Search Results

Search found 7724 results on 309 pages for 'backbone js'.

Page 45/309 | < Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >

  • Reading HTML header info of files via JS

    - by Morten Repsdorph Husfeldt
    I have a product list that is generated in ASP. I have product descriptions for each product in an HTML file. Each HTML file is named: <product.id>.html. Each HTML file size is only 1-3 kb. Within the HTML file is <title> and <meta name="description" content="..." />. I want to access these in an efficient way so that I can output this as e.g.: document.write(<product.id>.html.title);<br/> document.write(<product.id>.html.description); I have a working solution for the individual products, where I use the description file - but I hope to find a more efficient / simple approach. Preferably, I want to avoid having 30+ hidden iframes - Google might think that I am trying to tamper with search result and blacklist my page. Current code: <script type="text/javascript"> document.getElementById('produkt').onload = function(){ var d = window.frames[frame].document; document.getElementById('pfoto').title = d.title : ' '; document.getElementById('pfoto').alt = d.getElementsByName('description')[0].getAttribute('content', 0) : ' '; var keywords = d.getElementsByName('keywords')[0].getAttribute('content', 0) : ' '; }; </script>

    Read the article

  • Query parameter using JS framework ?

    - by Maxim Veksler
    Hi, I seem to not be able to find implementation from the common Ajax libraries (JQuery, mootools, prototypejs...) that would allow the operation of parsing the window.location.href for request parameter. I would expect something like: $P{"param1"} == "param1_value" Am I missing something? p.s. The web does contains implementation examples for such operations

    Read the article

  • html/js: Refresh 'Select' options

    - by framara
    Hi, There's a class 'Car' with brand and model as properties. I have a list of items of this class List<Car> myCars. I need to represent in a JSP website 2 ComboBox, one for brand and another for model, that when you select the brand, in the model list only appear the ones from that brand. I don't know how to do this in a dynamic way. Any suggestion where to start? Thanks Update Ok, what I do now is send in the request a list with all the brand names, and a list of the items. The JSP code is like: <select name="manufacturer" id="id_manufacturer" onchange="return getManufacturer();"> <option value=""></option> <c:forEach items="${manufacturers}" var="man"> <option value="${man}" >${man}</option> </c:forEach> </select> <select name="model" id="id_model"> <c:forEach items="${mycars}" var="car"> <c:if test="${car.manufacturer eq man_selected}"> <option value="${car.id}">${car.model}</option> </c:if> </c:forEach> </select> <script> function getManufacturer() { man_selected = document.getElementById('id_manufacturer').value; } </script> How do I do to refresh the 'model' select options according to the selected 'man_selected' ?

    Read the article

  • Kill unload function in JS?

    - by Newbie
    Hello! Is there a way to kill the unload function with javascript(jquery)? I am looking for something like this: window.onbeforeunload = function(){ confirm("Close?") } or in jquery: $(window).unload(function() { confirm("close?") }); Now, on window unload I get my confirm alert but it will continue in any case. Clicking cancel it won't stay on my page. Can U help me plz?

    Read the article

  • JS variable scope missunderstanding

    - by meo
    I have a little problem: slideHelpers.total = 4 for (i=1;i <= slideHelpers.total; i++) { $('<a href="#">' + i + '</a>').bind('click', function(){ alert('go to the ' + i + ' slide')}).appendTo('.slideaccess') } the alert gives out 5 what is logic, because when the function click triggers i is actually 5. But i would like to have the same i as in my <a> tag. What is the best way to handle this? I could put i in the data() of the <a> tag for example but i am sure there is a easier way.

    Read the article

  • how to get the values dynamically in js

    - by jeessy
    hi having problem with my id iam making my website for health product. already we have a 10 products with corresponding amounts in this section customer choose the product through drop down box. in next we are getting service charges from customer by clicking radio buttons. we have a three radio buttons with name=add and three amount value like 5$ 7$ 9$. It is working fine. for example: customer selected 3 produts in the sense that total amount around 20$ after customer clicks this radio button(any) and submit button that amount will add with totally in next page ie 25$ what i want is that radio button amount should add with get payment then display the page dynamically. function checkRadio (frmName, rbGroupName) { var radios = document[frmName].elements[rbGroupName]; for (var i=0; i < radios.length; i++) { if(radios[i].checked) { return true; } } return false; } $(document).ready(function(){ $("input[name='rmr']").click(function() { updatePayment($(this).val()); if (!!$(this).attr("checked") == true) { $("#finalamount").html( parseInt($("#totalamount").val(), 10) * parseInt($(this).val(), 10)); } }); } this code is right or wrong. thanks in adv

    Read the article

  • Is it possible to use template and value at the same time on data-bind?

    - by Anonymous
    I have two sections of code. Code #1: <select data-bind="options: operatingSystems, optionsText: function (item) { return item.Name }, value: selectedOperatingSystem"></select> Code #2: <script type="text/html" id="os-template-detail"> <option data-bind="text: Name" class="body-text"></option> </script> <select data-bind="value: selectedOperatingSystem, template: { name: 'os-template-detail', foreach: operatingSystems }"></select> Both shows data from json correctly. With code #1, it updates the value when I select an item on the list while code #2 does not update anything when I change the item. I am pretty new to Knockout.js and have no idea why Code #2 doesn't work. Is it the limitation of Knockout that preventing me from using template and value at the same time?

    Read the article

  • A brief question about JS or AJAX

    - by Luke
    I have been finding ways around this for a long time but think it's time I addressed it. If I have a page that has a dropdown menu, is there anyway I can select a value which will subsequently load other values further down. Can this be done without a page reload? I will give you an example. Say I was making some tools for an admin panel, but first of all they needed to select a member to work with. They would select the member and then below, the fields about that member would be populated based on what was selected in the first menu. As I have already asked, can this be done without a page reload? Thanks for reading.

    Read the article

  • getting the names of elements in JS/jQuery

    - by Mala
    I have some checkbox inputs like so: <input type="checkbox" name="1" class="filter"/> <input type="checkbox" name="2" class="filter"/> ...etc... I'm trying to write a function where any time a checkbox is selected, it generates a string with all the names concatenated. Here's what I have so far: $('.filter').click(function(event){ var filters = $('.filter').toArray(); var fstr = ""; for (f in filters) { fstr = fstr+","+f.name; } alert(fstr); }); The names keep coming up as 'undefined', though (i.e. the alert returns ,undefined,undefined,undefined,undefined,undefined,undefined). How do I access the names?

    Read the article

  • Force download through markup or JS

    - by mschoening
    Lets assume I have a file on a CDN (Cloud Files from Rackspace) and a static html page with a link to that file. Is there any way I can force download this file (to prevent it from opening in the browser -- for mp3s for example)? We could make our server read the file and set the corresponding header to: header("Content-Type: application/force-download") but we have about 5 million downloads per month so we would rather let the CDN take care of that. Any ideas?

    Read the article

  • regular expression on replace method of js not working

    - by user950146
    why this is not working var value = arr[row][col].replace(new RegExp('"', 'g'),'""'); Error : Webpage error details User Agent: Mozilla/4.0 (compatible; MSIE 8.0; Windows NT 6.1; Trident/4.0; SLCC2; .NET CLR 2.0.50727; .NET CLR 3.5.30729; .NET CLR 3.0.30729; Media Center PC 6.0; InfoPath.2; Tablet PC 2.0) Timestamp: Tue, 10 Apr 2012 11:22:01 UTC Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Message: Object doesn't support this property or method Line: 1041 Char: 25 Code: 0 URI: http://example.com/? Note: : Error copied directly from debugger of IE8

    Read the article

  • passing dynamic values in callback method

    - by swastican
    is there a way to pass dynamic values to callback function in js or jquery or nodejs. for(var i = 0; i < 10; i++) { filename = 'file'+i+'.html'; request(url, function(error, response, body) { test(error, response, body, filename); }); function test(error, response, body, filename) { console.log('file name ' + filename); if(response.statusCode == 200){ console.log('done'); } } I refered this so article for passing values to callback function. link: [JavaScript: Passing parameters to a callback function the output always seems to be 9 How can i pass values dynamically? The callback function always refers the last value of filename.

    Read the article

  • Understanding NoSQL Data Modeling - blog application

    - by Rushabh RajeshKumar Padalia
    I am creating an blogging application in Node.js + MongoDB Database. I have used relational Database like MySQL before but this is my first experience with NoSQL database. So I would like to conform my MongoDB data models before I move further. I have decided my blogDB to have 3 collections post_collection - stores information about that article comment_collection - store information about comments on articles user_info_collection - contains user inforamtion PostDB { _"id" : ObjectID(...), "author": "author_name", "Date": new Date(....), "tag" : ["politics" , "war"], "post_title": "My first Article", "post_content": "Big big article" "likes": 23 "access": "public" } CommentDB { "_id" : Objectid(...), "POST": "My First Article", "comment_by": "User_name", "comment": "MY comments" } UserInfoDB { "_id": ObjectID(...), "user": "User_name", "password": "My_password" } I would appreciate your comments.

    Read the article

  • [DOM/JS] display table in IE

    - by budzor
    I have code like that: var xPola = 10, //how many cols yPola = 10, //how many cols bokPola = 30, //size of cell body = document.getElementsByTagName('body')[0]; var tablica = document.createElement('table'); body.appendChild(tablica); for( var y = 0; y < yPola; y++ ) { var rzad = document.createElement('tr'); tablica.appendChild(rzad); for( var x = 0; x < xPola; x++ ) { var pole = document.createElement('td'); pole.setAttribute('width', bokPola); pole.setAttribute('height', bokPola); rzad.appendChild(pole); } }; it works fine in FF, Chrome & Opera (it displays 10x10 table with 30px width&height rows). In IE nothing happens. I check in firebug lite and it is in HTML section, inside BODY tag but i see nothing. Whats wrong?

    Read the article

  • Javascript object encapsulation that tracks changes

    - by Raynos
    Is it possible to create an object container where changes can be tracked Said object is a complex nested object of data. (compliant with JSON). The wrapper allows you to get the object, and save changes, without specifically stating what the changes are Does there exist a design pattern for this kind of encapsulation Deep cloning is not an option since I'm trying to write a wrapper like this to avoid doing just that. The solution of serialization should only be considered if there are no other solutions. An example of use would be var foo = state.get(); // change state state.update(); // or state.save(); client.tell(state.recentChange()); A jsfiddle snippet might help : http://jsfiddle.net/Raynos/kzKEp/ It seems like implementing an internal hash to keep track of changes is the best option. [Edit] To clarify this is actaully done on node.js on the server. The only thing that changes is that the solution can be specific to the V8 implementation.

    Read the article

  • Toastr.js notifications as modal notfication

    - by Maxsteel
    I know it's not what toastr (or toast notifs in general) are meant to be used for, but I want to use them as a modal notification. My idea is following. On toast show: toastr.options.onShown = function() { //Create an overlay on the entire page} Overlay: #overlay { background-color: rgba(0, 0, 0, 0.8); z-index: 999; position: absolute; left: 0; top: 0; width: 100%; height: 100%; display: none; } And on toast close: toastr.options.onHidden = function() { //make overlay go away } Also, I'm setting timeout of toast to 0 so it won't disappear by itself. Question: I want the toast notification to stay atop the overlay and not behind it as overlay will cover everything. How can I do it?

    Read the article

  • Angular.js: value() not injected in config()

    - by Nik
    I am having trouble getting the value() injected into the app.config(). Here's the code (coffeescript) window.app = angular.module("app", []) app.value("template_path", "assets/angular/templates/users") app.config(["$routeProvider","template_path" ($routeProvider, template_path) -> console.log template_path it is throwing an "Unknown provider: template_path from app" error Could it be that the config() method cannot be injected with value() set values? I am using 1.0.2 Thank you!

    Read the article

  • Issue pushing object into an array JS

    - by Javacadabra
    I'm having an issue placing an object into my array in javascript. This is the code: $('.confirmBtn').click(function(){ //Get reference to the Value in the Text area var comment = $("#comments").val(); //Create Object var orderComment = { 'comment' : comment }; //Add Object to the Array productArray.push(orderComment); //update cookie $.cookie('order_cookie', JSON.stringify(productArray), { expires: 1, path: '/' }); }); However when I print the array this is the output: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] => TEST TEST ) I would like it to look like this: Array ( [0] => Array ( [stockCode] => CBL202659/A [quantity] => 8 ) [1] => Array ( [stockCode] => CBL201764 [quantity] => 6 ) [2] Array( [comment] => TEST TEST ) I added products to the array in a similar way and it worked fine: var productArray = []; // Will hold order Items $(".orderBtn").click(function(event){ //Check to ensure quantity > 0 if(quantity == 0){ console.log("Quantity must be greater than 0") }else{//It is so continue //Show the order Box $(".order-alert").show(); event.preventDefault(); //Get reference to the product clicked var stockCode = $(this).closest('li').find('.stock_code').html(); //Get reference to the quantity selected var quantity = $(this).closest('li').find('.order_amount').val(); //Order Item (contains stockCode and Quantity) - Can add whatever data I like here var orderItem = { 'stockCode' : stockCode, 'quantity' : quantity }; //Check if cookie exists if($.cookie('order_cookie') === undefined){ console.log("Creating new cookie"); //Add object to the Array productArray.push(orderItem);

    Read the article

  • PHP or JS to connect with fingerprint scanner save to database

    - by narong
    I have a project to set profile user and save all data to database include fingerprint also. i don't what i should start, I have USB finger scanner already to test. What i think: i should have a input box to read data from USB finger scanner than i should create a function to upload it database. but with this thinking i meet problem: i don't know data that get from USB finger scanner is image or data? if image, how i can read it to input box to save to database ? Anyone have any idea, please share me to resolve it. I am looking to see your helping soon! thanks

    Read the article

  • Splitting Nucleotide Sequences in JS with Regexp

    - by TEmerson
    I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts. For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results. I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

    Read the article

< Previous Page | 41 42 43 44 45 46 47 48 49 50 51 52  | Next Page >