) { echo '<',$key,'>'; if(is_array($value)) { foreach($value as $tag => $val) { echo '<',$tag,'>',htmlentities($val),'</',$tag,'>'; } } echo '</',$key,'>'; } } } echo '</posts>'; } /* disconnect from the db */ @mysql_close($link); } And the php doesn't execute, it just displays as plain text. What's the dealio? The host supports PHP, I use it to run a Wordpress blog and other things.

    Read the article

  • string comparision and counting the key in target [closed]

    - by mesun
    Suppose we want to count the number of times that a key string appears in a target string. We are going to create two different functions to accomplish this task: one iterative, and one recursive. For both functions, you can rely on Python's find function - you should read up on its specifications to see how to provide optional arguments to start the search for a match at a location other than the beginning of the string. For example, find("atgacatgcacaagtatgcat","atgc") #returns the value 5, while find("atgacatgcacaagtatgcat","atgc",6) #returns the value 15, meaning that by starting the search at index 6, #the next match is found at location 15. For the recursive version, you will want to think about how to use your function on a smaller version of the same problem (e.g., on a smaller target string) and then how to combine the result of that computation to solve the original problem. For example, given you can find the first instance of a key string in a target string, how would you combine that result with invocation of the same function on a smaller target string? You may find the string slicing operation useful in getting substrings of string.

    Read the article

< Previous Page | 437 438 439 440 441 442 443 444 445 446 447 448  | Next Page >